GENE EXPRESSION DURING DIFFERENTIATION OF HUMAN DENDRITIC CELLS FROM CORD BLOOD CD34 STEM CELLS

D.R.

866056—CYTO 11/2 (Press Set)————MS 0391

Article No. cyto.1998.0403, available online at http://www.idealibrary.com.on

GENE EXPRESSION DURING DIFFERENTIATION OF HUMAN DENDTRITIC CELLS FROM CORD BLOOD CD34 STEM CELLS Gabrielle M. Fisher,

Sharifah Iqball,

Stella C. Knight

Human cord blood CD34+ stem cells were allowed to differentiate in the presence of cytokines stem cell factor (SCF), granulocyte–macrophage colony-stimulating factor (GM-CSF) and tumour necrosis factor alpha (TNF-a) into functional CD1a+ dendritic cells (DC). A maximum of 1.9 × 106 CD1a+ cells were separated from the cells generated from 1.2 × 106 CD34+ stem cells from an individual donor. The percentage of CD1a+ cells separated rose to a maximum of 27% at day 11 and fell to 8% at 21 days. Reverse transcription-polymerase chain reaction analysis showed that interleukin 2 receptor, interleukin 3 receptor, interleukin 6 receptor, interleukin 12 receptor (IL-12R) and signal transducer and activator of transcription (STAT) 3, STAT 4 mRNA was expressed in all CD1a+ cell populations throughout and appears to be constitutive. Expression of IL-12RmRNA was unexpected in CD1a+ DC normally considered to be of myeloid lineage. Expression of interleukin 12 (IL-12) p40 subunit mRNA was not detected. Intermittent expression of the IL-12p35 subunit and IL-4R mRNA suggested that gene expression is inducible, but not obviously correlated with progressive DC development. Expression of mRNA for a spectrum of cytokine receptors indicates that CD1a+ DC have the potential to respond to a variety of maturational signals. 7 1999 Academic Press

Dendritic cells (DC) form part of the immune network. They comprise a small population of antigen presenting cells widely distributed as a trace cell type in most tissues. Numbers in peripheral blood have been estimated at less than 0.1% of the white blood cells, making isolation of large numbers difficult.1 Dendritic cells can now be generated in vitro from haematopoietic stem cells in bone marrow, peripheral blood or umbilical cord blood and also from the more differentiated mononuclear cells in peripheral blood.2–4 Umbilical cord blood provides an accessible source of large numbers of stem cells that can be isolated because they express the characteristic cell surface marker CD34. Their potential to develop into cell types of the haematopoietic system, including dendritic cells, depends largely on the balance of cytokines in the cellular environment.5 To generate large numbers of

From the Antigen Presentation Research Group, Imperial College of Science Technology & Medicine, Northwick Park Institute for Medical Research, Harrow, HA1 3UJ, Middlesex, UK Correspondence to: G.M. Fisher, Antigen Presentation Research Group, Imperial College of Science Technology & Medicine, Northwick Park Institute for Medical Research, Watford Road, Harrow, HA1 3UJ, Middlesex, UK; E-mail: g.fisher.ic.ac.uk Received 28 January 1998, accepted for publication 5 June 1998 7 1999 Academic Press 1043–4666/99/020111 + 07 $30.00/0 KEY WORDS: CD1a/ cytokine/ cytokine receptors/ dendritic cells/ mRNA expression CYTOKINE, Vol. 11, No. 2 (February), 1999: pp 111–117

dendritic cells, CD34+ stem cells have been cultured in a variety of cytokine combinations; one of the most successful combinations for producing mature DC able to stimulate T cells is stem cell factor (SCF), granulocyte–macrophage colony-stimulating factor (GM-CSF), and tumour necrosis factor alpha (TNF-a).6 At the genetic level, the molecular basis of commitment and differentiation is still poorly understood. We have studied gene expression of receptors for several cytokines known to be associated with stem cell development into dendritic cells. GM-CSF favours outgrowth of DC from peripheral blood.7,8 TNF-a is crucial for generating dendritic Langerhans’ cells from CD34+ haematopoietic progenitors6 and is probably needed only for the first 3 days in culture.9 TNF-a can also interact with the interleukin (IL) 3 receptor, GM-CSF receptor and G-CSF receptor to stimulate IL-3 and GM-CSF-dependent, early development of monocytic cells from CD34+ haematopoietic progenitor cells and to inhibit the granulocytic differentiation pathway.10 Stem cell factor (c-kit ligand) acts directly to promote stem cell proliferation and also acts synergistically with IL-3 and IL-6 on stem cells in vitro.11 Interleukin 3 increased the final number of DC generated from mobilised CD34+ cells.12 Interleukin 4 suppresses the macrophage pathway in precursors capable of developing into either DC or macrophages13,14 and a combination of IL-4 and GM-CSF has 111

D.R.

866056—CYTO 11/2 (Press Set)————MS 0391

112 / Fisher et al.

RESULTS A low percentage (approximately 3%) of CD1a+ cells was separated from cultures of CD34+ stem cells incubated for 3 days, increasing to a maximum of approximately 27% from cultures incubated for 11 days and declining thereafter to approximately 8% from cultures incubated for 21 days (Fig. 1). The maximum expansion, 58-fold, was seen in a population of cells incubated for 12 days, although, in this

30 25 CD1a+ cells (%)

been used to generate large numbers of DC from peripheral blood mononuclear cells.4 IL-12 is known to increase the number of bone marrow stem cells and their myeloid progeny and to act synergistically with other cytokines including SCF and IL-3.15 Thus, many cytokines acting alone or in combination can influence the differentiation of DC from their stem cell precursors. Different pathways of development may result in different DC subsets.16–19 Culturing CD34+ stem cells with GM-CSF and TNF-a gives rise to a heterogeneous population containing cells with typical dendritic morphology. The CD1a cell surface antigen is a characteristic marker of DC derived from cord blood stem cells.1 This differs from the situation in bone marrow in which precursor cells were shown to have a greater capacity to form macrophages and CD1a did not prove to be a discriminating marker for DC.20 In this study, therefore, we have chosen to use cord blood as a source of stem cells and maturing DC were isolated on the basis of their CD1a expression. We used reverse transcription followed by amplification by polymerase chain reaction (RT-PCR) to monitor expression of mRNA for receptors of several cytokines important in the differentiation of CD34+ stem cells into functional CD1a+ dendritic cells. The expression of the receptor ligand-specific a subunit (where known) was investigated in preference to the common signalling b subunit that may be shared by several different receptors. Expression of the cytokine IL-12 p35 and p40 subunits were investigated because IL-12 is known to be expressed by CD1a+ DC in skin.21 Cytokine function is mediated by signal transducer and activator of transcription (STAT) proteins. We have therefore included in our study two STAT genes that may be important in differentiation, the essential STAT 3 gene which has a broad activation profile and STAT 4 which has a much narrower activation profile including IL-12 as a specific ligand.22 Assuming that a direct relationship exists between levels of messenger (mRNA) and those of the corresponding proteins, this study identifies the potential of DC developing from cord blood stem cells to respond to a variety of maturational signals.

CYTOKINE, Vol. 11, No. 2 (February, 1999: 111–117)

20 15 10 5 0

0

3

5

6

7

8

9 10 11 12 13 14 15 16 21

Days in culture Figure 1. Development of CD1a+ dendritic cells from human cord blood CD34+ cells. CD34+ stem cells were cultured in the presence of SCF, GMCSF and TNF-a for up to 21 days. CD1a+ cells were selected by immunomagnetic selection and counted microscopically. Results are an average of between 2 and 6 donor samples per time point and the maximum results are indicated by bars.

instance, only 10% (8.4 × 105) CD1a+ cells were separated. The percentage of CD1a+ cells tended to increase with expansion of the total cell population, but did not correlate with the final number of cells. This lack of correlation reflected the variable proliferation and differentiation potential of CD34+ progenitors. The maximum yield of CD1a+ cells generated in vitro, from a single individual, was approximately 1.9 × 106 from an initial 1.2 × 106 CD34+ cord blood stem cells cultured for 21 days. The lower yield may have resulted not only from the wide variability in potential of stem cells from different donors, but also from the stringent immunomagnetic selection of only those CD1a+ cells that strongly label for the CD1a marker. In support of the latter explanation, weakly staining CD1a+ cells could be identified, by FACS, amongst the CD1a depleted population. Expression of IL-2Ra, IL-3Ra, IL-4Ra, IL-6Ra, IL-12R, STAT3 and STAT4 mRNA was detected, by RT-PCR analysis, in all populations of CD1a+ cells cultured for between 3 days and 21 days (Fig. 2A–H). These genes appear to be expressed constitutively. Thus the potential to respond to and be influenced by the cytokines IL-2, IL-3, IL-4, IL-6 and IL-12 is maintained throughout development from day 0 to day 21. The lowest number of CD1a+ cells used for molecular studies was 2 × 104 cells. At this cell number we were able to detect mRNA expression for the cytokine receptors IL-2Ra, IL-3Ra, IL-4R, IL-6Ra, IL-12R and for the STAT proteins STAT3 and STAT4, in addition to mRNA for the positive control, housekeeping gene GAPDH. The lowest number of cells in which we detected expression of mRNA for the cytokine IL-12p35 subunit was 5 × 104. We were not able to detect expression of IL-12p40 mRNA in any CD34 derived cells, in populations containing 1.9 × 106

D.R.

866056—CYTO 11/2 (Press Set)————MS 0391 Gene expression in dendritic cells / 113

120

120

A

IL-2R

80 40 0 120

0

3

5

6

7

8

9

GAPDH expression (%)

10 11 12 13 14 15 16 21

0 120

B

IL-3R

40

120

0

3

5

6

7

8

9

C

10 11 12 13 14 15 16 21 IL-6R

0

120

40

40 0

3

5

6

7

8

9

10 11 12 13 14 15 16 21

0 120

D

IL-12R

80 40 0

3

5

6

7

8

9

F

10 11 12 13 14 15 16 21 IL-12p35

40

80

120

0

80

80

0

IL-4R

40

80

0

E

80

0

3

5

6

7

8

9

G

0

10 11 12 13 14 15 16 21 STAT 3

3

5

6

7

H

8

9

10 11 12 13 14 15 16 21 STAT 4

80 40

0

Figure 2.

3

5

6

7

8 9 10 11 12 13 14 15 16 21 Days in culture

0

0

3

5

6

7

8 9 10 11 12 13 14 15 16 21 Days in culture

Gene expression in CD1a+ cells derived from human cord blood CD34+ stem cells.

CD34+ stem cells were cultured in GMCSF, SCF and TNF-a for between 0 and 21 days. For each time point, CD1a+ dendritic cells were immunomagnetically selected, and levels of mRNA were analysed by RT-PCR. Levels of gene expression are shown (Q) (A–H) for the IL-2 receptor (IL-2R), IL-3 receptor (IL-3R), IL-6 receptor (IL-6R), IL-12 receptor (IL-12R), IL-4 receptor (IL-4R), IL-12p35 subunit (IL-12p35), STAT 3 and STAT 4. Levels of gene expression in the CD34+ stem cells at day 0 (q), are shown for comparison. Results are expressed as % of GAPDH expression in the same mRNA sample. Each point is representative of between two and six donor samples. Undetectable expression of IL-12p40 is not shown.

CD1a+ cells or in up to 7.3 × 107 CD1a-depleted cells. In contrast, p40 mRNA was readily detected in 5 × 106 cells of a mixed culture of leukocytes from different donors, yet not in the same number of leukocytes, from a single donor, activated by concanavalin A or phorbol ester (data not shown). Expression of the IL-12p35 subunit in CD1a+ cells was detected in some, but not all cultures. Message was detected in cultures incubated for 0, 3, 6, 11, 14 and 21 days (Fig. 2F) and may be inducible. Lack of expression could not be explained by low cell numbers, because cell numbers for the intervening time points were well above the previous 5 × 104 minimum level for p35 detection. IL-4R mRNA was absent in CD1a+ cells cultured for 3, 7, 9, 13 and 16 days (Fig. 2E) and appears to be inducible. In this study, lack of IL-4R expression did not appear to correlate with expression of other transcripts including the transient expression of IL-12p35 mRNA.

Expression of IL-12R mRNA was readily detected in CD1a+ cells separated from all cultures throughout day 0 to day 21 (Fig. 2D). Amplification of IL-12R cDNA frequently gave rise to product bands of two sizes, i.e. 390 bp as expected and 600 bp. This effect is being investigated further.

DISCUSSION Human cord blood CD34+ stem cells were allowed to differentiate in the presence of cytokines into functional CD1a+ dendritic cells. Expression of mRNA for a variety of cytokine receptors suggests that DC respond to various environmental stimuli. Different responses may account for the natural heterogeneity of DC at different sites; CD1a+ dendritic cells being one DC type. The rise and fall in percentage CD1a+ cells in cultures of differentiating cord blood stem cells

D.R.

866056—CYTO 11/2 (Press Set)————MS 0391

114 / Fisher et al.

confirms previous findings.14 The maximum percentage value is lower than those obtained by flow cytometry, reported as 40% by Rosenzwajg14 and 60% by Caux,8 although similar to yields from mobilized blood.5 The maximum yield of CD1a+ cells generated in vitro, from a single individual, was lower than the 20-fold increase predicted by Caux,8 for cord blood stem cells cultured with TNF-a and GM-CSF. Lower values, in both cases, can be partly explained by the inherent variability of stem cells from different donors and partly by methodology. Flow cytometry detects both strongly and weakly labelled cells, whereas in this study, immunomagnetic selection would have separated only those cells that were strongly CD1a+. Gene expression was not obviously correlated with progressive DC development. In the differentiation of peripheral blood CD34+ cells, Testa23 showed that expression of receptors was lineage specific. They showed, by RT-PCR analysis, that mRNA expression of the early acting IL-6R progressively declined in the erythroid (E) and granulocytic (G) lineage, was sustained until day 7 and then declined in the megakaryocytic (Mk) lineage and increased through day 9 and remained detectable until terminal maturation in the monocytic (Mo) lineage. In this respect, IL-6 mRNA expression in CD1a+ cells resembles that seen in the monocytic lineage. Similarly, IL-3R expression was shown to be rapidly downmodulated in Mk and E, but reduced more slowly in Mo and sustained in G pathways. In this study the DC pattern of expression, as expected, resembles the Mo and G pathways more than E or Mk. The lack of expression of IL-12p40 mRNA in CD1a+ cells derived from cord blood contrasts with previous reports for CD1a+ cells isolated from skin.21,24 Yawalkar21 was able to detect low levels of expression of both IL-12 p35 and p40 mRNA in between 1 × 104 and 9 × 104 freshly isolated CD1a + dendritic Langerhans’ cells using a nested reverse transcriptase polymerase chain reaction method and Kang24 found that freshly isolated Langerhans’ cells upregulate IL-12p40 after overnight incubation and maturation into DC. It may be that this gene is only expressed at detectable levels in cells activated in a special way, for example in vitro by Staphylococcus aureus Cowan 1 strain(SAC) protein or by lipopolysaccharide (LPS)25 or foreign lymphocytes (as in this study), or in vivo by cytokines present in the tissue as a result of a past infection or encounters with environmental antigens. In this study, it may be that expression of IL-12p40 was not triggered in CD1a+ dendritic cells generated from stem cells in an essentially antigen-free environment. In addition, it may have been difficult to detect IL-12 p40 mRNA because it is degraded more rapidly than other messages and degraded more rapidly in DC derived

CYTOKINE, Vol. 11, No. 2 (February, 1999: 111–117)

from cord blood stem cells than Langerhans’ cells. In agreement with our results, Lee26 reported negligible basal levels of p40 transcript in unstimulated cord blood mononuclear cells. They also noted that the half life of IL-12p40 mRNA was approximately three-fold lower in activated cord blood mononuclear cells than in activated adult peripheral blood mononuclear cells i.e. 114 2 3 min compared to 353 2 7.8 min. Expression of IL-12p35 mRNA appeared to be inducible. Reduced levels of p35 may be associated with bursts of developmental change in the cell population leading to suppression or rapid inactivation of p35 mRNA. Expression of IL-12p35 in the absence of the p40 subunit is not surprising, because subunits have been shown to be differentially expressed in different types of cells and subject to different regulatory mechanisms.27,28,33 Whether similar mechanisms operate during DC development to account for the transient expression of p35 mRNA and lack of expression of p40 mRNA remains to be elucidated. It is reasonable to assume that cytokines exert their widespread effects via receptors expressed by the developing cells and in binding their receptors, they may activate specific pathways or block activation by alternative cytokines. IL-4 has proved very useful in the generation of DC in vitro, in that it appears to promote DC development by suppressing the alternative macrophage pathway in bipotent DC/macrophage precursors identified in peripheral blood.4,13,14 The presence of IL-4R message in CD1a+ cells suggests that IL-4 may act directly on DC and play a more positive role in DC differentiation. In this study, differentiation was manipulated by positively selecting CD34+ stem cells and by culturing them with known recombinant cytokines. However, cells also may have been influenced by trace cytokines present in the added foetal calf serum5 and by cytokines produced by cells of other lineages differentiating simultaneously. Such influences may have been responsible for the observed intermittent expression of IL4R mRNA. In a previous study of biological distribution, using FACS and RT-PCR analysis, IL-12R was shown to be expressed on several human T, NK and B cell lines but not on non-lymphohaematopoietic cell lines.29 In this study, the expression of IL-12R on CD1a+ dendritic cells extends this distribution to cells of the myeloid lineage. The IL-12 receptor has recently been shown to be composed of at least two beta-type cytokine receptor subunits.30 The IL-12R sequence on which our primers were based has now been redesignated IL-12Rb1 and the IL-12Rb1 protein has been shown necessary for IL-12 signalling. Interestingly, the IL-12p40 subunit has been shown to interact primarily with IL-12Rb1. Expression of IL-12R has been shown to be subject to regulation by IL-4 and

D.R.

866056—CYTO 11/2 (Press Set)————MS 0391 Gene expression in dendritic cells / 115

[3H]TdR uptake (cpm)

1200

MATERIALS AND METHODS Medium and reagents Cord blood stem cells were cultured in medium consisting of RPMI 1640 Dutch modification (Sigma Chemical Co., UK) supplemented with 10% (V/V) foetal calf serum (Gibco Co., UK), penicillin (100 units/ml), streptomycin (100 mg/ml) and 2 mM glutamine (ICN Flow, UK), recombinant human stem cell factor (SCF) (10 ng/ml), recombinant human granulocyte–macrophage colonystimulating factor (GM-CSF) (100 ng/ml) and recombinant human tumour necrosis factor a (TNF-a) (50 units/ml) (R&D Systems Europe Ltd., UK).

800

400

0

1000

2000

3000

4000

Number of stimulator cells Figure 3. Stimulation of lymphocyte proliferation by CD1a+ dendritic cells. 4

In a mixed leukocyte reaction, allogeneic responder cells (1.25 × 10 cells per well) were cultured with different numbers of stimulator CD1a+ dendritic cells. Cells were harvested after three days and proliferation of responder cells was measured by uptake of [3H]thymidine ([3H]TdR). (W), CD1a+; (Q), CD1a−.

interferon g and may play a role in CD4+ T cell development into Th1 or Th2 cells.31 However, we did not detect any gross changes in IL-12R expression during development of CD1a+ dendritic cells. If the receptor proteins are expressed, CD1a+ DC appear to remain responsive to a wide variety of cytokines by virtue of their expression of the corresponding receptor genes for at least three weeks in culture. It may be that in common with other terminally differentiated cells regulation is at the translational level and not the transcriptional level.

TABLE 1. Primer GAPDH GAPDH IL-1Ra IL-2Ra IL-3Ra IL-3Ra IL-4R IL-4R IL-6Ra IL-6Ra IL-12R IL-12R STAT3 STAT3 STAT4 STAT4 IL-12P35 IL-12P35 IL-12P40 IL-12P40

Isolation of CD34+ stem cells from cord blood Umbilical cord blood samples were obtained from normal healthy infants according to local guidelines. Briefly, lymphocytes were separated from individual umbilical cord blood samples by density gradient centrifugation over Ficoll Paque8 (Pharmacia Biotech, UK). Stem cells expressing the CD34 cell surface antigen were isolated by immunomagnetic selection using the MACS device (Miltenyi Biotec GmbH, Germany) according to the manufacturer’s protocol. Cells isolated in this way are 85–98% pure. CD34+ cells were cultured in 24-well plates at a density of approximately 5 × 105 cells/ml for periods up to 21 days. Antibody labelling, immunomagnetic selection and function of CD1a+ cells Cells were harvested, washed in phosphate-buffered saline (PBS) containing 2 mM EDTA and 0.5% (V/V) BSA (Sigma Chemical Co., UK) and labelled for 15 min at 6–12°C (bottom shelf of a refrigerator) with CD1a-FITC conjugated monoclonal antibody (Ortho-mune OKT6) (Ortho Diagnostic Systems Ltd., UK). Positive cells were selected by immunomagnetic selection using anti-FITC magnetic beads and the MACS device (Miltenyi Biotec GmbH, Germany).

Gene specific primers used in PCR Orientation*

Sequence

Product (bp)

Genbank8 Reference

S AS S AS S AS S AS S AS S AS S AS S AS S AS S AS

GTCAGTGGTGGACCTGACCT AGGGGTCTACATGGCAACTG GTGAGACTTCCTGCCTCGTC TTTATTAGGCAACGTGAACGG ATTGAGATATTAACTCCACCCAACA ACCCGTTAGGAATGTCCATTC CCTTGGCATCTCCCAATG GTGTCGGAGACATTGGTGTG TTCCTCTCATCTCCCCACC CCTGAGGGTGCAGCTTGT CAGCTCCACATGCTGTCCT GTAACACTTTTCCTGCCCCA ACATTCTGGGCACAAACACA ATGTTGGAGATCACCACAACTG AGCTGAAGTTTCACTCCGGA CAAACCAGATCAGCTTTTACCC GACCACCTCAGTTTGGCCAG GGCCAGGCAACTCCCATTAG CCAAGAACTTGCAGCTGAAG TGGGTCTATTCCGTTGTGTC

420

M33197

723

X010157

642

M74782

664

X52425

518

M20566

390

U03187

247

AA053514

628

L78440

409

Reference 33

355

Reference 33

*S—sense oligonucleotide; AS—antisense oligonucleotide.

D.R.

866056—CYTO 11/2 (Press Set)————MS 0391

116 / Fisher et al.

The purity of cells was assessed by flow cytometry using a FACScan8 (Becton Dickinson, UK). Cells isolated in this way were q90% pure. The function of CD1a+ dendritic cells was assessed by their ability to stimulate proliferation as measured by cellular incorporation of thymidine.32 CD1a+ cells stimulated primary allogeneic proliferation (Fig. 3). mRNA extraction–reverse transcription (RT) –polymerase chain reaction(PCR) Cells were lysed in a guanidinium isothiocyanate buffer and mRNA isolated directly by binding to oligo dT cellulose (AMS Biotechnology Europe, UK). An oligo dT primer was used to convert mRNA to cDNA in a final volume of 20 ml according to the manufacturer’s protocol (Invitrogen BV, The Netherlands). In PCR, 2 ml RT-product was amplified in a final volume of 25 ml PCR buffer consisting of 10 mM Tris–HCl (pH 8.8), 50 mM KCl, 2.5 mM MgCl2, 200 mM (each) dNTPs, 2.5 U Taq polymerase (Amersham Life Sciences Ltd.) and 50 ng of each primer. As a control, an aliquot of non-reverse transcribed mRNA was amplified simultaneously to ensure the absence of genomic DNA contamination. Primers are listed in Table 1. IL-12p35 and IL-12p40 primer sequences were designed by S.F. Wolf— cited,33 all other specific primers used to amplify the genes of interest were based on published sequences in GENBANK and designed using the Primer program (primer.genome.wi.edu). Primer pairs were designed to amplify under the same standard set of conditions (annealing temperature, 53° and 2.5 mM Mg2 + ) and to produce different sized products clearly resolvable by agarose gel electophoresis. Samples were amplified in parallel with an initial denaturation step of 94°C for 2 min followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 30 s and elongation at 72°C for 30 s with a final extension step of 72°C for 10 min. An 8-ml sample of each PCR product was analysed by electrophoresis on a 2% agarose gel containing 0.5 mg/ml ethidium bromide. Band densities were estimated and numerical values assigned using a scanner and Molecular Analysis Software (Bio-Rad Laboratories, UK). Results were expressed as a percentage of the band density obtained simultaneously for the housekeeping gene GAPDH in the same RT product.

Acknowledgements We would like to thank the UK HGMP Resource Centre for supplying IL-2Ra, IL-3Ra, IL-4Ra, IL-6Ra and IL-12R primers. We would like to thank the staff at the London Cord Blood Bank for collection of cord blood. This work was funded by the UK Medical Research Council.

REFERENCES 1. Steinman RM (1991) The dendritic cell system and its role in immunogenicity. Annu Rev Immunol 9:271–296. 2. Reid CDL, Fryer PR, Clifford C, Kirk A, Tikerpae J, Knight SC (1990) Identification of haematopoietic progenitors of

CYTOKINE, Vol. 11, No. 2 (February, 1999: 111–117) macrophages and dendritic Langerhans’ cells (DL-CFU) in human bone marrow and peripheral blood. Blood 76:1139–1149. 3. Santiago-Schwarz F, Belilos E, Diamond B, Carsons SE (1992) TNF in combination with GM-CSF enhances the differentiation of neonatal cord blood stem cells into dendritic cells and macrophages. J Leukoc Biol 52:274. 4. Romani N, Gruner S, Brang D, Kampgen E, Lenz A, Trockenbacher B, Konwalinka G, Fritsch PO, Steinman RM, Schuler G (1994) Proliferating dendritic cell progenitors in human blood. J Exp Med 180:83–93. 5. Reid CDL (1997) The dendritic cell lineage in haemopoiesis. Br J Haematol 96:217–223. 6. Santiago-Schwarz F, Rappa DA, Laky K, Carsons SE (1995) Stem cell factor augments tumour necrosis factor-granulocytemacrophage colony-stimulating factor-mediated dendritic cell hematopoiesis. Stem Cells 13:186–197. 7. Markowicz S, Engleman EG (1990) Granulocytemacrophage colony-stimulating factor promotes differentiation and survival of human peripheral blood dendritic cells in vitro. J Clin Invest 85:955–961. 8. Caux C, Dezutter-Dambuyant C, Schmitt D, Bancherau J (1992) GM-CSF and TNF-a Cooperate in the generation of dendritic Langerhans’ cells. Nature 360:258–261. 9. Reid CDL, Stackpoole A, Meager A, Tikerpae J (1992) Interactions of tumor necrosis factor with granulocyte-macrophage colony-stimulating factor and other cytokines in the regulation of dendritic cell growth in vitro from early bipotent CD34+ progenitors in human bone marrow. J Immunol 149:2681–2688. 10. Caux C, Favre C, Saeland S, Duvert V, Durand I, Mannoni P, Banchereau J (1991) Potentiation of early hematopoiesis by tumour necrosis factor-a is followed by inhibition of granulopoietic differentiation and proliferation. Blood 78:635–644. 11. Brugger W, Mocklin W, Heimfeld S, Berenson RJ, Mertelsmann R, Kanz L (1993) Ex vivo expansion of enriched peripheral blood CD34+ progenitor cells by stem cell factor, Interleukin-1b (IL-1b), IL-6, IL-3, Interferon-g and erythropoietin. Blood 81:2579–2584. 12. Siena S, Di Nicola D, Bregni M, Mortarini R, Anichini A, Lombardi L, Ravagnani F, Parmiani G, Gianni AM (1995) Massive ex vivo generation of functional dendritic cells from mobilized CD34+ blood progenitors for anticancer therapy. Exp Haematol 23:1463–1471. 13. Jansen JH, Wientjens G-JHM, Fibbe WE, Willemze R, Kluin-Nelemans HC (1989) Inhibition of human macrophage colony formation by interleukin 4. J Exp Med 170:577–582. 14. Rosenzwajg M, Canque B, Gluckman JC (1996) Human dendritic cell differentiation pathway from CD34+ hematopoietic precursor cells. Blood 87:535–544. 15. Jacobsen SEW, Veiby OP, Smeland EB (1993) Cytotoxic lymphocyte maturation factor (Interleukin 12) is a synergistic growth factor for hematopoietic stem cells. J Exp Med 178:413–418. 16. Caux C, Vanbervliet B, Massacrier C, Dezutter-Dambuyant C, de Saint-Vis B, Jacquet C, Yoneda K, Imamura S, Schmitt D, Banchereau J (1996) CD34+ haematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to GM-CSF + TNF-a. J Exp Med 184:695–706. 17. Caux C, Massacrier C, Vanbervliet B, Dubois B, Durand I, Cella M, Lanzavecchia A, Banchereau J (1997) CD34+ haematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to granulocytemacrophage colony-stimulating factor plus tumour necrosis factor a: II. Functional analysis. Blood 90:1458–1470. 18. Flores-Romo L, Bjorck P, Duvert V, Van Kooten C, Saeland S, Banchereau J (1997) CD40 ligation on human cord blood CD34+ hematopoietic progenitors induces their proliferation and differentiation into functional dendritic cells. J Exp Med 185: 341–349. 19. Galy A, Travis M, Cen D, Chen B (1995) Human T, B, natural killer, and dendritic cells arise from a common bone marrow progenitor cell subset. Immunity 3:459–473.

D.R.

866056—CYTO 11/2 (Press Set)————MS 0391 Gene expression in dendritic cells / 117

20. Szabolcs P, Avigan D, Gezelter S, Ciocon DH, Moore MAS, Steinman RM, Young JW (1996) Dendritic cells and macrophages can mature independently from a human bone marrow-derived, post-colony-forming unit intermediate. Blood 87:4520–4530. 21. Yawalkar N, Brand CU, Braathen LR (1996) IL-12 gene expression in human skin-derived CD1a+ dendritic lymph cells. Arch Dermatol Res 288:79–84. 22. Thierfelder WE, Van Deursen JM, Yamamoto K, Tripp RA, Sarawar SR, Carson RT, Sangster MY, Vignali DAA, Doherty PC, Grosveld GC, Ihle JN (1996) Requirement for STAT4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171–174. 23. Testa U, Fossati C, Samoggia P, Masciulli R, Mariani G, Hassan HJ, Sposi NM, Guerriero R, Rosato V, Gabbianelli M, Pelosi E, Valtieri M, Peschle (1996) Expression of growthfactor receptors in unilineage differentiation culture of purified hematopoietic progenitors. Blood 88:3391–3406. 24. Kang K, Kubin M, Cooper KD, Lessin SR, Trinchieri G, Rook AH (1996) IL-12 synthesis by human Langerhans’ cells. J Immunol 156:1402–1407. 25. Hilkens CMU, Kalinski P, Boer M de, Kapsenberg ML (1997) Human dendritic cells require exogenous Interleukin-12 inducing factors to direct the development of naive T-helper cells towards the Th1 phenotype. Blood 90:1920–1926. 26. Lee S, Suen Y, Chang L, Bruner V, Qian J, Indes J, Knoppel E, Van de Ven C, Cairo MS (1996) Decreased Interleukin-12 (IL-12) from activated cord versus adult peripheral blood mononuclear cells and upregulation of interferon-g, natural killer and lymphokine-

activated killer activity by IL-12 in cord blood mononuclear cells. Blood 88: 945–954. 27. D’Andrea A, Rengaraju M, Valiante NM, Chehimi J, Kubin M, Aste M, Chan SH, Kobayashi M, Young D, Nickbarg E, Chizzonite R, Wolf SF, Trinchieri G (1992) Production of natural killer cell stimulatory (interleukin 12) by peripheral blood mononuclear cells. J Exp Med 176:1387. 28. Kato T, Hakamada R, Yamane H, Nariuchi H (1996) Induction of IL-12p40 messenger RNA expression and IL-12 production of macrophages via CD40-CD40 ligand interaction. J Immunol 156:3932–3938. 29. Wu CY, Warrier RR, Carvajal DM, Chua AO, Minetti LJ, Chizzonite R, Mongini PKA, Stern AS, Gubler U, Presky DH, Gately MK (1996) Biological function and distribution of human interleukin-12 receptor-beta chain. Eur J Immunol 26:345–350. 30. Presky DH, Yang H, Minetti LJ, Chua AO, Nabavi N, Wu CY, Gately MK, Gubler U (1996) A functional interleukin 12 receptor complex is composed of two b-type cytokine receptor subunits. PNAS 93:14002–14007. 31. Szabo SJ, Dighe AS, Gubler U, Murphy KM (1997) Regulation of the Interleukin (IL-) -12R b2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J Exp Med 185:817–824. 32. Knight SC (1988) Lymphocyte proliferation assays. In Klaus GGB (ed.) Lymphocytes—a Practical Approach, IRL Press, pp. 189–207. 33. Chougnet C, Wynn TA, Clerici M, Landay AL, Kessler HA, Rusnak J, Melcher GP, Sher A, Shearer GM (1996) Molecular analysis of decreased Interleukin-12 production in persons infected with human immunodeficiency virus. J Inf Dis 174:46–53.