- Email: [email protected]
Gene expression in formalin-fixed paraffin-embedded lymph nodes
Journal of Immunological Methods 359 (2010) 42–46
Contents lists available at ScienceDirect
Journal of Immunological Methods j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j i m
Research paper
Gene expression in formalin-fixed paraffin-embedded lymph nodes Mariastefania Antica a,⁎, Mladen Paradzik a, Sanja Novak a, Sonja Dzebro b, Marija Dominis b a b
Laboratory for Electron Microscopy, Bijenicka 54, Rudjer Boskovic Institute, HR-10000 Zagreb, Croatia Department of Pathology, Merkur Clinical Hospital, Zagreb, Croatia
a r t i c l e
i n f o
Article history: Received 17 March 2010 Received in revised form 19 May 2010 Accepted 27 May 2010 Available online 4 June 2010 Keywords: Lymph nodes Lymphocytes Gene expression RNA Lymphoma
a b s t r a c t Elucidation of molecular pathways involved in development of human lymphoma requires efficient methods for tackling gene expression in lymph nodes. Expression studies of transcription factors in these malignancies facilitate understanding the changes occurring in neoplastic transformation and lymphoma development. Excised lymph nodes are routinely fixed in formalin and embedded in paraffin for diagnosis and stored in many hospitals' pathology archives. These tissues represent a precious resource for research since they allow retrospective studies to cover a broad range of human lymphoma even the less frequent types. Reverse transcription polymerase chain reaction (RT-PCR) is a commonly used method for gene expression analysis and a reproducible protocol for RNA isolation from lymph nodes is an inevitable requirement for these studies. However, formalin fixation and paraffin-embedding interfere with the quality of RNA especially when isolated from lymph nodes being the most fragile lymphatic tissues. We present here a simple and fast method for RNA isolation from formalin-fixed paraffin-embedded lymph nodes that can be successfully applied for RT-PCR as well as for quantitative RT-PCR analysis. We tested diverse isolation reagents and combined a range of factors in order to get a high quality RNA for retrospective studies of gene expression in human lymphoma samples. Our modified method of RNA extraction from FFPE provides superior yields and purity based on qPCR data. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Molecular pathways involved in development of human lymphoma require efficient methods for tackling gene expression in lymph nodes. Expression studies of transcription factors in these malignancies facilitate understanding the changes occurring in neoplastic transformation and lymphoma development (Winandy et al., 1995; Morgan et al., 1997; Sun et al., 1999; Warren and Rothenberg, 2003; Ng et al., 2007; Antica et al., 2008). Molecular methods applied for studying lymphoproliferative disorders are often limited by the lack of fresh material since routine diagnostics in clinical practice is based on classical histological analysis of formalinfixed paraffin-embedded (FFPE) tissues (Cairns et al., 1997; Abbreviations: FFPE, Formalin-fixed paraffin-embedded. ⁎ Corresponding author. Tel.: + 385 1 456 1065; fax: + 385 1 456 1177. E-mail address: [email protected] (M. Antica). 0022-1759/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.jim.2010.05.010
Coombs et al., 1999; Korbler et al., 2003). Lymph nodes, routinely fixed in formalin, embedded in paraffin for diagnosis are stored in many hospitals' pathology archives and represent a precious resource for research. They cover a broad range of human lymphoma and allow retrospective studies in order to collect even the less frequent types. Recent development of different molecular techniques have proven FFPE tissues to be a valuable resource of research material because of the possibility to scan large archives of diverse pathological specimens stored in many hospitals (Koopmans et al., 1993; Masuda et al., 1999). Archive material allows making use of long-term follow up studies and their correlation with diagnosis, prognosis and treatment. RNA isolation from FFPE tissues, combined with techniques like polymerase chain reaction (PCR) analysis makes a powerful tool for genomic research and gene expression studies even in years-old specimens. Reverse transcription polymerase chain reaction (RT-PCR) is a commonly used method for gene
M. Antica et al. / Journal of Immunological Methods 359 (2010) 42–46
expression analysis but formalin fixation and paraffin-embedding may interfere with the quality of RNA especially when isolated from lymph nodes being the most fragile lymphatic tissues. Procedures for long-term storage of tissues like dehydration and fixation seriously challenge the quality of recovered nucleic acids and the efficiency of isolation. Formalin fixation produces cross-links nucleic acids and proteins and covalently modifies RNA by adding monomethyol groups interfering with RNA isolation and subsequent reactions like RT-PCR. In addition to that there is controversy in literature on the quality of RNA isolated from FFPE. This variability could depend on the tissues analyzed. Especially lymph nodes are very fragile since even by immediate cell isolation there are many dead cells in suspensions. Therefore, in this study we compared different RNA extraction methods and present our own procedure which makes RNA isolation from FFPE lymph nodes quick and easy. We further compared RNA extracted from FFPE by our optimized method and from fresh lymph nodes in assays using RT-PCR and quantitative real-time PCR. 2. Materials and methods 2.1. Tissues The lymph node tissues were obtained from patients with lymphoma and as controls we used tonsils. The experiments were approved by the Ethics Committee of the University of Zagreb Medical School. Informed consent was provided according to the Declaration of Helsinki. Part of the tissue was homogenized through a sieve immediately after dissection to obtain viable lymphocytes. The cells were further collected by centrifugation, washed with PBS and 1.2× 106 cell aliquots resuspended in either 500 μl GITC (guanidinium isothiocynate, Chomczynski and Sacchi, 1987) solution containing 4 M guanidinium isothiocyanate, 20 mM sodium acetate, 0.1 mM dithiothreitol and 0.5% Na-laurylsarcosine (pH 5.5) or in 500 μl TRIzol® (Invitrogene), RNAzol® (BioGenesis), and RLT buffer® (included in Qiagen RNeasy kit). Lysates were stored at −80 °C until needed. The other part of the same lymph node was fixed in 10% neutral buffered formalin from 12 h to maximum 48 h and embedded in paraffin blocks (FFPE). These blocks were subsequently cut in 4 μm sections and analyzed independently by two pathologists as a routine procedure. 2.2. RNA isolation The FFPE sections were deparaffinized by three rinses in either xylene or Histoclear (10 min at 57 °C by shaking). After each rinse samples were collected by centrifugation at 10,000 g for 2 min. The tissues were washed twice in 100% ethanol (10,000 g for 5 min) and dried at room temperature for 2–3 min. Tissues were collected in 500 μl of either TRIzol®, RNAzol®, RLT buffer® or in the GITC solution. Proteinase K (BD Biosciences) was added to a final concentration of 500 μg/ml, and incubation times were 1 h, 3 h or 16 h at 55 °C with shaking. After digestion, half of the samples were incubated at 95 °C for 30 min to reverse formalin-induced cross linking. All samples were heated to 99 °C for 5 min to inactivate proteinase K. The lysates were then left to cool down to room temperature.
43
From half of the samples lysed in GITC solution, RNA was extracted as reported previously (Chomczynski and Sacchi 1987). The same method was also used to extract RNA from fresh cells for comparison. FFPE samples incubated with TRIzol®, RNAzol® or RLT® buffers were subjected to RNA extraction following the corresponding manufacturers' instructions. One U/μl RNAse Inhibitor (Boehringer Mannheim, Germany) was added to each sample and RNA integrity checked by electrophoresis on 1.8% agarose gels stained with ethidium bromide. RNA purity, quality and quantity were assessed by means of a BioSpec-nano spectrophotometer (Shimadzu Corporation, Japan) and A260/A280 ratio used to monitor protein contamination. 2.3. Reverse transcription and polymerase chain reaction For RT-PCR analysis, we used two different approaches: RNA was either reverse transcribed using Superscript II reverse transcriptase (Invitrogen) and oligo d(T) primers and cDNA then used in PCR, or we performed RT-PCR in a single tube using OneTube Titan RT-PCR System (Boeringher Mannheim, Germany) with gene-specific primers, all according to manufacturers instructions. With Superscript II reverse transcriptase, the 20 μl reactions containing 0.5 μg of oligo d(T) primers, 0.4 mM of each dNTP and 1 μg of RNA were set following the instructions. The reaction conditions were as follows: 5 min at 65 °C, 52 min at 37 °C and 15 min at 70 °C, using Mastercycler Gradient (Eppendorf, Hamburg, Germany). Two microliters of cDNA was then used in a 25 μl PCR reaction, with 0.5 mM dNTPs, 1.5 mM MgCl2, 400 nM primers and 1U of TaqGold DNA polymerase (Roche). The primers used were Hev1 (forward primer, 5′ tccagaatgtcagcatggag 3′), and Hev2 (reverse primer, 5′ agcttttcccccacaaactt 3′), specific for the lymphoid Zn-finger transcription factor Helios, with an expected product size of 202 bp. The 80 bp fragments of a housekeeping gene hypoxanthin-phosphoribosyl transferase (HPRT) cDNA were amplified using the following primers: HPRT FP (forward primer, 5′ gtctggcttatatccaacacttcgt 3′) and HPRT RP (reverse primer, 5′ ggcagtataatccaaagatggtcaa 3′), the concentrations of components being the same as stated above for Helios PCR. Since both primer pairs are spanning large introns, false positive results due to the amplification of genomic DNA are avoided. The reaction conditions for both primer pairs using oligo d(T) primers for the RT step were as follows: primary denaturation 94 °C for 7 min; 94 °C for 30 s, 54 °C for 30 s and 72 °C for 1 min (35 cycles); and final extension at 72 °C for 10 min. 202 bp PCR products from Helios RNA were analyzed on 2% agarose gels and stained with ethidium bromide. On the other hand, the 80 bp HPRT product was analyzed on 12% polyacrylamide gel for a better resolution. 2.4. Quantitative real-time RT-PCR Quantitative real-time RT-PCR was performed on duplicate samples using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems, USA) with human Ikaros (Hs00172991_m1), Aiolos (Hs00 232635_m1) or Helios (Hs 212361 _m1) primers and Taqman probes. Primers and TaqMan probes were all designed using Primer Express software (Applied Biosystems). To compensate for inter-PCR
44
M. Antica et al. / Journal of Immunological Methods 359 (2010) 42–46
variation normalisation of the target gene (Ikaros, Aiolos, Helios) with an endogenous control (human 18S ribosomal RNAHs99999901_s1) was performed. For this analysis the comparative Ct method (ΔCt) was used in which Ct is the threshold cycle number. The PCR reaction was carried out according to the manufacturer's protocol. Reaction mixtures of 25 μl contained 12.5 μl TaqMan buffer AS with the ROX dye as the passive reference, 5 mM MgCl2, 200 μM dATP, dCTP, dGTP, 400 μM dUTP, 1.25 U AmpliTaq Gold DNA polymerase, 0.5 U AmpErase uracil N-glycosylase (UNG), 300 nM forward and reverse primers, 200 nM specific TaqMan probe, and 6 μl cDNA (diluted 1:2). All reagents were from Applied Biosystems. Normalisation of the amount of mRNA in each sample by an internal control, 18S rRNA, allowed controlling for differences in the amount of total RNA added to each cDNA reaction, as well as for variation in reverse transcriptase (RT) efficiency among the different cDNA reactions.
samples were of better quality compared to FFPE isolated RNA, ratio 1,99 ± 0,07 and 1,78 ± 0,17 respectively. Indeed, electrophoretic analysis revealed that the RNA was degraded to a certain extent and there were no clear 28S and 18S rRNA bands from FFPE samples (Fig. 1B). However the intensity of the smear relates to the size and thickness of paraffin sections (data not shown). We further examined the reliability of FFPE RNA for RT-PCR and quantitative RT-PCR. Electrophoretic analysis of RT-PCR products shows bands of 202 bp and 80 bp amplicons from Helios and housekeeping gene HPRT RNAs, respectively (Fig. 1C). The primers used for
2.5. Statistics The data were presented as mean ± s.d. from four independent measurements. The student unpaired t-test was used to determine significant difference between the samples. A p value less than 0.05 was considered significant. 3. Results In this study we compared and combined a number of parameters influencing the efficiency and suitability of RNA analysis from FFPE specimens like deparaffinization, digestion time, RNA extraction procedures and compatibility of various commercially available reagents and kits for RNA isolation and RT-PCR analysis. Side by side we used xylene and Histoclear 3 × 10 min at 57 °C followed by two rinses in 100% ethanol. Since the samples obtained were equally deparaffinized, we used Histoclear for all further experiments. Its lower toxicity when compared to xylene gives Histoclear an advantage since it requires no timeconsuming waste handling and storage procedures. Further, we assessed the optimal digestion time in Proteinase K and incubated the samples at 55 °C with shaking for 1 h, 3 h or 16 h. We obtained sufficient RNA even with the shortest incubation time of one hour which substantially abbreviate the preparation period. One of the most important steps in this procedure is the thermal reversion of formalin-induced cross linking and heating the digested samples at 95 °C for 30 min substantially improves the final result. Since there are several commercially available RNA isolation reagents on the market we compared three of them, TRIzol, RLT and RNAzol to the Chomczynski and Sacchi (Chomczynski and Sacchi, 1987) GITC extraction. When applied to the FFPE samples we found the GITC extraction to be at least as effective as the commercially available ones. To shorten the preparation time at this stage it is possible to continue with any commercially available RNA isolation columns. The RNA quality was checked by spectrophotometric analysis and electrophoresis (Fig. 1A and B). Spectrophotometric analyses are routinely used as quality indicators. The A260/A280 value measures the ratio of nucleic acid to protein, and good quality RNA samples have the A260/ A280 values in the range from 1.8 to 2.0. Freshly isolated
Fig. 1. A) Spectrophotometric measurements used as indicator of RNA purity following purification of FFPE or fresh tissue samples. B) RNA integrity checked by electrophoresis on 1.8% agarose gels stained with ethidium bromide. Lanes 1 and 2: FFPE RNA, lane 3: Molecular weight marker VIII (Boehringer, Mannheim), lanes 4 and 5: fresh tissue RNA. C) RT-PCR analysis of Helios and HPRT gene expressions in lymph node samples. 202 bp PCR products from Helios RNA were analyzed on 2% agarose and the 80 bp HPRT product was analyzed on 12% polyacrylamide gel. The gels were stained with ethidium bromide. Lane 1: RNA isolated from fresh tissue using Trizol; lane 2: RNA isolated from FFPE using Trizol; lane 3: RT-PCR isolated from FFPE using GITC.
M. Antica et al. / Journal of Immunological Methods 359 (2010) 42–46
amplification of the zinc finger protein Helios cDNA and hypoxanthine-phosphoribosyl transferase were designed to span introns, thus avoiding possible amplification of genomic DNA. At the same time they were designed to produce very short amplicons in order to evade the shortcoming of RNA degradation. We show here that we can amplify 202 bp long Helios RNA fragments from both, FFPE and fresh samples. We also tested the suitability of FFPE RNA for the quantitative real-time PCR. Since transcription factors from the Ikaros family — Ikaros, Aiolos and Helios, are important in lymphocyte development we analyzed their expression in the samples. We compared the results from FFPE and freshly isolated RNA. Interestingly, Ikaros transcription factors RNA was better preserved in FFPE samples and as shown in Fig. 2 quantitative RT-PCR reveals a higher yield of Aiolos, Ikaros and Helios RNA from FFPE samples. Table 1 summarizes the steps we recommend for a fast, efficient and inexpensive RNA isolation from formalin-fixed paraffin-embedded lymphnodes.
45
Table 1 A protocol we selected for a fast, efficient and inexpensive RNA isolation from formalin-fixed paraffin-embedded tissues. Details are described in Material and Methods.
4. Discussion Reverse transcription polymerase chain reaction (RT-PCR) is a commonly used method for gene expression analysis but formalin fixation and paraffin-embedding may interfere with the quality of RNA especially when isolated from lymph nodes being the most fragile lymphatic tissues. Most existing methods for RNA extraction from FFPE samples are either time-consuming and laborious or very expensive. We here present a very fast and simple method that can be routinely used for screening or for various gene expression analyses of lymphatic tissues. Table 1 summarizes the steps we recommend for FFPE analysis. Recent developments in human genomics raised many questions about the function of newly discovered genes; the ability to perform gene expression analysis and scanning large year-old archives of formalinfixed paraffin-embedded tissues become a great advantage for researchers (Abrahamsen et al., 2003; Korbler et al., 2003). Therefore, in this study we defined an optimal set of parameters which make RNA isolation from FFPE specimens very quick, simple and inexpensive. We confirm that deparaffinization with Histoclear is a method of choice
Fig. 2. Real-time RT-PCR analysis of Aiolos, Helios and Ikaros gene expressions in FFPE (□) versus cell suspensions from freshly isolated samples (■) using TRIzol. The results of specific mRNA expression are normalized with the endogenous control, human 18S ribosomal RNA, as a housekeeping gene and illustrated as ΔCt values. Mean ± SEM *p b 0.05, **p b 0.01, ***p b 0.001, FFPE versus fresh.
since it is harmless for the environment. By combining diverse approaches we managed to shorten the isolation time. Heating to reverse protein-RNA cross linking can considerably improve the total RNA yield. As an alternative we recommend a second very fast, efficient and inexpensive protocol using GITC solution instead and further purification on commercial columns. We show here that RNA isolated by these two protocols, although degraded to a certain extent, is of sufficient quality for standard RT-PCR reactions, as we successfully amplified 202 bp fragments of Helios cDNA and 80 bp HPRT fragments. A careful choice of primers plays a very important role, since the degradation of RNA determines the maximal size of the product. It was shown previously that the quantity of PCR product increases up to 100-fold when amplifying short (b136 bp) rather than long amplicons (Abrahamsen et al., 2003). This was true for the HPRT gene, which has been described to be lost in 50% of the FFPE samples when compared to its detection in fresh tissue (Beillard et al., 2003; Votavova et al., 2009). The extraction method combined with the HPRT primers we describe here was successful in most cases (about 94%; 47 of 50 samples). We selected this house keeping gene since it was described to be the most reliable for RT-PCR normalisation (Ohl et al., 2005). Also according to Foss et al. HPRT represents the control system of choice for the evaluation of RNA (Foss et al., 1994). Interestingly, in a quantitative RT-PCR assay FFPE RNA was superior to the RNA from freshly isolated cells at least in regard to Ikaros family transcription factors (Fig. 2). In our clinical practice we stick to the recommendations from several studies to keep fixation time within 12–48 h, depending on the size of the specimen, in order to limit the effects of formalin fixation (for review see(Farragher et al.,
46
M. Antica et al. / Journal of Immunological Methods 359 (2010) 42–46
2008). Since we show here a higher relative amount of mRNA for Ikaros transcription factors it is possible that formalin preserves RNA from degradation. An explanation could be the fact that fixation with formaldehyde efficiently and irreversibly inactivates endogenous RNases. The described method of RNA extraction gives a better way of getting high quality RNA from FFPE lymph nodes and more reliable results for at least transcription factors from the Ikaros family. Another explanation could be that FFPE only degrades the ribosomal RNA and leaves the others in good shape. Since the qRT-PCR is based on the ratio of the gene in question and 18S RNA as a house keeping gene this could be the reason for a higher Aiolos, Ikaros and Helios RNA quantity in the FFPE samples. However, the primer design, either for PCR or real-time PCR minimizes this possibility since they all amplify very short RNA fragments. We show here that we can amplify 202 bp long Helios RNA fragments from both, FFPE and fresh samples. Similarly for real-time PCR we used primers for the house keeping gene 18S RNA which give amplicons of only 187 bp. In addition to that a recent paper shows that also for colon and lung tumors there is a high correlation in gene expression analysis and real-time RT-PCR between frozen and matched FFPE samples by using the same house keeping gene as in the present work (Roberts et al., 2009). Nevertheless, this study shows that FFPE specimens can readily be used in studying molecular pathogenesis and gene expression of lymphoproliferative disorders and other human diseases. Acknowledgements This research was supported by the Croatian Ministry of Science, Education and Sport's grant No. 0098-0982913-2332 and the Croatian Academy of Sciences and Arts. We wish to thank R. Bluzic for contribution in initial experiments. References Abrahamsen, H.N., Steiniche, T., Nexo, E., Hamilton-Dutoit, S.J., Sorensen, B.S., 2003. Towards quantitative mRNA analysis in paraffin-embedded tissues using real-time reverse transcriptase-polymerase chain reaction: a methodological study on lymph nodes from melanoma patients. The Journal of Molecular Diagnostics 5, 34. Antica, M., Cicin-Sain, L., Kapitanovic, S., Matulic, M., Dzebro, S., Dominis, M., 2008. Aberrant Ikaros, Aiolos, and Helios expression in Hodgkin and nonHodgkin lymphoma. Blood 111, 3296. Beillard, E., Pallisgaard, N., van der Velden, V.H.J., Bi, W., Dee, R., van der Schoot, E., Delabesse, E., Macintyre, E., Gottardi, E., Saglio, G., Watzinger, F., Lion, T., van Dongen, J.J.M., Hokland, P., Gabert, J., 2003. Evaluation of
candidate control genes for diagnosis and residual disease detection in leukemic patients using /'real-time/' quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR) — a Europe against cancer program. Leukemia 17, 2474. Cairns, M.T., Church, S., Johnston, P.G., Phenix, K.V., Marley, J.J., 1997. Paraffinembedded tissue as a source of RNA for gene expression analysis in oral malignancy. Oral Diseases 3, 157. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry 162, 156. Coombs, N.J., Gough, A.C., Primrose, J.N., 1999. Optimisation of DNA and RNA extraction from archival formalin-fixed tissue. Nucl. Acids Res. 27, 12. Farragher, S., Tanney, A., Kennedy, R., Paul Harkin, D., 2008. RNA expression analysis from formalin fixed paraffin embedded tissues. Histochemistry and Cell Biology 130, 435. Foss, R.D., Guha-Thakurta, N., Conran, R.M., Gutman, P., 1994. Effects of fixative and fixation time on the extraction and polymerase chain reaction amplification of RNA from paraffin-embedded tissue: comparison of two housekeeping gene mRNA controls. Diagnostic Molecular Pathology 3, 148. Koopmans, M., Monroe, S.S., Coffield, L.M., Zaki, S.R., 1993. Optimization of extraction and PCR amplification of RNA extracts from paraffinembedded tissue in different fixatives. Journal of Virological Methods 43, 189. Korbler, T., Grskovic, M., Dominis, M., Antica, M., 2003. A simple method for RNA isolation from formalin-fixed and paraffin-embedded lymphatic tissues. Experimental & Molecular Pathology 74, 336. Masuda, N., Ohnishi, T., Kawamoto, S., Monden, M., Okubo, K., 1999. Analysis of chemical modification of RNA from formalin-fixed samples and optimization of molecular biology applications for such samples. Nucl. Acids Res. 27, 4436. Morgan, B., Sun, L., Avitahl, N., Andrikopoulos, K., Ikeda, T., Gonzales, E., Wu, P., Neben, S., Georgopoulos, K., 1997. Aiolos, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation. EMBO Journal 16, 2004. Ng, S.Y.-M., Yoshida, T., Georgopoulos, K., 2007. Ikaros and chromatin regulation in early hematopoiesis. Current Opinion in Immunology 19, 116. Ohl, F., Jung, M., Xu, C., Stephan, C., Rabien, A., Burkhardt, M., Nitsche, A., Kristiansen, G., Loening, S., Radonić, A., Jung, K., 2005. Gene expression studies in prostate cancer tissue: which reference gene should be selected for normalization? Journal of Molecular Medicine 83, 1014. Roberts, L., Bowers, J., Sensinger, K., Lisowski, A., Getts, R., Anderson, M.G., 2009. Identification of methods for use of formalin-fixed, paraffinembedded tissue samples in RNA expression profiling. Genomics 94, 341. Sun, L., Goodman, P.A., Wood, C.M., Crotty, M.-L., Sensel, M., Sather, H., Navara, C., Nachman, J., Steinherz, P.G., Gaynon, P.S., Seibel, N., Vassilev, A., Juran, B.D., Reaman, G.H., Uckun, F.M., 1999. Expression of aberrantly spliced oncogenic ikaros isoforms in childhood acute lymphoblastic leukemia. Journal of Clinical Oncology 17, 3753. Votavova, H., Forsterova, K., Stritesky, J., Velenska, Z., Trneny, M., 2009. Optimized protocol for gene expression analysis in formalin-fixed, paraffin-embedded tissue using real-time quantitative polymerase chain reaction. Diagnostic Molecular Pathology 18, 176. Warren, L.A., Rothenberg, E.V., 2003. Regulatory coding of lymphoid lineage choice by hematopoietic transcription factors. Current Opinion in Immunology 15, 166. Winandy, S., Wu, P., Georgopoulos, K., 1995. A dominant mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma. Cell 83, 289.
Contents lists available at ScienceDirect
Journal of Immunological Methods j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j i m
Research paper
Gene expression in formalin-fixed paraffin-embedded lymph nodes Mariastefania Antica a,⁎, Mladen Paradzik a, Sanja Novak a, Sonja Dzebro b, Marija Dominis b a b
Laboratory for Electron Microscopy, Bijenicka 54, Rudjer Boskovic Institute, HR-10000 Zagreb, Croatia Department of Pathology, Merkur Clinical Hospital, Zagreb, Croatia
a r t i c l e
i n f o
Article history: Received 17 March 2010 Received in revised form 19 May 2010 Accepted 27 May 2010 Available online 4 June 2010 Keywords: Lymph nodes Lymphocytes Gene expression RNA Lymphoma
a b s t r a c t Elucidation of molecular pathways involved in development of human lymphoma requires efficient methods for tackling gene expression in lymph nodes. Expression studies of transcription factors in these malignancies facilitate understanding the changes occurring in neoplastic transformation and lymphoma development. Excised lymph nodes are routinely fixed in formalin and embedded in paraffin for diagnosis and stored in many hospitals' pathology archives. These tissues represent a precious resource for research since they allow retrospective studies to cover a broad range of human lymphoma even the less frequent types. Reverse transcription polymerase chain reaction (RT-PCR) is a commonly used method for gene expression analysis and a reproducible protocol for RNA isolation from lymph nodes is an inevitable requirement for these studies. However, formalin fixation and paraffin-embedding interfere with the quality of RNA especially when isolated from lymph nodes being the most fragile lymphatic tissues. We present here a simple and fast method for RNA isolation from formalin-fixed paraffin-embedded lymph nodes that can be successfully applied for RT-PCR as well as for quantitative RT-PCR analysis. We tested diverse isolation reagents and combined a range of factors in order to get a high quality RNA for retrospective studies of gene expression in human lymphoma samples. Our modified method of RNA extraction from FFPE provides superior yields and purity based on qPCR data. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Molecular pathways involved in development of human lymphoma require efficient methods for tackling gene expression in lymph nodes. Expression studies of transcription factors in these malignancies facilitate understanding the changes occurring in neoplastic transformation and lymphoma development (Winandy et al., 1995; Morgan et al., 1997; Sun et al., 1999; Warren and Rothenberg, 2003; Ng et al., 2007; Antica et al., 2008). Molecular methods applied for studying lymphoproliferative disorders are often limited by the lack of fresh material since routine diagnostics in clinical practice is based on classical histological analysis of formalinfixed paraffin-embedded (FFPE) tissues (Cairns et al., 1997; Abbreviations: FFPE, Formalin-fixed paraffin-embedded. ⁎ Corresponding author. Tel.: + 385 1 456 1065; fax: + 385 1 456 1177. E-mail address: [email protected] (M. Antica). 0022-1759/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.jim.2010.05.010
Coombs et al., 1999; Korbler et al., 2003). Lymph nodes, routinely fixed in formalin, embedded in paraffin for diagnosis are stored in many hospitals' pathology archives and represent a precious resource for research. They cover a broad range of human lymphoma and allow retrospective studies in order to collect even the less frequent types. Recent development of different molecular techniques have proven FFPE tissues to be a valuable resource of research material because of the possibility to scan large archives of diverse pathological specimens stored in many hospitals (Koopmans et al., 1993; Masuda et al., 1999). Archive material allows making use of long-term follow up studies and their correlation with diagnosis, prognosis and treatment. RNA isolation from FFPE tissues, combined with techniques like polymerase chain reaction (PCR) analysis makes a powerful tool for genomic research and gene expression studies even in years-old specimens. Reverse transcription polymerase chain reaction (RT-PCR) is a commonly used method for gene
M. Antica et al. / Journal of Immunological Methods 359 (2010) 42–46
expression analysis but formalin fixation and paraffin-embedding may interfere with the quality of RNA especially when isolated from lymph nodes being the most fragile lymphatic tissues. Procedures for long-term storage of tissues like dehydration and fixation seriously challenge the quality of recovered nucleic acids and the efficiency of isolation. Formalin fixation produces cross-links nucleic acids and proteins and covalently modifies RNA by adding monomethyol groups interfering with RNA isolation and subsequent reactions like RT-PCR. In addition to that there is controversy in literature on the quality of RNA isolated from FFPE. This variability could depend on the tissues analyzed. Especially lymph nodes are very fragile since even by immediate cell isolation there are many dead cells in suspensions. Therefore, in this study we compared different RNA extraction methods and present our own procedure which makes RNA isolation from FFPE lymph nodes quick and easy. We further compared RNA extracted from FFPE by our optimized method and from fresh lymph nodes in assays using RT-PCR and quantitative real-time PCR. 2. Materials and methods 2.1. Tissues The lymph node tissues were obtained from patients with lymphoma and as controls we used tonsils. The experiments were approved by the Ethics Committee of the University of Zagreb Medical School. Informed consent was provided according to the Declaration of Helsinki. Part of the tissue was homogenized through a sieve immediately after dissection to obtain viable lymphocytes. The cells were further collected by centrifugation, washed with PBS and 1.2× 106 cell aliquots resuspended in either 500 μl GITC (guanidinium isothiocynate, Chomczynski and Sacchi, 1987) solution containing 4 M guanidinium isothiocyanate, 20 mM sodium acetate, 0.1 mM dithiothreitol and 0.5% Na-laurylsarcosine (pH 5.5) or in 500 μl TRIzol® (Invitrogene), RNAzol® (BioGenesis), and RLT buffer® (included in Qiagen RNeasy kit). Lysates were stored at −80 °C until needed. The other part of the same lymph node was fixed in 10% neutral buffered formalin from 12 h to maximum 48 h and embedded in paraffin blocks (FFPE). These blocks were subsequently cut in 4 μm sections and analyzed independently by two pathologists as a routine procedure. 2.2. RNA isolation The FFPE sections were deparaffinized by three rinses in either xylene or Histoclear (10 min at 57 °C by shaking). After each rinse samples were collected by centrifugation at 10,000 g for 2 min. The tissues were washed twice in 100% ethanol (10,000 g for 5 min) and dried at room temperature for 2–3 min. Tissues were collected in 500 μl of either TRIzol®, RNAzol®, RLT buffer® or in the GITC solution. Proteinase K (BD Biosciences) was added to a final concentration of 500 μg/ml, and incubation times were 1 h, 3 h or 16 h at 55 °C with shaking. After digestion, half of the samples were incubated at 95 °C for 30 min to reverse formalin-induced cross linking. All samples were heated to 99 °C for 5 min to inactivate proteinase K. The lysates were then left to cool down to room temperature.
43
From half of the samples lysed in GITC solution, RNA was extracted as reported previously (Chomczynski and Sacchi 1987). The same method was also used to extract RNA from fresh cells for comparison. FFPE samples incubated with TRIzol®, RNAzol® or RLT® buffers were subjected to RNA extraction following the corresponding manufacturers' instructions. One U/μl RNAse Inhibitor (Boehringer Mannheim, Germany) was added to each sample and RNA integrity checked by electrophoresis on 1.8% agarose gels stained with ethidium bromide. RNA purity, quality and quantity were assessed by means of a BioSpec-nano spectrophotometer (Shimadzu Corporation, Japan) and A260/A280 ratio used to monitor protein contamination. 2.3. Reverse transcription and polymerase chain reaction For RT-PCR analysis, we used two different approaches: RNA was either reverse transcribed using Superscript II reverse transcriptase (Invitrogen) and oligo d(T) primers and cDNA then used in PCR, or we performed RT-PCR in a single tube using OneTube Titan RT-PCR System (Boeringher Mannheim, Germany) with gene-specific primers, all according to manufacturers instructions. With Superscript II reverse transcriptase, the 20 μl reactions containing 0.5 μg of oligo d(T) primers, 0.4 mM of each dNTP and 1 μg of RNA were set following the instructions. The reaction conditions were as follows: 5 min at 65 °C, 52 min at 37 °C and 15 min at 70 °C, using Mastercycler Gradient (Eppendorf, Hamburg, Germany). Two microliters of cDNA was then used in a 25 μl PCR reaction, with 0.5 mM dNTPs, 1.5 mM MgCl2, 400 nM primers and 1U of TaqGold DNA polymerase (Roche). The primers used were Hev1 (forward primer, 5′ tccagaatgtcagcatggag 3′), and Hev2 (reverse primer, 5′ agcttttcccccacaaactt 3′), specific for the lymphoid Zn-finger transcription factor Helios, with an expected product size of 202 bp. The 80 bp fragments of a housekeeping gene hypoxanthin-phosphoribosyl transferase (HPRT) cDNA were amplified using the following primers: HPRT FP (forward primer, 5′ gtctggcttatatccaacacttcgt 3′) and HPRT RP (reverse primer, 5′ ggcagtataatccaaagatggtcaa 3′), the concentrations of components being the same as stated above for Helios PCR. Since both primer pairs are spanning large introns, false positive results due to the amplification of genomic DNA are avoided. The reaction conditions for both primer pairs using oligo d(T) primers for the RT step were as follows: primary denaturation 94 °C for 7 min; 94 °C for 30 s, 54 °C for 30 s and 72 °C for 1 min (35 cycles); and final extension at 72 °C for 10 min. 202 bp PCR products from Helios RNA were analyzed on 2% agarose gels and stained with ethidium bromide. On the other hand, the 80 bp HPRT product was analyzed on 12% polyacrylamide gel for a better resolution. 2.4. Quantitative real-time RT-PCR Quantitative real-time RT-PCR was performed on duplicate samples using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems, USA) with human Ikaros (Hs00172991_m1), Aiolos (Hs00 232635_m1) or Helios (Hs 212361 _m1) primers and Taqman probes. Primers and TaqMan probes were all designed using Primer Express software (Applied Biosystems). To compensate for inter-PCR
44
M. Antica et al. / Journal of Immunological Methods 359 (2010) 42–46
variation normalisation of the target gene (Ikaros, Aiolos, Helios) with an endogenous control (human 18S ribosomal RNAHs99999901_s1) was performed. For this analysis the comparative Ct method (ΔCt) was used in which Ct is the threshold cycle number. The PCR reaction was carried out according to the manufacturer's protocol. Reaction mixtures of 25 μl contained 12.5 μl TaqMan buffer AS with the ROX dye as the passive reference, 5 mM MgCl2, 200 μM dATP, dCTP, dGTP, 400 μM dUTP, 1.25 U AmpliTaq Gold DNA polymerase, 0.5 U AmpErase uracil N-glycosylase (UNG), 300 nM forward and reverse primers, 200 nM specific TaqMan probe, and 6 μl cDNA (diluted 1:2). All reagents were from Applied Biosystems. Normalisation of the amount of mRNA in each sample by an internal control, 18S rRNA, allowed controlling for differences in the amount of total RNA added to each cDNA reaction, as well as for variation in reverse transcriptase (RT) efficiency among the different cDNA reactions.
samples were of better quality compared to FFPE isolated RNA, ratio 1,99 ± 0,07 and 1,78 ± 0,17 respectively. Indeed, electrophoretic analysis revealed that the RNA was degraded to a certain extent and there were no clear 28S and 18S rRNA bands from FFPE samples (Fig. 1B). However the intensity of the smear relates to the size and thickness of paraffin sections (data not shown). We further examined the reliability of FFPE RNA for RT-PCR and quantitative RT-PCR. Electrophoretic analysis of RT-PCR products shows bands of 202 bp and 80 bp amplicons from Helios and housekeeping gene HPRT RNAs, respectively (Fig. 1C). The primers used for
2.5. Statistics The data were presented as mean ± s.d. from four independent measurements. The student unpaired t-test was used to determine significant difference between the samples. A p value less than 0.05 was considered significant. 3. Results In this study we compared and combined a number of parameters influencing the efficiency and suitability of RNA analysis from FFPE specimens like deparaffinization, digestion time, RNA extraction procedures and compatibility of various commercially available reagents and kits for RNA isolation and RT-PCR analysis. Side by side we used xylene and Histoclear 3 × 10 min at 57 °C followed by two rinses in 100% ethanol. Since the samples obtained were equally deparaffinized, we used Histoclear for all further experiments. Its lower toxicity when compared to xylene gives Histoclear an advantage since it requires no timeconsuming waste handling and storage procedures. Further, we assessed the optimal digestion time in Proteinase K and incubated the samples at 55 °C with shaking for 1 h, 3 h or 16 h. We obtained sufficient RNA even with the shortest incubation time of one hour which substantially abbreviate the preparation period. One of the most important steps in this procedure is the thermal reversion of formalin-induced cross linking and heating the digested samples at 95 °C for 30 min substantially improves the final result. Since there are several commercially available RNA isolation reagents on the market we compared three of them, TRIzol, RLT and RNAzol to the Chomczynski and Sacchi (Chomczynski and Sacchi, 1987) GITC extraction. When applied to the FFPE samples we found the GITC extraction to be at least as effective as the commercially available ones. To shorten the preparation time at this stage it is possible to continue with any commercially available RNA isolation columns. The RNA quality was checked by spectrophotometric analysis and electrophoresis (Fig. 1A and B). Spectrophotometric analyses are routinely used as quality indicators. The A260/A280 value measures the ratio of nucleic acid to protein, and good quality RNA samples have the A260/ A280 values in the range from 1.8 to 2.0. Freshly isolated
Fig. 1. A) Spectrophotometric measurements used as indicator of RNA purity following purification of FFPE or fresh tissue samples. B) RNA integrity checked by electrophoresis on 1.8% agarose gels stained with ethidium bromide. Lanes 1 and 2: FFPE RNA, lane 3: Molecular weight marker VIII (Boehringer, Mannheim), lanes 4 and 5: fresh tissue RNA. C) RT-PCR analysis of Helios and HPRT gene expressions in lymph node samples. 202 bp PCR products from Helios RNA were analyzed on 2% agarose and the 80 bp HPRT product was analyzed on 12% polyacrylamide gel. The gels were stained with ethidium bromide. Lane 1: RNA isolated from fresh tissue using Trizol; lane 2: RNA isolated from FFPE using Trizol; lane 3: RT-PCR isolated from FFPE using GITC.
M. Antica et al. / Journal of Immunological Methods 359 (2010) 42–46
amplification of the zinc finger protein Helios cDNA and hypoxanthine-phosphoribosyl transferase were designed to span introns, thus avoiding possible amplification of genomic DNA. At the same time they were designed to produce very short amplicons in order to evade the shortcoming of RNA degradation. We show here that we can amplify 202 bp long Helios RNA fragments from both, FFPE and fresh samples. We also tested the suitability of FFPE RNA for the quantitative real-time PCR. Since transcription factors from the Ikaros family — Ikaros, Aiolos and Helios, are important in lymphocyte development we analyzed their expression in the samples. We compared the results from FFPE and freshly isolated RNA. Interestingly, Ikaros transcription factors RNA was better preserved in FFPE samples and as shown in Fig. 2 quantitative RT-PCR reveals a higher yield of Aiolos, Ikaros and Helios RNA from FFPE samples. Table 1 summarizes the steps we recommend for a fast, efficient and inexpensive RNA isolation from formalin-fixed paraffin-embedded lymphnodes.
45
Table 1 A protocol we selected for a fast, efficient and inexpensive RNA isolation from formalin-fixed paraffin-embedded tissues. Details are described in Material and Methods.
4. Discussion Reverse transcription polymerase chain reaction (RT-PCR) is a commonly used method for gene expression analysis but formalin fixation and paraffin-embedding may interfere with the quality of RNA especially when isolated from lymph nodes being the most fragile lymphatic tissues. Most existing methods for RNA extraction from FFPE samples are either time-consuming and laborious or very expensive. We here present a very fast and simple method that can be routinely used for screening or for various gene expression analyses of lymphatic tissues. Table 1 summarizes the steps we recommend for FFPE analysis. Recent developments in human genomics raised many questions about the function of newly discovered genes; the ability to perform gene expression analysis and scanning large year-old archives of formalinfixed paraffin-embedded tissues become a great advantage for researchers (Abrahamsen et al., 2003; Korbler et al., 2003). Therefore, in this study we defined an optimal set of parameters which make RNA isolation from FFPE specimens very quick, simple and inexpensive. We confirm that deparaffinization with Histoclear is a method of choice
Fig. 2. Real-time RT-PCR analysis of Aiolos, Helios and Ikaros gene expressions in FFPE (□) versus cell suspensions from freshly isolated samples (■) using TRIzol. The results of specific mRNA expression are normalized with the endogenous control, human 18S ribosomal RNA, as a housekeeping gene and illustrated as ΔCt values. Mean ± SEM *p b 0.05, **p b 0.01, ***p b 0.001, FFPE versus fresh.
since it is harmless for the environment. By combining diverse approaches we managed to shorten the isolation time. Heating to reverse protein-RNA cross linking can considerably improve the total RNA yield. As an alternative we recommend a second very fast, efficient and inexpensive protocol using GITC solution instead and further purification on commercial columns. We show here that RNA isolated by these two protocols, although degraded to a certain extent, is of sufficient quality for standard RT-PCR reactions, as we successfully amplified 202 bp fragments of Helios cDNA and 80 bp HPRT fragments. A careful choice of primers plays a very important role, since the degradation of RNA determines the maximal size of the product. It was shown previously that the quantity of PCR product increases up to 100-fold when amplifying short (b136 bp) rather than long amplicons (Abrahamsen et al., 2003). This was true for the HPRT gene, which has been described to be lost in 50% of the FFPE samples when compared to its detection in fresh tissue (Beillard et al., 2003; Votavova et al., 2009). The extraction method combined with the HPRT primers we describe here was successful in most cases (about 94%; 47 of 50 samples). We selected this house keeping gene since it was described to be the most reliable for RT-PCR normalisation (Ohl et al., 2005). Also according to Foss et al. HPRT represents the control system of choice for the evaluation of RNA (Foss et al., 1994). Interestingly, in a quantitative RT-PCR assay FFPE RNA was superior to the RNA from freshly isolated cells at least in regard to Ikaros family transcription factors (Fig. 2). In our clinical practice we stick to the recommendations from several studies to keep fixation time within 12–48 h, depending on the size of the specimen, in order to limit the effects of formalin fixation (for review see(Farragher et al.,
46
M. Antica et al. / Journal of Immunological Methods 359 (2010) 42–46
2008). Since we show here a higher relative amount of mRNA for Ikaros transcription factors it is possible that formalin preserves RNA from degradation. An explanation could be the fact that fixation with formaldehyde efficiently and irreversibly inactivates endogenous RNases. The described method of RNA extraction gives a better way of getting high quality RNA from FFPE lymph nodes and more reliable results for at least transcription factors from the Ikaros family. Another explanation could be that FFPE only degrades the ribosomal RNA and leaves the others in good shape. Since the qRT-PCR is based on the ratio of the gene in question and 18S RNA as a house keeping gene this could be the reason for a higher Aiolos, Ikaros and Helios RNA quantity in the FFPE samples. However, the primer design, either for PCR or real-time PCR minimizes this possibility since they all amplify very short RNA fragments. We show here that we can amplify 202 bp long Helios RNA fragments from both, FFPE and fresh samples. Similarly for real-time PCR we used primers for the house keeping gene 18S RNA which give amplicons of only 187 bp. In addition to that a recent paper shows that also for colon and lung tumors there is a high correlation in gene expression analysis and real-time RT-PCR between frozen and matched FFPE samples by using the same house keeping gene as in the present work (Roberts et al., 2009). Nevertheless, this study shows that FFPE specimens can readily be used in studying molecular pathogenesis and gene expression of lymphoproliferative disorders and other human diseases. Acknowledgements This research was supported by the Croatian Ministry of Science, Education and Sport's grant No. 0098-0982913-2332 and the Croatian Academy of Sciences and Arts. We wish to thank R. Bluzic for contribution in initial experiments. References Abrahamsen, H.N., Steiniche, T., Nexo, E., Hamilton-Dutoit, S.J., Sorensen, B.S., 2003. Towards quantitative mRNA analysis in paraffin-embedded tissues using real-time reverse transcriptase-polymerase chain reaction: a methodological study on lymph nodes from melanoma patients. The Journal of Molecular Diagnostics 5, 34. Antica, M., Cicin-Sain, L., Kapitanovic, S., Matulic, M., Dzebro, S., Dominis, M., 2008. Aberrant Ikaros, Aiolos, and Helios expression in Hodgkin and nonHodgkin lymphoma. Blood 111, 3296. Beillard, E., Pallisgaard, N., van der Velden, V.H.J., Bi, W., Dee, R., van der Schoot, E., Delabesse, E., Macintyre, E., Gottardi, E., Saglio, G., Watzinger, F., Lion, T., van Dongen, J.J.M., Hokland, P., Gabert, J., 2003. Evaluation of
candidate control genes for diagnosis and residual disease detection in leukemic patients using /'real-time/' quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR) — a Europe against cancer program. Leukemia 17, 2474. Cairns, M.T., Church, S., Johnston, P.G., Phenix, K.V., Marley, J.J., 1997. Paraffinembedded tissue as a source of RNA for gene expression analysis in oral malignancy. Oral Diseases 3, 157. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry 162, 156. Coombs, N.J., Gough, A.C., Primrose, J.N., 1999. Optimisation of DNA and RNA extraction from archival formalin-fixed tissue. Nucl. Acids Res. 27, 12. Farragher, S., Tanney, A., Kennedy, R., Paul Harkin, D., 2008. RNA expression analysis from formalin fixed paraffin embedded tissues. Histochemistry and Cell Biology 130, 435. Foss, R.D., Guha-Thakurta, N., Conran, R.M., Gutman, P., 1994. Effects of fixative and fixation time on the extraction and polymerase chain reaction amplification of RNA from paraffin-embedded tissue: comparison of two housekeeping gene mRNA controls. Diagnostic Molecular Pathology 3, 148. Koopmans, M., Monroe, S.S., Coffield, L.M., Zaki, S.R., 1993. Optimization of extraction and PCR amplification of RNA extracts from paraffinembedded tissue in different fixatives. Journal of Virological Methods 43, 189. Korbler, T., Grskovic, M., Dominis, M., Antica, M., 2003. A simple method for RNA isolation from formalin-fixed and paraffin-embedded lymphatic tissues. Experimental & Molecular Pathology 74, 336. Masuda, N., Ohnishi, T., Kawamoto, S., Monden, M., Okubo, K., 1999. Analysis of chemical modification of RNA from formalin-fixed samples and optimization of molecular biology applications for such samples. Nucl. Acids Res. 27, 4436. Morgan, B., Sun, L., Avitahl, N., Andrikopoulos, K., Ikeda, T., Gonzales, E., Wu, P., Neben, S., Georgopoulos, K., 1997. Aiolos, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation. EMBO Journal 16, 2004. Ng, S.Y.-M., Yoshida, T., Georgopoulos, K., 2007. Ikaros and chromatin regulation in early hematopoiesis. Current Opinion in Immunology 19, 116. Ohl, F., Jung, M., Xu, C., Stephan, C., Rabien, A., Burkhardt, M., Nitsche, A., Kristiansen, G., Loening, S., Radonić, A., Jung, K., 2005. Gene expression studies in prostate cancer tissue: which reference gene should be selected for normalization? Journal of Molecular Medicine 83, 1014. Roberts, L., Bowers, J., Sensinger, K., Lisowski, A., Getts, R., Anderson, M.G., 2009. Identification of methods for use of formalin-fixed, paraffinembedded tissue samples in RNA expression profiling. Genomics 94, 341. Sun, L., Goodman, P.A., Wood, C.M., Crotty, M.-L., Sensel, M., Sather, H., Navara, C., Nachman, J., Steinherz, P.G., Gaynon, P.S., Seibel, N., Vassilev, A., Juran, B.D., Reaman, G.H., Uckun, F.M., 1999. Expression of aberrantly spliced oncogenic ikaros isoforms in childhood acute lymphoblastic leukemia. Journal of Clinical Oncology 17, 3753. Votavova, H., Forsterova, K., Stritesky, J., Velenska, Z., Trneny, M., 2009. Optimized protocol for gene expression analysis in formalin-fixed, paraffin-embedded tissue using real-time quantitative polymerase chain reaction. Diagnostic Molecular Pathology 18, 176. Warren, L.A., Rothenberg, E.V., 2003. Regulatory coding of lymphoid lineage choice by hematopoietic transcription factors. Current Opinion in Immunology 15, 166. Winandy, S., Wu, P., Georgopoulos, K., 1995. A dominant mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma. Cell 83, 289.