Gene expression analysis to identify mRNA markers of cardiac myxoma

Journal of Molecular and Cellular Cardiology 37 (2004) 717–733 www.elsevier.com/locate/yjmcc

Original Article

Gene expression analysis to identify mRNA markers of cardiac myxoma A.V. Skamrov a,*, M.A. Nechaenko b, L.E. Goryunova a, E.S. Feoktistova a, G.L. Khaspekov a, D.A. Kovalevsky a, L.I. Vinnitsky b, G.F. Sheremeteva b, R. Sh. Beabealashvilli a a

National Cardiology Research Center, Ministry of Health of the Russian Federation, 3rd Cherepkovskaya street 15A, Moscow 121552, Russia b Research Center of Surgery, Russian Academy of Medical Sciences, Abrikosovsky per. 2, Moscow 119874, Russia Received 30 September 2003; received in revised form 26 May 2004; accepted 9 June 2004 Available online 31 July 2004

Abstract cDNA expression arrays were used to identify mRNA expression markers for cardiac myxoma. The RNA profile analysis suggests that cardiac myxoma should be considered as a stand-alone tissue rather than a pathological modification of particular normal tissue. The analysis reveals a set of genes which are highly and steadily expressed in cardiac myxomas and can serve as an mRNA expression markers of the tumour. Marker status of selected genes was confirmed by reverse transcriptase polymerase chain reaction analysis. Genes MIA (melanoma inhibitory activity) and PLA2G2A (phospholipase A2, group IIA) show the highest specificity as cardiac myxoma markers, since they have more than 10-fold higher RNA level in cardiac myxomas than in any one of 15 normal tissues tested. Among markers of myxoma at least three are participants of phospholipid metabolism: ANXA3, PLA2G2A, and phospholipid transfer protein . Tissue inhibitor of metalloproteinase 1 and secretory leucocyte protease inhibitor are inhibitors of proteases degrading extracellular matrix proteins and participating in cell proliferation regulation. MIA, SPP1, fibromodulin are modulators or participants of the interaction between extracellular matrix proteins and their cell surface receptors. SOX9 is a transcription factor required for chondrocyte differentiation. Calretenin (CALB2) is an intracellular calcium-binding protein with poorly understood function. © 2004 Elsevier Ltd. All rights reserved. Keywords: Cardiac myxoma; Expression marker; Array; PLA2G2A; MIA; PLTP; TIMP1; CALB2; SLPI; SPP1; SOX9; ANXA3; FMOD

1. Introduction Primary cardiac neoplasms are rare in humans [1,2]. Cardiac myxoma is the commonest benign heart tumour which is frequently found in the left atrium (about 86% of the lesions). Cardiac myxoma can be a sporadic lesion (93% of cases) and usually occurs in women over 30 years [2–4]. Treatment is surgical excision with very low risk of a second myxoma developing after resection. Cardiac myxoma can also be a component of autosomal dominant syndrome called Carney complex (CNC, OMIM 160980, and OMIM 605244). Carney complex is characterized by spotty pigmentation (blue naevi and lentigines), myxomas (cardiac, cutaneous, and mammary), endocrine over-activity (Cushing’s syndrome and acromegaly), testicular tumours, and schwannomas [5,6]. Cardiac myxomas of Carney complex are histologi* Corresponding author. Tel.: +7-095-414-65-39; fax : +7-095-414-67-27. E-mail address: [email protected] (A.V. Skamrov). © 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.yjmcc.2004.06.006

cally indistinguishable from sporadic cardiac myxomas and most often arise in the left atrium; however, they exhibit no age or sex preference and can present as multiple concurrent lesions in any cardiac chamber. Moreover, cardiac myxomas of CNC have multiple recurrences at any cardiac location despite adequate surgical resection [6,7]. The genetic linkage analysis of affected families has revealed genetic heterogeneity of CNC, and two chromosomal loci (2p16 and 17q22– 24) have been suggested for the disease genes. Recently it was reported that PRKAR1A gene, which codes for the type 1A regulatory subunit of protein kinase A, is a tumour suppressor gene on chromosome 17 that is mutated in about half of Carney complex affected families [8–11]. The disease gene in 2p16 locus remains unknown [10]. Histogenesis of cardiac myxoma remains a theme of debates. The majority of researchers agree that cardiac myxomas are benign neoplasms that arise from (subendocardial) pluripotent primitive mesenchymal cells which can differentiate within myxomas along a variety of lineages, including epithelial, haematopoietic, muscular, and chondroid [12–14].

718

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

The initial symptoms caused by cardiac tumours are unspecific [1,2,15,16]. Nowadays the presence of cardiac masses is easily detectable by routine imaging techniques: echocardiography, magnetic resonance imaging (MRI), and computed tomography (CT) [1,2,17–19]. The diagnostic method of choice for suspected heart tumour is echocardiography. It enables determination of the size, location, mobility, and the place of insertion of the tumour [1,2,15,16]. As tissue characterization is not possible from this type of analysis an appropriate therapeutic needs histological diagnosis. The gross appearance of cardiac myxomas is variable. Internally, they are heterogeneous and frequently contain cysts, necrosis, and haemorrhage [1,2,4,12–15]. Since neoplasms in heart are rare and most pathologists lack experience with cardiac tumours, the cases of diagnostic confusions, when tumours other than myxomas were misdiagnosed as cardiac myxomas, have been reported [20]. In this paper we describe gene expression analysis of sporadic tumour aimed to elucidate mRNA expression markers for cardiac myxoma. Elucidation of expression markers of cardiac myxoma opens the door for investigation of regulatory pathways activated in tumour, can help in identification of the myxoma cell origin, provides clues for the understanding of several clinical manifestations of cardiac myxomas and can be used as a basis to develop new diagnostic tools. Expression markers were selected applying criteria of sensitivity and specificity. The sensitivity suggests that the level of particular mRNA is firmly measurable by technique in hand and its variation from one myxoma sample to another is low. Although there are several ways to define marker specificity, here we consider a gene suitable of being a marker of myxoma if there are no more than two of 15 different normal tissues where expression level of the gene lies within the same order of magnitude as in myxoma.

2. Methods 2.1. Cardiac myxoma patients We studied gene expression patterns of seven cardiac myxomas (Table 1 cases 1–4, 9, 11, and 12). All patients were women admitted for investigation because of dyspnoea and

chest discomfort. They had no familial history of cardiac myxomas. Echocardiography revealed a tumour in the left atrium (six cases) or in the right atrium (one case). All the patients had tumour resection. In every case the diagnosis “cardiac myxoma” was confirmed by histological examination of the tumour. Major portion of the tumours was composed of a myxoid-matrix with stellate cells. Myxoma cells were observed as isolated or aggregated in clusters, in small cords, and in ring structures. There was diffuse infiltration by white blood cells, and in some tumour sections massive groups of leucocytes were found. Haemorrhages were common, but these sections were avoided for RNA analysis. In case 4 about one-third of the myxoma section was filled with cardiomyocyte reminiscent cells. In case 3 some calcification and ossification was seen in the tumour and that part of the tumour was excluded from analysis. Mutations in PRKAR1A gene were not detected by SSCP analysis of patient’s DNA blood samples. Six patients (cases 1, 3, 4, 9, 11 and 12; Table 1) had an uneventful postoperative recovery and were discharged on the 10th postoperative day. A more than 6-month follow-up echocardiography control showed no signs of tumour recurrences. One patient (case 2) died on the 9th postoperative day due to heart failure. 2.2. RNA sources Tumour specimens were taken within 1–2 h after surgery, frozen in liquid nitrogen and kept at –80 °C until RNA isolation. Human normal heart and aorta tissue samples from externally healthy persons 25–65-year-old men and women were obtained aseptically during autopsy within 4 h after death due to an accident, frozen in liquid nitrogen, and stored at –70 °C until use for total RNA purification. Total leucocytes from peripheral blood were isolated through buffy coat formation and purified using red blood cell lysis buffer. The leucocytes were stored at –70 °C until use for total RNA purification [21,22]. Total RNA was isolated from the samples by acid guanidine thiocyanate/phenol/chloroform method according to prescriptions of Clontech kit, Cat. # K1038-1. Then RNA samples were purified by precipitation with 2 M LiCl. 28S

Table 1 Clinical data for cases of cardiac neoplasmas Case 1 2 3 4 9 10 11 12 15

Sex F F F F F M F F M

Age 71 76 25 52 41 7 59 53 14

Tumour location Left atrium Left atrium Left atrium Left atrium Left atrium Left ventricle Right atrium Left atrium Left atrium

Tumour size (cm) 6.7 × 3 × 3 7×5×2 4×4×5 2×2×2 7×5×5 6×4×3 9×5×3 3 × 2.6 × 2.6 4×4×4

Histological diagnosis Myxoma Myxoma Myxoma Myxoma Myxoma Mesenchymoma Myxoma Myxoma Mesenchymoma

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

and 18S rRNA bands ratio of accepted RNA samples was 2:1. DNA contamination level was tested by semiquantitative polymerase chain reaction (PCR) using human DNA dilutions as standards. DNA contamination level of accepted RNA samples did not exceed 0.1%. Total RNA from normal (non-pathological) heart, aorta, blood, brain, spleen, lung, kidney, liver, small intestine, skeletal muscle, pancreas, stomach, colon, and bone marrow skin was purchased from Clontech laboratory Inc, Palo Alto, CA, USA. These tissue RNAs were isolated from 10 to 20 (male/female, age 20–60) pooled tissue samples. 2.3. Probe preparation and cDNA micro-array hybridization Two micrograms of total RNA were reverse transcribed in the presence of 100 units Superscript RNase H-MMLV reverse transcriptase (Clontech), 35 µCi [a-32P]dATP (10 mCi/ml, 3000 Ci/mmol, Obninsk, Russia) and 1× CDS primer mix (Clontech). The reactions were carried out at 42 °C for 60 min in 10 µl buffer consisting of 50 mM Tris–HCl (pH 8.3), 75 mM KCl, 5 mM MgCl2, 5 mM DTT, 0.5 mM each of dCTP, dGTP, dTTP and 5 µM dATP. The resulting 32P-cDNA probes were purified from unincorporated nucleotides by gel filtration on Sephadex G-50 (Amersham Pharmacia Biotech) columns, treated with denaturing solution (0.1 M NaOH, 10 mM EDTA) to remove RNA, mixed with 1/40 of the total volume of Human Cot-1 DNA® (1 mg/ml, Life Technologies, CA, USA) and neutralized with 1 M NaH2PO4 (pH 7.0). Gene expression was analysed using the Atlas™ Human cDNA Expression Arrays from Clontech: Cardiovascular, Human 1.2 II and Cancer 1.2. Prehybridizations were performed for 4 h at 42 °C in hybridization solution consisting of 50% formamide, 6× SSPE, 5× Denchardt solution, 0.2% SDS, 2 mg/ml heparin, and 0.5 mg/ml denatured herring sperm DNA. Purified and denatured labelled probes were added to the hybridization solution and incubated at 42 °C overnight. After hybridization the membranes were washed at increasing stringency (2× 20 min, 2× SSPE, 1% SDS, 42 °C; 2× 20 min, 2× SSPE, 1% SDS, 65 °C; 2× 20 min, 0.2× SSPE, 0.5% SDS, 65 °C). The membranes were then exposed to phosphor image screens for 3 d. Images were scanned in a Phosphorimager SI system (Molecular Dynamics, USA) and quantified using AtlasImage 1.5 software (Clontech). 2.3.1. Data normalization Our experience in data analysis obtained in more than 400 hybridization experiments with RNA samples isolated from different tissues (both normal and pathological) suggested modification of the normalization procedure proposed by filter supplier (Clontech). First, a set of reference genes that will be used in normalization procedure was selected for each Atlas™ Human cDNA Expression Array: Cardiovascular, Human 1.2 II and Cancer 1.2.

719

To make a selection raw data obtained in every hybridization experiment with particular array type were treated as follows: All dots with the intensity lower than six times of filter background were considered as “low” and ignored at this stage of analysis (usually there was a bit more than 70% of all probes on the filter thus excluded). The median value of the remaining dots was calculated and all dots with the intensity less than 20% of the median or more than five times of the median were excluded. Genes remained in every data list after the procedure described were collected to form the normalization set. Finally, from this set we voluntarily excluded genes that according to our and others experience show high variation in the expression level for the same tissue from individual to individual, from one tissue to another, genes that show age- and sex-dependent expression variations, as well as genes that were not expressed in tissues analysed by others (http://expression.gnf.org, http://genome-www.stanford.edu/) [23,24]. As a result, a normalization set containing 15–20 genes was formed for each of Atlas™ Human cDNA Expression Arrays (the list of genes used for normalization is given in each table; Tables 2–4). Since different genes from the normalization set have exhibited widely different level of expression in one tissue, an attempt to normalize on their mean intensity would lead to unequal contribution of each gene to normalization. For example: expression level of ACTB (beta-actin) is about 10-fold higher than that of YWHAZ gene (tyrosine 3-monooxygenase/tryptophan 5-mono-oxygenase activation protein). To overcome this problem we used weighted intensities to equalize the input of each gene into the mean calculation. The weighting coefficients were taken from an arbitrary reference experiment as dots intensities reciprocal numbers. It should be noted that relative standard deviation (S.D.) of normalized dot intensity for every gene in normalization set was lower than 80% (Tables 2–4). To summarize, in this study the weighted sum of intensities of the genes from normalization set was used to normalize data in every hybridization experiment. To do that, after the filter background subtraction all data intended for comparison were collected to a single table. One hybridization data set was arbitrarily chosen as reference (n). Every dot intensity in experiment j was multiplied by coefficient calculated from the following formula: Kscale/(Ri Aij/Ain), where Aij is the dot intensity of gene i from normalization set in hybridization experiment j. The scale coefficient Kscale was chosen for comparison convenience. Here, the scale was selected to give for glyceraldehyde 3-phosphate dehydrogenase (GAPD) gene probe intensity a value of about 2000 arbitrary units to get output intensity values comparable to those given in http://expression.gnf.org. 2.3.2. Data analysis Preparatory analysis of the data collected in a series of hybridization experiments with the same total mRNA prepa-

720

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

Blood

Normalization

Myxoma

Table 2 Candidate genes for mRNA expression markers of cardiac myxoma, heart, aorta, and blood revealed by cDNA hybridization with cardiovascular Atlas™ membranes Gene name

GeneBank Gene symbol

S.D. (%)*

Myxomaa

phospholipase A2, group IIA

M22430; J04704 X03124 X02761; K00799 L26232 J05481; X72012 U05291 X00351 M26880 X56932 X01677 J03191 K00558 S60099 M28372 X12454 U14971 X05908 K00065; X02317 M86400

PLA2G2A

187

TIMP1 FN1

Tissue inhibitor of metalloproteinase 1 Fibronectin 1 Phospholipid transfer protein Endoglin CD105 Fibromodulin Actin, beta Ubiquitin C 60S ribosomal protein L13A Glyceraldehyde 3-phosphate dehydrogenase profilin I Brain-specific tubulin alpha 1 subunit Amyloid-like protein 2 Cellular nucleic acid binding protein Annexin V 40S ribosomal protein S9 Annexin I Cytosolic Superoxide dismutase 1 Tyrosine 3-mono-oxygenase/tryptophan 5-monooxygenase activation protein HLA class I histocompatibility antigen C-4 alpha subunit SELL precursor; CD62L Intercellular adhesion molecule 1 precursor (ICAM1) Cell surface adhesion glycoprotein LFA-1; CD18 Platelet basic protein

Heart

Aorta

Intercellular adhesion molecule 3 Urokinase-type plasminogen activator receptor; CD87 Nonmuscle filamin 1 integrin alpha 8 High endothelial venule precursor Undulin 1; matrix glycoprotein melanoma-associated antigen A32; CD146 Cardiac muscle troponin T Cardiac phospholamban Slow skeletal & cardiac muscle troponin C Desmin Cardiac muscle myosin regulatory light subunit Cardiac myosin-binding protein C Cardiac LIM domain protein

Aortac

Bloodd

RT-PCR teste

40474

S.D. Heartb myxoma (%)** 52 427

83

42

0

109 97

5304 5257

39 31

517 188

972 2742

401 57

1 3

PLTP ENG

163 98

1784 1466

63 64

100 506

92 386

42 89

0 5

FMOD ACTB UBC RPL13A GAPD PFN1 TUBA1 APLP2 ZNF9 ANXA5 RPS9 ANXA1 SOD1

80 44 51 41 48 60 38 37 45 40 50 56 55

586 4635 3532 2668 2063 1847 1649 1120 769 499 459 389 350

53 14 31 25 23 49 31 40 42 56 63 64 87

100 6137 3987 1499 4251 743 1196 754 1581 461 612 284 666

330 7897 5557 1801 1670 843 1259 978 1144 655 631 675 346

41 7645 8278 3930 1585 973 1427 658 840 325 1204 290 172

1

YWHAZ

72

151

35

480

252

308

M11886

HLA-C

148

3812

37

1345

1459

22931

M25280 J03132

SELL ICAM1

166 101

59 130

173 49

86 130

157 105

1560 796

M15395

ITGB2

90

189

15

54

107

663

M54995; M38441 X69711; X69819 U08839; M83246 X53416 L36531 X82157 M64108 M28882 S64668 M63603 X07897 U59167 M94547 X84075 U49837

PPBP

113

47

100

68

68

506

ICAM3

121

52

138

67

50

498

PLAUR

82

63

77

95

66

319

FLNA ITGA8 SPARCL1 COL14A1 MCAM TNNT2 PLN TNNC1 DES MYLC2A MYBPC3 CSRP3

100 119 84 105 97 184 151 191 161 177 158 148

185 64 73 57 61 45 37 44 210 49 57 41

40 69 214 125 79 6106 2812 2713 253 5464 388 538

128 70 526 61 181 16187 14176 5657 5654 4577 1852 1224

1294 1198 1024 585 403 179 2414 129 284 88 105 75

253 65 86 50 101 183 104 151 79 57 42 42

(continued on next page)

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

721

Table 2 (continued) Gene name

Other

Vimentin

GeneBank

X56134; M14144 Small inducible cytokine A5 (SCYA5) M21121 Integrin alpha L; CD11A Y00796 Monocyte chemotactic protein 1 (MCP1) M24545 Protein disulfide isomerase X05130 Bone/cartilage proteoglycan 1 J04599 Brain natriuretic peptide B M25296 Collagen 1 alpha 1 subunit K01228 Integrin beta 1 (ITGB1); CD29 X07979 Integrin beta 4; CD104 X53587; X52186 Cardiac muscle myosin heavy chain beta isoform M58018 Cardiac muscle myosin heavy chain alpha D00943 Atrial natriuretic factor precursor (ANF) HS75640

Gene symbol S.D. (%)*

Myxomaa

Aortac

Bloodd RT-PCR teste

9990

S.D. Heartb myxoma (%)** 32 1950

VIM

79

11840

4145

CCL5 ITGAL CCL2 P4HB SDCCAG33 NPPB COL1A1 ITGB1 ITGB4

95 87 88 44 83 37 78 68 77

4408 4399 1325 1259 1215 911 786 638 566

55 63 119 37 55 32 69 26 90

48794 50949 1391 673 142 536 495 786 468

22057 29792 1050 696 1224 552 746 1627 234

19140 24955 819 696 64 751 214 97 228

MYH7 MYH6 NPPA

241 197 273

93 60 44

509 1261 4462

18199 3893 1518

364 126 63

85 65 85

a–d

Arithmetic mean of normalized dot intensities in cDNA-hybridization data sets. The number of different tissues (among 15 tested) where expression level of the gene lies within the same order of magnitude as in cardiac myxoma. * S.D. of dot intensities in a total set of cDNA-hybridization data is given as a percent of arithmetic mean in the set. ** S.D. of dot intensities in a set of myxoma cDNA-hybridization data is given as a percent of the mean in myxoma cDNA-hybridization set. e

ration but different filters, enzymes, primers etc. has revealed that the average value of relative S.D. of dot intensities was 25% for dots with intensities six times higher than the filter background and gradually increased to 80% for dots with lower intensities. 2.3.3. Data averaging In this work we analysed hybridization profiles for RNA isolated from cardiac myxoma and normal heart, aorta, and blood. After filter background deduction all data intended for comparison were collected to a single table and normalized. Each hybridization experiment was repeated two to six times either with the same RNA preparation or with RNA preparations obtained from different sections of the same myxoma (for large tumours). The results obtained after the normalization procedure were used to calculate the arithmetic means for each gene for each tumour separately. The S.D. for data obtained for different sections were of the same value (less than 25% for genes with dot intensities 6-fold higher than the filter background) as those for just repeated hybridization experiments performed with the same RNA preparations. The mean values for each tumour were then treated as a single set of data when data from different tumours were compared. Total number of different myxoma tumours described here is seven. The mean values and S.D. of hybridization intensities of each gene were calculated again treating data already averaged for each tumour separately as a single set of data. These data are given in Tables 2–4. So the average values and S.D. in the tables are given as patient-to-patient variation. Data for control tissues were treated in a similarly way: heart, aorta and blood. Data for 18 different healthy donors (10 women and eight men aged 30–55 years) were used for blood RNA. Although the difference in the gene expression

pattern depending on age and gender was obvious, these differences were negligible when compared with the differences exhibited by dissimilar tissues. Therefore the data were averaged for all blood donors. For the heart data we used four data sets obtained with pooled total heart mRNA (Clontech) and five indoor RNA preparations obtained from the left ventricle, right ventricle, left atrium, right atrium, and ventricle septum. Again all these RNA demonstrate a difference in gene expression pattern that was minor when compared with myxoma and other dissimilar tissues. We considered all the preparations as “heart RNA” and averaged the data obtained. Similarly, the aorta data were produced as the mean of a preparation of pooled aorta RNA (Clontech) and four preparations of each intima and media separately. Before calculating the mean values all data intended to be averaged were plotted against each other as double log plot and were considered as amenable for averaging if not more than 5% of all dots were out of 25% distance from the diagonal line in the intensity range 6-fold exceeding the filter background. Not all Array data were produced with the complete set of the controls. For much less informative Cancer array only one of each “heart”, “aorta”, and “blood” RNA was used. For the same “Cancer array” only four myxoma samples (samples 1–4; Table 1) were hybridized. No repeated hybridizations were made in this case. 2.3.4. Data grouping Maximum intensities for each gene in the collection of all analysing data were calculated and the genes with the maximum intensity values lower than 6-fold of the mean filter background in all experiments were excluded from further analysis. Since the background value was around 20, all normalized values that were lower than 20 were clipped for convenience

722

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

Table 3 Candidate genes for mRNA expression markers of cardiac myxoma revealed by cDNA hybridization with human 1.2 II Atlas™ membranes Gene name

GenBank

Gene symbol

S.D. (%)*

Myxomaa

phospholipase A2, group IIA

M22430; J04704 J05481; X72012 M14221 L26232 K02765 X84707 M20560; J03899 X56667 X04470

PLA2G2A

197

ENG

Heart

Aorta

Blood

Normalization

Myxoma

Endoglin; CD105 Cathepsin B Phospholipid transfer protein Complement 3 (C3) Melanoma inhibitory activity Annexin A3 Calbindin 2, 29 kDa (calretinin) Secretory leukocyte protease inhibitor (antileukoproteinase) SRY (sex determining region Y)-box 9 Secreted phosphoprotein 1 (osteopontin, bone sialoprotein I) Actin, beta glyceraldehyde 3-phosphate dehydrogenase Ubiquitin C Brain-specific tubulin alpha 1 subunit 60S ribosomal protein L22 Zinc finger protein 42 (myeloid-specific retinoic acid- responsive) Amyloid beta (A4) precursor-like protein 2 Melanocortin 2 receptor (adrenocorticotropic hormone) 40S ribosomal protein S9 Complement component (3d/Epstein Barr virus) receptor 2 60S ribosomal protein L13A Guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 Calpain, small subunit 1 Translation initiation factor 4 gamma, 2 Tyrosine 3-mono-oxygenase/tryptophan 5-monooxygenase activation protein Ewing sarcoma breakpoint region 1 CD37 antigen Formyl peptide receptor-like 1 Lymphocyte-specific protein 1 Tumour necrosis factor receptor superfamily, member 10c SELL (lymphocyte adhesion molecule 1) Ficolin (collagen/fibrinogen domain containing) 1 Hematopoietic cell-specific Lyn substrate 1 Matrix Gla protein Myosin, heavy polypeptide 11, smooth muscle Regulator of G-protein signalling 5 S100 calcium binding protein A1 Creatine kinase, muscle Creatine kinase, mitochondrial 2 (sarcomeric) Four and a half LIM domains 2 Cysteine and glycine-rich protein 3 (cardiac LIM protein)

Aortac

Bloodd

RT-PCR teste

26656

S.D. Heartb myxoma (%)** 66 78

276

1066

0

111

1935

66

265

251

68

5

CTSB PTLP C3 MIA ANXA3

124 123 99 153 124

1530 1519 1132 528 465

56 69 57 65 59

358 47 202 31 93

232 88 421 20 82

233 20 26 36 88

10 0 8 0 2

CALB2 SLPI

142 105

456 440

24 32

20 20

20 107

21 52

1 1

Z46629 X13694

SOX9 SPP1

116 123

389 325

38 49

20 20

20 20

21 20

1 2

X00351 X01677 M26880 K00558 X59357 M58297

ACTB GAPD UBC TUBA1 RPL22 ZNF42

36 25 32 33 21 27

6594 3554 3400 2763 961 699

36 31 25 29 10 28

6024 5868 3985 1354 981 965

8234 4440 7650 2129 1426 484

12871 4414 5568 1994 755 650

S60099 L06155

APLP2 MC2R

26 43

648 648

26 45

716 327

898 132

294 284

U14971 M26004

RPS9 CR2

30 29

595 587

29 29

856 840

634 477

1104 556

X56932 M24194

RPL13A GNB2L1

26 28

540 539

22 19

576 451

930 415

1101 834

X04106 U76111 M86400

CAPNS1 EIF4G2 YWHAZ

37 32 24

469 466 426

28 49 37

436 576 389

301 515 364

449 65 158

X66899 X14046 M60627 M33552 AF012629

EWSR1 CD37 FPRL1 LSP1 TNFRSF10C

33 170 190 155 148

360 279 97 88 66

21 66 42 52 55

498 20 20 47 20

345 25 20 44 25

593 1336 1048 749 560

M25280 D83920 X16663 X07362 X69292 AB008109 X58079 M14780 J05401 L42176 U49837

SELL FCN1 HCLS1 MGP MYH11 RGS5 S100A1 CKM CKMT2 FHL2 CSRP3

136 166 120 120 155 165 172 142 197 179 160

64 59 178 689 75 88 485 200 88 55 66

41 28 42 33 12 44 224 76 172 26 100

20 20 20 483 358 436 5230 2521 2350 1323 794

20 20 25 3341 2971 2418 1168 798 509 339 195

555 468 435 20 177 20 21 68 20 20 20

(continued on next page)

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

723

Other

Table 3 (continued) Gene name

GenBank

Gene symbol S.D. (%)*

Myxomaa

Heartb

Aortac

Bloodd RT-PCR teste

2490 930 676

S.D. myxoma (%)** 15 42 50

Ferritin, heavy polypeptide 1 S100 calcium binding protein A11 (calgizzarin) Fusion, derived from t (12;16) malignant liposarcoma Diaphorase (NADH) (cytochrome b-5 reductase) Annexin A5 Pyruvate kinase, muscle Prostaglandin D2 synthase 21kDa (brain) Cathepsin D precursor (CTSD) CD14 antigen

M97164 D38583 X71428

FTHL6 S100A11 FUS

65 102 20

1790 311 280

1564 760 314

7104 6690 380

Y09501 X12454 M23725 M61900 M11233 M86511

DIA1 ANXA5 PKM2 PTGDS CTSD CD14

43 50 51 132 67 91

676 641 620 604 485 442

32 67 37 165 49 36

389 78 685 3097 700 31

383 226 402 848 358 75

205 91 316 34 524 642

a–d

Arithmetic mean of normalized dot intensities in cDNA-hybridisation data sets. The number of different tissues (among 15 tested) where expression level of the gene lies within the same order of magnitude as in cardiac myxoma. * S.D. of dot intensities in a total set of cDNA-hybridization data is given as a per cent of arithmetic mean in the set. ** S.D. of dot intensities in a set of myxoma cDNA-hybridization data is given as a per cent of the mean in myxoma cDNA-hybridization set. e

(set to 20). This approach excludes down-regulated genes from analysis, drawing the attention to over-expressed genes. This is reasonable when the marker gene search is the aim of the study and seems to be the only possible when intrinsically heterogeneous material is the object of the research. Then the remaining genes were divided into five groups: genes used for “normalization”, putative marker genes of “blood”, “aorta”, “heart”, “myxoma” and “other”. Gene was selected for “myxoma” group if relative S.D. of its dot intensity in experiments with myxoma RNA samples was lower than 80% and the ratio of the highest intensity value obtained in these hybridizations to the mean of all but the maximum values was not more than 3. The arithmetic mean for this purpose only was calculated for every gene taking into account all except the highest intensity gotten in hybridizations with myxoma RNA samples. The mean values given in Tables 2–4 were not biased. The procedure for getting these average values is described in previous section. The same criteria were used for genes collected into other groups, but S.D. was taken for the corresponding tissue: heart for “heart”, etc. All the genes not included into the named groups were transferred to the “other” group. The genes which according to the criteria belong to more than one named group were placed in “other” group too. 2.4. RT-PCR analysis Two micrograms of total RNA were reverse transcribed in 20 µl reaction mixture containing 50 mM Tris–HCl (pH 8.3), 75 mM KCl, 5 mM MgCl2, 5 mM DTT, 1 mM each of dCTP, dGTP, dTTP and dATP, 2.5 µM random nanomers (Genet.Oligos, Russia) and 200 units Superscript MMLV reverse transcriptase (Clontech). The reactions were performed at 42 °C for 60 min and stopped by adding 10 volumes (200 µl) of the stop solution (1 mM EDTA, 10 mM Tris–HCl, pH 8.0). The cDNA probes were stored frozen at –20 °C. For PCR analysis 1 µl aliquots were added to 20 µl reaction mixture containing 10× PCR buffer (Clontech), 100 µM dNTP (each), 1 µM

(each) gene-specific forward and reverse primers, 5 units Advan-Taq (Clontech). Gene-specific primers for PCR analysis were designed using Oli99 (Technogene, Russia) software for all except for immunoglobulin kappa chain (IGKC, constant region), immunoglobulin gamma 3 heavy chain (IGHG3, constant region), and GAPD RNAs. For the latter cases sequences for PCR primers specific for individual genes of interest were obtained from Clontech. After desired number of PCR cycles (94 °C, 20 s; 57 °C, 30 s; 72 °C, 45 s), 10 µl aliquots were withdrawn and amplification was extended for four more cycles. Then all probes were analysed by agarose gel-electrophoresis. Each RT-PCR experiment was repeated three times using different cDNA preparations. SSCP analysis was done as described previously [11].

3. Results 3.1. Gene expression analysis Ordinary mRNA expression analysis of pathological tissue suggests direct comparison of two hybridization patterns: the first is a result of hybridization with RNA from “normal” tissue, and the second with RNA from the same but pathologically changed tissue. For myxoma the mRNA relative concentration analysis is impossible, since there is no “normal” reference tissue. Therefore, the absolute instead of relative to “normal” values of dot intensities were used for analysis. 3.1.1. Array hybridization The hybridization experiments with the Atlas™ membranes were done for seven separate cardiac myxoma samples from different patients and a set of normal tissues: heart, blood, and aorta. The arrays used are composed of gene-specific cDNA probes (200–600 bp in length) immobilized on a solid-phase nylon membrane. Cardiovascular

724

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

Table 4 Candidate genes for mRNA expression markers of cardiac myxoma revealed by cDNA hybridization with Cancer 1.2 Atlas™ membranes Gene name

GenBank

Gene symbol S.D. (%)*

Myxomaa

Immunoglobulin kappa constant IGHG3 (G3m marker)

M63438 Y14737; Y14735 X02761; K00799 X03124 K01171

IGKC IGHG3

132 134

FN1

Heart

Aorta

Blood

Normalization

Myxoma

Fibronectin 1 Tissue inhibitor of metalloproteinase 1 Major histocompatibility complex, class II, DR alpha Immunoglobulin lambda-like polypeptide 1 Integrin, beta 4

M27749 X53587; X52186 Caspase 10, apoptosis-related cysteine protease U60519 Ubiquitin C M26880 Actin, beta X00351 Glyceraldehyde 3-phosphate dehydrogenase X01677 Translation elongation factor 1 alpha 1 M27364 40S ribosomal protein S16 M60854 60S ribosomal protein L10 M73791 Ras homolog gene family, member A L25080 60S ribosomal protein L32 X03342 Zinc finger protein 36, C3H type-like 1 X79067 60S ribosomal protein L13A X56932 CD59 antigen p18–20 M34671 Tubulin, alpha, ubiquitous K00558 Expressed in non-metastatic cells 2 protein L16785; (NME2) M36981 Translation elongation factor 2 X51466 Platelet-derived growth factor alpha polypeptide X06374 Tyrosine 3-mono-oxygenase/tryptophan 5-mono- M86400 oxygenase activation protein Major histocompatibility complex, class I, C M11886 HLA-G histocompatibility antigen, class I, G M32800; U03754 Fc fragment of IgG, low affinity IIa, M31932 receptor for (CD32) Solute carrier family 2 (facilitated glucose M20681 transporter), member 3 Ras-related C3 botulinum toxin substrate 2 M64595; M29871 p53-induced protein 7 AF010312 Rho GDP dissociation inhibitor (GDI) beta L20688 Biglycan J04599 Integrin, alpha 8 L36531 Myosin, light polypeptide kinase U48959 Insulin-like growth factor binding protein 5 M65062 Microtubule-associated protein 1B L06237 Myosin, light polypeptide 2, regulatory, cardiac, X66141 slow Desmin U59167 Myosin, light polypeptide 3, alkali; ventricular, M24122 skeletal, slow

Aortac

Bloodd RT-PCR teste

153667 135332

S.D. Heartb Myxoma (%)** 74 1542 76 1334

1781 1462

1343 690

7 6

100

7062

58

460

4138

20

3

TIMP1 HLA-DRA

123 101

6146 5338

81 60

563 282

1112 391

457 1165

1 4

IGLL1 ITGB4

122 106

4256 1798

66 62

20 20

20 20

203 407

8 7

CASP10 UBC ACTB GAPD EEF1A1 RPS16 RPL10 ARHA RPL32_EST ZFP36L1 RPL13A CD59 K-ALPHA-1 NME2

46 73 74 53 28 31 28 15 25 35 37 69 32 61

19472 4827 3543 5002 5607 3087 2381 2624 2407 2315 2077 2512 1772 1998

55 28 63 24 12 29 28 10 25 30 26 40 14 23

24591 5825 7560 10762 2046 3750 2164 1897 2638 756 1112 1764 1008 1023

33668 8862 8595 3304 4683 2686 2316 2789 1935 1842 1276 1091 1194 1431

38598 19223 15413 2541 4215 1912 3526 2143 1825 2487 2954 241 905 154

EEF2 PDGFA YWHAZ

24 66 33

913 491 373

17 71 31

1467 771 282

751 690 329

997 1534 580

HLA-C HLA-G

154 144

2438 1270

21 44

1334 460

2213 957

36934 14126

FCGR2A

100

848

27

20

20

3072

SLC2A3

179

107

103

20

20

2891

RAC2

141

228

41

20

20

1961

PIG7 ARHGDIB BGN ITGA8 MYLK IGFBP5 MAP1B MYL2

121 100 100 223 235 123 174 276

277 408 994 93 69 989 127 607

36 41 53 115 90 125 72 195

20 20 20 20 20 800 252 39355

268 20 2254 1678 1647 1513 1482 20

1767 1481 20 20 20 20 20 20

DES MYL3

207 273

877 148

151 114

11755 8983

432 20

61 20

(continued on next page)

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

725

Other

Table 4 (continued) Gene name

GenBank

Gene symbol S.D. (%)*

Myxomaa

CD74 antigen Vimentin

X00497 X56134; M14144 AF029082 V00491 AF019562 J00220 + S71043 X52541; M62829 X57086; X57331 U12255 U79718 J04164

CD74 VIM

54 74

SFN HBA2 TYROBP

L31951

Stratifin Haemoglobin, alpha 2 TYRO protein tyrosine kinase binding protein Immunoglobulin alpha 1 heavy chain constant region Early growth response 1 Immunoglobulin heavy constant µ Fc fragment of IgG, receptor, transporter, alpha Nth endonuclease III-like 1 (E. coli) Interferon induced transmembrane protein 1 (9–27) Mitogen-activated protein kinase 9

Aortac

Bloodd RT-PCR teste

14864 11054

S.D. Heartb Myxoma (%)** 40 1616 34 3231

1688 15789

6447 2541

50 62 82 117

9828 9498 4600 4439

20 38 44 93

9487 17269 178 20

17693 23530 226 20

8211 12908 8151 472

EGR1

47

4047

58

1067

3561

2186

IGHM

102

2725

71

222

185

205

FCGRT NTHL1 IFITM1

80 45 94

2694 1551 1329

68 65 44

667 1495 1171

504 1708 721

784 1721 4734

MAPK9

112

1265

73

371

1492

208

a–d

Arithmetic mean of normalized dot intensities in cDNA-hyridization data sets. e The number of different tissues (among 15 tested) where expression level of the gene lies within the same order of magnitude as in cardiac myxoma. * S.D. of dot intensities in a total set of cDNA-hybridization data is given as a percent of arithmetic mean in the set. ** S.D. of dot intensities in a set of myxoma cDNA-hybridization data is given as a percent of the mean in myxoma cDNA-hybridization set.

(588 gene probes), Cancer 1.2 (1176), and Human 1.2 II (1176) Atlas™ membranes were used for hybridization with each of the mRNA samples as described in Section 2. Visual inspection of the hybridization results (Fig. 1) indicates that cardiac myxoma has its own hybridization pattern which is clearly distinguishable from patterns produced by other tissues. Notably, several over-expressed genes can be readily identified in myxoma samples: phospholipase A2 group IIA (PLA2G2A), phospholipid transfer protein (PLTP), tissue inhibitor of metalloproteinase1 (TIMP1) and fibronectin 1 (FN1) (Fig. 1). Quantitative analysis of the data obtained has revealed a set of candidate genes for mRNA expression markers of cardiac myxomas. The data were summarized in Tables 2–4. The S.D. are given as a per cent of mean value for each gene in a set of myxoma cDNA-hybridization data and in a total set of cDNA-hybridization data. Genes PLA2G2A, PLTP, TIMP1, endoglin (ENG), calretinin (CALB2), complement component 3 (C3), melanoma inhibitory activity (MIA), secretory leucocyte protease inhibitor (SLPI), secreted phosphoprotein 1 (SPP1) (osteopontin), cathepsin B (CTSB), and fibromodulin (FMOD) have to be mentioned here as being highly and stably expressed in myxomas. Moreover, as one can see from Tables 2–4, some of these genes show high expression level in experiments with different Atlas™ arrays. It is worth noting that similar analysis of array-hybridization data obtained in experiments with normal tissues appropriately identified genes known to be specific for these tissues [25–27]. For example, cardiac muscle troponin T2 (TNNT2), cardiac phospholamban (PLN), slow skeletal and cardiac muscle troponin C (TNNC1), and desmin (DES) were selected as mRNA expression markers for heart muscle. Matrix

GLA protein (MGP), integrin alpha 8 (ITGA8), smooth muscle and non-muscle myosin light chain kinase (MYLK), myosin heavy chain smooth muscle isoform (MYH11) as mRNA expression markers for blood vessels, and cell surface adhesion glycoprotein LFA-1 beta 2 chain (ITGB2), selectin L (SELL), leucocyte CD37 antigen (CD37), antagonist decoy receptor for TRAIL (TNFRSF10C), lymphocytespecific protein 1 (LSP1), HLA class I histocompatibility antigens (HLAC and HLAG) as mRNA expression markers for blood. For a number of selected genes the average intensity values obtained in the hybridization experiments with mRNA from different myxoma samples, heart (total, ventricle, and atrium), aorta (total, intima, and media), and blood are schematically shown in Fig. 1. As it follows from the figure the cardiac myxoma markers, clearly differentiate myxomas and other tissues. Markers for normal cardiomyocytes show relatively low level of expression in cardiac myxomas and high variability of expression level from myxoma to myxoma samples (S.D. of the gene expression level is two or three times higher than the corresponding mean value; see for instance a group of heart marker genes in Tables 2–4). This can be explained by irregular presence of variable number of cardiomyocytes in some myxoma samples. For example, myxoma 4 exhibits about 2-fold lower level of expression of all myxoma markers than others and in contrast to other myxomas exhibits expression of complete set of cardiomyocyte expression markers very well following the expression profile for atrium (Fig. 1). This finding is in a good accord with the presence of high percentage of cardiomyocyte-like cells in histological sections of myxoma 4 (not shown). Since heart marker gene

726

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

expression pattern for myxoma 4 resemble the pattern of heart atrium it seems unlike that cardiomyocyte reminiscent cells of myxoma 4 are produced de novo from some mesenchymal progenitor cells of myxoma tumour origin. Gene markers for endothelial, smooth muscle, and blood cells do not show so dramatic variability in myxomas (Tables 2–4), suggesting that the cells are present in myxoma in a more or less constant proportion. It is of interest that antigenic markers commonly discussed in the literature in connection with cardiac myxoma: S100 calcium-binding protein, MCP1, CD34 antigen, von Willebrand factor (factor VIII), factor VIII related protein, vimentin, and laminin were not selected as specific markers for myxoma according to our criteria (exception is calretenin, Table 2) [13,28–34]. The reason is that the genes show either high level of expression in many tissues or high variability of expression in myxomas (expanded versions of Tables 2–4 are available from authors on request). For instance, monocyte chemotactic protein 1 (MCP1, CCL2) exhibiting on average high level of mRNA concentration demonstrates S.D. exceeding its mean value (Table 2; average normalized intensity values: myx1: 1023; myx2: 683; myx3: 5037; myx4: 475; myx9: 959; myx11: 984; myx12: 1630). 3.2. RT-PCR analysis RT-PCR technique was used to validate the mRNA expression marker status of the selected genes. RNA from three myxoma samples (cases 1–3; Table 1) and 15 normal tissues listed in Figs. 2–4 were analysed. A set of genes (Table 5) for RT-PCR analysis was formed from candidate genes for mRNA expression markers of cardiac myxoma and heart selected in array-hybridization experiments. The list was enlarged to include previously described markers of cardiac myxomas, markers of inflammation, housekeeping genes, and genes somehow related to most probable marker gene found on the ground of array-hybridization analysis. cDNAs were synthesized from each total RNA sample as described in Section 2, and integrity of cDNA was ensured by PCR amplification with primers specific for GAPD and PRKAR1A genes (Fig. 2). For each gene the minimal number of cycles enabling one to detect PCR amplification product for myxoma cDNA was determined in a pilot experiment. To have a crude estimation of mRNA level difference among

727

Fig. 2. Gene-specific RT-PCR expression analysis in myxoma and normal tissues. RT-PCR analysis was performed as described in Section 2. Confirmation integrity of cDNA preparation by expression analysis of housekeeping genes. Gene symbols and PCR cycle numbers are shown above electrophoresis pictures. In the left corner there is a 100 bp molecular weight marker. 1: cDNA synthesis without RNA; 2: cardiac myxoma case 1; 3: cardiac myxoma case 2; 4: cardiac myxoma case 3; 5: heart; 6: aorta; 7: blood; 8: brain; 9: spleen; 10: lung; 11: kidney; 12: liver; 13: small intestine; 14: skeletal muscle; 15: pancreas; 16: stomach; 17: colon; 18: bone marrow; 19: skin.

tissues, PCR amplification was extended for four more cycles to increase the sensitivity of the test for approximately one order of magnitude. 3.2.1. PLA2G2A As seen from Fig. 3, RT-PCR analysis confirms a very high expression level of PLA2G2A in cardiac myxomas (can be detected after 20 cycles of PCR amplification under described conditions). It should be emphasized that RT-PCR revealed almost identical level of PLA2G2A mRNA in all myxoma samples tested. Among 15 normal tissues tested this mRNA can be detected only after 24 cycles in small intestine, colon, aorta, and heart, which is in agreement with prior studies of tissue distribution of PLA2G2A expression [35–37]. PLA2G2A is induced in association with several immunemediated inflammatory conditions [38–40]. The phospholipases A2 hydrolyse the sn-2 fatty acid acyl ester bond of phosphoglycerides, releasing free fatty acids (preferentially arachidonic acid) and lysophospholipids. Prostaglandins and thromboxanes are generated by the phospholipase A2/cyclooxygenase pathway and leucotrienes by the phospholipase A2/lipo-oxygenase pathway. Prostaglandins production is controlled by two cyclo-oxygenases (COX-1 and COX-2) that mediate the initial conversion of arachidonic acid into a precursor common for all prostanoids. RT-PCR examination of the expression of inflammation markers (IL6, CD14, TNFA, IL1B, and IL1A), PTGS genes (code for COX proteins), and ALOX5 gene (code for 5-lipoxygenase) reveals that there is no over-expression of

Fig. 1. Cardiovascular Atlas array analyses. In the upper part of the figure the cDNA-hybridization patterns from normal blood, normal heart, normal aorta, and cardiac myxoma 1 are shown. The positions of several gene-candidates for mRNA expression markers of cardiac myxoma are identified. PLA2G2A, PLTP, TIMP1, and FN1 gene probes show strong hybridization signal in myxoma and weak (or no) hybridization in heart, aorta, and blood. In the lower part of the figure transcription profiles of cardiac myxoma and normal blood, heart, and aorta are shown for complete set of genes selected as expression markers of myxoma and normal total heart (Table 2). In addition hybridization data for cardiac muscle myosin heavy chain beta isoform gene (MYH7) preferentially expressed in ventricle, and cardiac muscle myosin heavy chain alpha isoform gene (MYH6) and atrial natriuretic factor (ANF) gene preferentially expressed in atrium are shown. Only most intensely expressed genes selected as markers of blood and aorta are exhibited. Complete set of genes used for data normalization (Table 2) is shown also. Normalized and averaged dot intensity values obtained in hybridization experiments with RNA purified from: four different non-pathologic total heart samples; three samples of left ventricle, right ventricle, and ventricle septum; left and right atrium samples of non-pathologic heart; seven different myxoma tumours from patients 2, 3, 4, 9, 11, and 12; pooled normal aorta; five different aorta media samples; four different aorta intima samples; two normal blood samples are shown on the chart.

728

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

Fig. 3. Gene-specific RT-PCR expression analysis in myxoma and normal tissues. RT-PCR analysis was performed as described in Section 2. Gene symbols and PCR cycle numbers are shown above electrophoresis pictures. In the left corner there is a 100 bp molecular weight marker. 1: cDNA synthesis without RNA; 2: cardiac myxoma case 1; 3: myxoma case 2; 4: myxoma case 3; 5: heart; 6: aorta; 7: blood; 8: brain; 9: spleen; 10: lung; 11: kidney; 12: liver; 13: small intestine; 14: skeletal muscle; 15: pancreas; 16: stomach; 17: colon; 18: bone marrow; 19: skin.

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

729

Fig. 4. Gene-specific RT-PCR expression analysis in myxoma and normal tissues. RT-PCR analysis was performed as described in Section 2. Gene symbols and PCR cycle numbers are shown above electrophoresis pictures. In the left corner there is a 100 bp molecular weight marker. 1: cDNA synthesis without RNA; 2: cardiac myxoma case 1; 3: myxoma case 2; 4: myxoma case 3; 5: heart; 6: aorta; 7: blood; 8: brain; 9: spleen; 10: lung; 11: kidney; 12: liver; 13: small intestine; 14: skeletal muscle; 15: pancreas; 16: stomach; 17: colon; 18: bone marrow; 19: skin.

these genes in cardiac myxomas (Fig. 3). Nevertheless, RTPCR analysis shows that in myxomas the expression of ALOX5 gene is within the same order of magnitude as in non-pathogenic tissues with the highest expression level of the gene (blood, lung, and bone marrow; Fig. 3).

3.2.2. Melanoma-inhibitory activity MIA shows the highest specificity as a marker (Fig. 3). In myxoma samples MIA could be detected after 23 cycles of PCR amplification; however, we could not detect its mRNA in all normal tissues tested even after 27 cycles of PCR. This

Table 5 RT-PCR primer sequences and amplicon lengths Gene symbol

Gene bank accessories

Forward primer

Reverse primer

PRKAR1A PLA2G2A CD14 IL6 TNFA IL1B IL1A PTGS1 PTGS2 ALOX5 MIA CALB1 CALB2 FMOD PLTP FN1 TIMP1 SPP1 SOX9

NM_002734 XM_001840 NM_000591 X04430 M10988 NM_000576 NM_000575 NM_080591 NM_000963 NM_000698 NM_006533 NM_004929 NM_001740 NM_002023 NM_006227 X02761 NM_003254 NM_000582 NM_000346

GTTTGCATGAGTGAAGCATGGATTGG CCCCGAGTTGCTAAACTTGTAGCTC TTCGCCCAGTCCAGGATTGTCAGAC CTCACTACTCTCAAATCTGTTCTGGAG TTGTGTCAATTTCTAGGTGAGGTCTTC GAATGTGGGAGCGAATGACAGAGG AAGTACAGCGCCATTTGTATTAGTTGC GTGGTAGCATGTCTATACAGTGATGG CAGCATCGATGTCACCATAGAGTGC AAAGTCGGCGAAGTCATTCCAAGAAG CTGAGCTCACTGGCAGTAGAAATCC CCATCCGACAAAGCCATTAT GTGTGATCCACTGAGCAAAGACTGC GAGCCTATACTTGGGCTAACTCTCC GCATGGTTCGTCACCACCTCATGC GTCATCCGTAGGTTGGTTCAAGCC CTCCTCGCTGCGGTTGTGGGAC CGGCTGACTTTGGAAAGTTCCTGAC TGATCACACGATTCTCCATCATCCTC

HLA-DRA IGLL1 ANXA3 SLPI CTSB C3 TNNC1 PLN TNNT2 MYH7 ITGA7 ITGA8 IGKC IGHG3 GAPD

NM_019111 NM_152855 NM_005139 NM_003064 NM_001908 NM_000064 NM_003280 NM_002667 NM_000364 NM_000257 NM_002206 XM_042813

TATGTTAACAATGAATGGGCAACCAGTG TGCATTTGTCACCCAAGAACTCTTACC CCGCACAGGTTCCTGCTCAGCTAC GGTACATCCTCGACGGCATCTCAG CGAGTCTGGGCAGGTCTACTTTGG CCTGCCTTAGGGTAGTGCTAAGAG TTCATCTGCGCAAACAGATTCAGGAAC AGAGACGGAGATCCTAAGGTCCAAC TGCAACACTTGAGTGGCTATCACTTC TGACCAAATTCACATTCTCAAGCAACAC CCCGGTCCCTGGTGTGCCTTG TGGCTCACGTATTACCCACA GGATAGAAGCGGCTACATTGACGAG CATACAACCCTCTGCTTTCACATCTC TGGCACCACCATCTCTGTCACTGC TAAGGCATAGGCCAAGACCATACCC GACCTCGTCATCAGGGCCAAGTTC TATGATGGCCGAGGTGATAGTGTGG AAGACATTTAAGCTAAAGGCAACTCGTAC AAACCTGTCACCACAGGAGTGTCAG GAGGAGCTCCAAGCCAACAAGGC AAAGACTGCATCGAGCCTTGAAGGG CCAGAGTGACTGGCAGTGTCCAG TGTATTCGGACTTCCTGCTCTACAAG ACGGCCTTTGTTCTCATCTCGCTG TGAGTTCAAGGCAGCCTTCGACATC CCCAGCTAAACACCCGTAAGACTTC AGCAGCAGCGCATCCGGAATGAG TATCATCCCTAATGAGACAAAGTCTCC GATCAGCATTGAGACCACGGAACTG TCGGTAGTGCTATGGCACACTTAGG

a

TCTAAGAAACATCATCACCTCCATGTG GTGCATGACCTGGCAGCTGTAGC AAAGCCCATCGTGGACCTTTGGAG GATATCAGTGGTGGAGCCAAGTCTC GACAGGCCCACGGCAGATTAGATC GATGTGGCCTCCACGTTGTAGAGC CACCGAACCATCATGACCAGGAAC AGCTGAGCGAGTGAGGTATTGGAC AGCGCCCGGTGACTTTAGCCTTC AACTTGTACTGGTTGTGATCAATGTCC CACATCCCGCTCAGACTGCATGG CTCTTAAAGTAAAGCCAAATCCGGAAG

Sequences for PCR primers specific for IGKC, IGHG3, and GAPD genes were obtained from Clontech.

Amplicon lengtha 653 303 314 239 395 194 225 344 456 259 397 286 414 218 339 314 201 346 197 344 225 244 334 274 271 198 197 452 259 198 209 208 255 452

730

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

result is in agreement with prior studies suggesting that MIA expression is relatively tissue-specific. Analysis of nonneoplastic tissues revealed specific MIA expression patterns in cartilage [41]. In neoplastic tissues MIA expression was detected in malignant melanomas, in chondrosarcomas and less frequently in a variety of different adenocarcinomas, including breast and colon cancers [42]. 3.2.3. Calretenin Previously it was shown that calretinin (calbindin 2) can serve as a marker for cardiac myxoma [32]. Calretinin has a general neuronal localization and is a predominantly cytosolic protein [43]. Tissue expression of the genes encoding calbindin 1 (CALB1) and calretinin (CALB2), two closely related calcium-binding proteins, were examined. As seen from Fig. 3, although the mRNA level of CALB2 in cardiac myxomas is low (30 cycles) the expression is restricted to cardiac myxomas and brain. On the other hand, CALB1 is expressed in the brain and kidney, but not in cardiac myxomas. 3.2.4. IGKC and IGHG3 Array-hybridization analysis has suggested a set of Iggenes as markers for cardiac myxoma (Table 4). RT-PCR analysis has revealed high expression (21 cycle) of IGKC, constant region; IGHG3, constant region in myxoma samples one and two, but not in myxoma sample three (Fig. 3). This tendency is in agreement with array-hybridization data (Table 4; average normalized intensity values for IGKC: myx1: 7000, myx2: 9500, myx3: 500, myx4: 2500; IGHG3: myx1: 6000; myx2: 8500; myx3: 400; myx4: 3000). It is noteworthy that monocyte chemotactic protein 1 exhibits an opposite drift (see the above section), showing maximum expression level in myxoma 3 when compared with other myxomas. Variations in mRNA level of these genes may be due to sample-to-sample fluctuant variations in myxoma’s cell content. To clarify this additional experiments need to be done. In addition, RT-PCR analysis revealed similar expression level of Ig-genes in myxomas (samples 1 and 2) and more than two normal tissues (blood, spleen, lung, small intestine, stomach, colon, bone marrow for immunoglobulin kappa constant; blood, spleen, lung, kidney, stomach, bone marrow for IGHG3). Hence, these genes cannot be suggested as markers for cardiac myxomas. RT-PCR analysis (Fig. 3) confirms high mRNA level (23– 25 cycles) of PLTP, FMOD, tissue inhibitor of metalloproteinase 1 (TIMP1), SPP1 (osteopontin), and annexin A3 (ANXA3) in cardiac myxoma. SOX9 mRNA is detectable after 27 cycles, secretory leucocyte protease inhibitor (SLPI)—after 29 cycles. It should be emphasized that for all these genes RT-PCR analysis revealed almost identical mRNA level in all myxoma samples tested. Collected data indicate different specificities of marker genes. High specificity was revealed for PLTP gene. For the rest genes there are few normal tissues with expression level similar to that ob-

served in cardiac myxoma: for FMOD, TIMP1: aorta; SOX9: brain; SPP1: brain and kidney; ANXA3: lung and bone marrow; SLPI: lung (Fig. 3, Tables 2–4). A number of candidate genes did not pass the selectivity test as reveled by RT-PCR analysis (Fig. 3, Tables 2–4), since there are more than two of 15 different tissues where expression level of the gene lies within the same order of magnitude as in myxoma: FN1: heart, lung, and liver; CTSB: 10 tissues; immunoglobulin lambda-like polypeptide 1 (IGLL): eight tissues; class II histocompatibility antigen, DR alpha chain precursor (HLA-DRA): blood, spleen, lung, and small intestine; endoglin (ENG): heart, aorta, spleen, lung, and kidney; C3: eight tissues. The analysis of array-hybridization data obtained in experiments with normal heart and vessel samples has revealed a set of markers of these tissues (Table 2–4). The RT-PCR analysis has confirmed marker status of selected genes (PLN, TNNT2, TNNC1) for heart (Fig. 4). Moreover, this set of markers clearly distinguishes normal myocardium from cardiac myxoma. In a second step, RT-PCR technique was used to check the ability of selected markers to discriminate (discern) cardiac myxoma from other tumours. RNA from two cardiac myxoma samples (cases 2, 11; Table 1), two cardiac mesenchymoma samples (cases 10, 15; Table 1) and 14 tumour samples of different tissues origin (listed in Fig. 5) were examined. As seen from Fig. 5, a high level of simultaneous expression of all markers is a distinctive feature of cardiac myxoma. 4. Discussion There are several intrinsic difficulties in the expression analysis of complex cell systems like cardiac myxoma. The heterogeneous cell content of these systems is among obstacles complicating transcription analysis, since variation in cell composition potentially leads to large differences in transcription patterns, and RNA extracted from different parts of the same myxoma could result in different patterns. Nevertheless, RNA profile analysis of cardiac myxomas has revealed a specific transcription pattern for cardiac myxoma. The pattern differs clearly from transcription patterns of neighbouring tissues: myocardium, blood, and aorta. These findings suggest that cardiac myxoma should be considered as a stand-alone tissue rather than a pathological modification of particular normal tissue. The absence of normal reference tissue led us to analysis of absolute but not relative to normal values of dot intensities in array-hybridization experiments. This approach revealed a set of candidate genes for mRNA expression markers of cardiac myxomas. RT-PCR analysis was used to verify marker status of selected genes. With the exception for genes coding for immunoglobulin chains, C3, CTSB, ENG, FN1, HLA-DRA marker status for the candidate genes was confirmed (Tables 2–4). Among the markers of myxoma at least three are participants of phospholipid methabolism: ANXA3 (annexin A3)

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733

Fig. 5. Gene-specific RT-PCR expression analysis in cardiac myxoma and other tumours. RT-PCR analysis was performed as described in Section 2. Gene symbols are shown in the left corner. 1: 100 bp molecular weight marker; 2: cDNA synthesis without RNA; 3: clear cell adenocarcinoma NOS (ICD-O: M8310/3, 189.0; kidney; male, 54 years); 4: basophil carcinoma (ICD-O: M8300/3, 174.9; breast; female, 67 years); 5: tubular adenocarcinoma (ICD-O: M8211/3, 174.9; breast; female, 51 years); 6: infiltrating duct carcinoma (ICD-O: M8500/3, 174.9; breast; female, 48 years); 7: lobular carcinoma NOS (ICD-O: M8520/3, 174.9; breast; female, 38 years); 8: mucinous adenocarcinoma (ICD-O: M8480/3, 154.9; rectum, female, 43 years); 9: carcinoid tumour, malignant (ICD-O: M8240/3, 152.9; small intestine; male, 59 years); 10: adenocarcinoma NOS (ICD-O: M8140/3, 153.9; colon; male, 53 years); 11: medullary carcinoma NOS (ICD-O: M8510/3, 174.9; breast; female, 70 years); 12: adenocarcinoma NOS (ICD-O: M8140/3, 154.1; rectum; female, 61 years); 13: adenocarcinoma NOS (ICD-O: M8140/3, 151.9; stomach; female, 72 years); 14: villous adenoma NOS (ICD-O: M8261/1, 154.1; rectum; female, 64 years); 15: squamous cell carcinoma NOS (ICD-O: M8070/3, 184.4; vulva; female, 60 years); 16: malignant melanoma NOS (ICD-O: M8720/3, 173.5; skin; male, 53 years); 17: cardiac myxoma case 2; 18: cardiac myxoma case 11; 19: cardiac mesenchymoma case 10; 20: cardiac mesenchymoma case 15. PCR cycles number GAPD: 26, PLA2G2A: 23, CALB2: 32, TIMP1: 24, PLTP: 23, MIA: 27, SPP1: 24, SLPI: 30, FMOD: 28, ANXA3: 29, SOX9: 28.

[44], PLA2G2A, and PLTP [45]; two, TIMP1 [46] and SLPI (secretory leucocyte protease inhibitor) [47] are inhibitors of proteases degrading extracellular matrix proteins and participating in cell proliferation regulation; MIA [42], SPP1 [48] and FMOD [49] are modulators or participants of interaction between extracellular matrix proteins and their cell surface receptors; SOX9 is a transcription factor required for chondrocyte differentiation [50]. CALB2 is an intracellular calcium-binding protein with poorly understood function [43,51]. It should be pointed up that for the majority of selected markers there is one or more “normal” tissues with expression level similar to that found in myxomas. For example, TIMP1: aorta; CALB2: brain; SPP1: brain, and kidney. This means that over-expression of particular gene is not a unique feature of myxoma. Thus, a combination of markers, rather than single transcription markers, uniquely characterizes cardiac myxoma. We consider a gene suitable of being a marker of myxoma if there are no more than two of 15 different tissues where expression level of the gene lies within the same order of magnitude as in myxoma (2- or 3-fold difference in band or dot intensity was regarded as meaningless). Based on the

731

definition, for each marker the probability to find similar expression level in cardiac myxoma and in any other tissue (tumour or normal) is no more than (2/15). Hence, the probability to find similar expression level simultaneously, say for four independent markers in non-myxoma RNA samples, can be estimated as 0.134 (0.03%), which seems to be sufficient to make definite diagnosis in uncertain cases. The term independent in this context is interpreted as showing different expression pattern in the selected array of reference normal tissues. For instance, FMOD gene expressed in the aorta to the same high level as in myxoma and low in other tissues is not considered as an independent of gene TIMP1, which also is highly expressed only in the aorta, while gene SPP1 is considered as being independent of genes TIMP1 and FMOD, since it is highly expressed in brain and kidney but its expression is low in other tissues. We tested the ability of the selected markers to distinguish cardiac myxoma from other tumours. Only two cases of cardiac neoplasms other than myxoma were analysed because of their rarity. Non-cardiac tumours were chosen randomly, but for a number of these tumours a high expression level of certain cardiac myxoma markers was expected. As it was anticipated, a combination of selected markers, but not a single one uniquely, distinguishes cardiac myxoma from other tumours. Nevertheless, MIA, PLA2G2A, and PLTP must be mentioned here as myxoma markers with the highest specificity observed in this study. Remarkably, high expression level of PLA2G2A in cardiac myxomas, is not associated with overexpression of inflammation markers (IL6, TNFA, IL1B, and IL1A). Recent analysis of gene expression patterns in human gastric cancers has revealed that the expression of PLA2G2A significantly correlates with patient survival and less frequent metastasis [52]. On the other hand, the expression pattern of PLA2G2A was unique among thousands of genes examined in that study, since only one of 5200 genes analysed had an expression pattern with a Pearson correlation coefficient of 0.5 to that of PLA2G2A [52]. These findings suggest that special regulatory pathways are involved in PLA2G2A induction in tumours. Although the origin of myxoma cells was not the object of this study, a set of cartilage-specific genes (SOX9, MIA, and SPP1) [42,50,53,54] among myxoma markers indirectly supports the hypothesis that cardiac myxomas arise from pluripotent primitive mesenchymal cells which can differentiate within myxomas along a variety of lineages.

References [1] [2] [3]

Shapiro LM. Cardiac tumors: diagnosis and management. Heart 2001; 85:218–22. Petrovsky BV, Konstantinov BA, Nechaenko MA. Primary cardiac tumors. Medicine, Moscow, Russia 1997. Yoon DH, Roberts WC. Sex distribution in cardiac myxomas. Am J Cardiol 2002;90:563–5.

732 [4]

[5]

[6]

[7] [8]

[9]

[10]

[11]

[12]

[13] [14] [15] [16] [17]

[18]

[19] [20] [21]

[22]

[23]

[24]

[25]

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733 Becker AE. Primary heart tumors in the pediatric age group: a review of salient pathologic features relevant for clinicians. Pediatr Cardiol 2000;21:317–23. Stratakis CA, Kirschner LS, Carney JA. Carney complex: diagnosis and management of the complex of spotty skin pigmentation myxomas, endocrine overactivity, and schwannomas. Am J Med Genet 1998;80:183–5. Stratakis CA, Kirschner LS, Carney JA. Clinical and molecular features of the Carney complex: diagnostic criteria and recommendations for patient evaluation. J Clin Endocrinol Metab 2001;86:4041–6. Carney JA. Differences between nonfamilial and familial cardiac myxoma. Am J Surg Pathol 1985;9:53–5. Casey M, Vaughan CJ, He J, Hatcher CJ, Winter JM, Weremowicz S, et al. Mutations in the protein kinase A R1alpha regulatory subunit cause familial cardiac myxomas and Carney complex. J Clin Invest 2000;106:R31–9. Kirschner LS, Carney JA, Pack SD, Taymans SE, Giatzakis C, Cho YS, et al. Mutations of the gene encoding the protein kinase A type I-alpha regulatory subunit in patients with the Carney complex. Nature Genet 2000;26:89–92. Stratakis CA. Mutations of the gene encoding the protein kinase A type I-alpha regulatory subunit (PRKAR1A) in patients with the “complex of spotty skin pigmentation, myxomas, endocrine overactivity, and schwannomas” (Carney complex). Ann New York Acad Sci 2002;968:3–21. Skamrov AV, Feoktistova ES, Khaspekov GL, Kovalevsky DA, Goryunova LE, Beabealashvilli RSH, et al. PRKAR1A gene mutations in two patients with Carney complex. Kardiologiia 2003;43:77– 82. Ferrans VJ, Roberts WC. Structural features of cardiac myxomas: histology, histochemistry, and electron microscopy. Hum Pathol 1973;4:111–46. Burke AP, Virmani R. Cardiac myxomas: a clinicopathologic study. Am J Clin Pathol 1993;100:671–80. Bell DA, Greco MA. Cardiac myxoma with chondroid features: a light and electron microscopic study. Hum Pathol 1981;12:370–4. Roberts WC. Primary and secondary neoplasms of the heart. Am J Cardiol 1997;80:671–82. Gersak B, Mikek M, Smrkolj V, Gabrijelcic T. Results of treatment of 17 patients with heart tumor. Eur J Surg Oncol 1999;25:302–5. Araoz PA, Mulvagh SL, Tazelaar HD, Julsrud PR, Breen JF. CT and MR imaging of benign primary cardiac neoplasms with echocardiographic correlation. Radiographics 2000;20:1303–19. Grebenc ML, Rosado-de Christenson ML, Green CE, Burke AP, Galvin JR. Cardiac myxoma: imaging features in 83 patients. Radiographics 2002;22:673–89. Gilkeson RC, Chiles C. MR evaluation of cardiac and pericardial malignancy. Magn Reson Imag Clin North Am 2003;11:173–86. Burke AP, Virmani R. More on cardiac myxomas. New Engl J Med 1996;335:1462–4. Sambrook J, Fritch EF, Maniatis T. Molecular Cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory Press; 1989. Strutt B, Khalil W, Killinger D. Growth and differentiation of human adipose stromal cells in culture. In: Jones GE, editor. Human cell culture protocols. New Jersey: Humana Press; 1996. p. 41–51. Su AI, Cooke MP, Ching KA, Hakak Y, Walker JR, Wiltshire T, et al. Large-scale analysis of the human and mouse transcriptomes. Proc Natl Acad Sci USA 2002;99:4465–70. Boheler KR, Volkova M, Morrell C, Garg R, ZhuY, Margulies K, et al. Sex- and age-dependent human transcriptome variability: implications for chronic heart failure. Proc Natl Acad Sci USA 2003;100: 2754–9. Hwang DM, Dempsey AA, Wang RX, Rezvani M, Barrans JD, Dai KS, et al. A genome-based resource for molecular cardiovascular medicine: toward a compendium of cardiovascular genes. Circulation 1997;96:4146–203.

[26] Steenman M, Chen YW, Le Cunff M, Lamirault G, Varro A, Hoffman E, et al. Transcriptomal analysis of failing and nonfailing human hearts. Physiol Genomic 2003;12:97–112. [27] Whitney AR, Diehn M, Popper SJ, Alizadeh AA, Boldrick JC, Relman DA, et al. Individuality and variation in gene expression patterns in human blood. Proc Natl Acad Sci USA 2003;100:1896– 901. [28] Govoni E, Severi B, Cenacchi G, Laschi R, Pileri S, Rivano MT, et al. Ultrastructural and immunohistochemical contribution to the histogenesis of human cardiac myxoma. Ultrastruct Pathol 1988;12:221–33. [29] Berrutti L, Silverman JS. Cardiac myxoma is rich in factor XIIIa positive dendrophages: immunohistochemical study of four cases. Histopathology 1996;28:529–35. [30] Farrell DJ, Bulmer E, Angus B, Ashcroft T. Immunohistochemical expression of endothelial markers in left atrial myxomas: a study of six cases. Histopathology 1996;28:147–52. [31] Pucci A, Gagliardotto P, Zanini C, Pansini S, di Summa M, Mollo F. Histopathologic and clinical characterization of cardiac myxoma: review of 53 cases from a single institution. Am Heart J 2000;140: 134–8. [32] Terracciano LM, Mhawech P, Suess K, D’Armiento M, Lehmann FS, Jundt G, et al. Calretinin as a marker for cardiac myxoma. Diagnostic and histogenetic considerations. Am J Clin Pathol 2000;114: 754–9. [33] Acebo E, Val-Bernal JF, Gomez-Roman JJ. Prichard’s structures of the fossa ovalis are not histogenetically related to cardiac myxoma. Histopathology 2001;39:529–35. [34] Zhang T, Koide N, Wada Y, Tsukioka K, Takayama K, Kono T, et al. Significance of monocyte chemotactic protein-1 and thymidine phosphorylase in angiogenesis of human cardiac myxoma. Circ J 2003;67: 54–60. [35] Ishizaki J, Suzuki N, Higashino K, Yokota Y, Ono T, Kawamoto K, et al. Cloning and characterization of novel mouse and human secretory phospholipase A(2)s. J Biol Chem 1999;274: 24973–9. [36] Valentin E, Singer AG, Ghomashchi F, Lazdunski M, Gelb MH, Lambeau G. Cloning and recombinant expression of human group IIF-secreted phospholipase A(2). Biochem Biophys Res Commun 2000;279:223–38. [37] Nyman KM, Ojala P, Laine VJ, Nevalainen TJ. Distribution of group II phospholipase A2 protein and mRNA in rat tissues. J Histochem Cytochem 2000;48:1469–78. [38] Andreani M, Olivier JL, Berenbaum F, Raymondjean M, Bereziat G. Transcriptional regulation of inflammatory secreted phospholipases A(2). Biochim Biophys Acta 2000;1488:149–58. [39] Nevalainen TJ, Haapamaki MM, Gronroos JM. Roles of secretory phospholipases A(2) in inflammatory diseases and trauma. Biochim Biophys Acta 2000;1488:83–90. [40] Capper EA, Marshall LA. Mammalian phospholipases A(2): mediators of inflammation, proliferation and apoptosis. Prog Lipid Res 2001;40:167–97. [41] Dietz UH, Sandell LJ. Cloning of a retinoic acid-sensitive mRNA expressed in cartilage and during chondrogenesis. J Biol Chem 1996; 271:3311–6. [42] Bosserhoff AK, Buettner R. Expression, function and clinical relevance of MIA (melanoma inhibitory activity). Histol Histopathol 2002;17:289–300. [43] Billing-Marczak K, Kuznicki J. Calretinin—sensor or buffer— function still unclear. Pol J Pharmacol 1999;51:173–8. [44] Gerke V, Moss SE. Annexins: from structure to function. Physiol Rev 2002;82:331–71. [45] Huuskonen J, Ehnholm C. Phospholipid transfer protein in lipid metabolism. Curr Opin Lipidol 2000;11:285–9. [46] Visse R, Nagase H. Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ Res 2003;92:827–39.

A.V. Skamrov et al. / Journal of Molecular and Cellular Cardiology 37 (2004) 717–733 [47] Hiemstra PS. Novel roles of protease inhibitors in infection and inflammation. Biochem Soc Trans 2002;30:116–20. [48] McKee MD, Nanci A. Osteopontin: an interfacial extracellular matrix protein in mineralized tissues. Connect Tissue Res 1996;35:197–205. [49] Chakravarti S. Functions of lumican and fibromodulin: lessons from knockout mice. Glycoconj J 2002;19:287–93. [50] Bi W, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B. Sox9 is required for cartilage formation. Nat Genet 1999;22:85–9. [51] Schwaller B, Meyer M, Schiffmann S. “New” functions for “old” proteins: the role of the calcium-binding proteins calbindin D-28k, calretinin and parvalbumin, in cerebellar physiology. Studies with knockout mice. Cerebellum 2002;1:241–58.

733

[52] Leung SY, Chen X, Chu KM, Yuen ST, Mathy J, Ji J, et al. Phospholipase A2 group IIA expression in gastric adenocarcinoma is associated with prolonged survival and less frequent metastasis. Proc Natl Acad Sci USA 2002;99:16203–8. [53] de Crombrugghe B, Lefebvre V, Nakashima K. Regulatory mechanisms in the pathways of cartilage and bone formation. Curr Opin Cell Biol 2001;13:721–7. [54] Pullig O, Weseloh G, Gauer S, Swoboda B. Osteopontin is expressed by adult human osteoarthritic chondrocytes: protein and mRNA analysis of normal and osteoarthritic cartilage. Matrix Biol 2000;19: 245–55.