Gene expression of catecholamine synthesizing enzymes and β adrenoceptor subtypes during rat embryogenesis

Neuroscience Letters 231 (1997) 108–112

Gene expression of catecholamine synthesizing enzymes and b adrenoceptor subtypes during rat embryogenesis Masahiko Fujinaga a , b ,*, James C. Scott c a

Department of Anesthesia, Stanford University School of Medicine, Stanford, CA 94305, USA b Anesthesiology Service, VA Palo Alto Health Care System, Palo Alto, CA 94304, USA c Department of Anesthesiology, University of New Mexico School of Medicine, Albuquerque, NM 87131, USA Received 21 April 1997; received in revised form 30 June 1997; accepted 3 July 1997

Abstract Timed-pregnant Sprague–Dawley rats were killed between gestational day (GD) 8 and 10, and embryos were explanted and separated into developmental stages according to a modified Theiler’s system. Total RNA from each stage was isolated and subjected to reverse transcription-polymerase chain reaction (RT-PCR) assays to examine gene expression of catecholamine synthesizing enzymes and three subtypes of b adrenoceptors. Expression of these genes was detected at much earlier stages than previously reported, and each enzyme and receptor subtype showed a different pattern of gene expression. For example, mRNA for tyrosine hydroxylase, the rate-limiting enzyme for catecholamine synthesis, was detected as early as stage 10a, late GD 8, before the neural crest cells appear (stage 12, mid GD 10). This contradicts the common belief that catecholamines are produced only in the cells of sympathoadrenal lineage which originate from the neural crest cells and the cells of central nervous system. Results from the present study indicate that catecholamine synthesis is not limited to the cells of sympathoadrenal lineage.  1997 Elsevier Science Ireland Ltd. Keywords: Catecholamines; Catecholamine synthesizing enzyme; b Adrenoceptor; Embryogenesis; Rat

Endogenous catecholamines, dopamine, norepinephrine and epinephrine, are hormones of the sympathoadrenal system and neurotransmitters in the central nervous system in adult mammals. It is widely believed that catecholamines are synthesized in a series of enzymatic steps from the amino acid l-tyrosine in cells of sympathoadrenal lineage which originate from the neural crest cells and the cells of central nervous system. Catecholamines have been assumed to be produced in the embryo or fetus after the development of the sympathoadrenal and central nervous systems. For example, tyrosine hydroxylase (TH) and its mRNA were first detected on gestational day (GD) 12 in rats in scattered cells of the gut, probably enteric ganglionic cells, by immunohistochemistry [3] and by in situ hybridization [10]. Phenylethanolamine-N-methyltransferase (PNMT) in rats was

* Corresponding author. 3801 Miranda Avenue, 112A, Palo Alto, CA 94304, USA. Tel.: +1 415 4935000, ext. 68822; fax: +1 415 8490405; e-mail: [email protected]

reported to first appear in sympathetic ganglia on GD 14 [1] and in the adrenal medulla on GD 16 [21,23]. Several groups of investigators have recently found evidence that is inconsistent with these common beliefs. First, mRNAs for some catecholamine synthesizing enzymes were detected earlier in development than previously reported using more sensitive techniques. Thomas et al. reported that TH and dopamine b-hydroxylase (DBH) mRNAs were detected in mice on GD 8 and 9, respectively, using reverse transcription-polymerase chain reaction (RTPCR) assays [22]. (These developmental stages are equivalent to GD 10 and 11 in rats. The investigators did not examine younger embryos.) In addition, Ebert et al. reported that PNMT mRNA was detected as early as on GD 9 (stage 12 by Theiler’s staging system) in rats using an RNase protection assay [4]. These studies suggest that catecholamines are synthesized in the embryo before the establishment of the sympathoadrenal and central nervous systems, although the question remains whether synthesis occurs in the neural crest cells or non-neural crest cells, since early

0304-3940/97/$17.00  1997 Elsevier Science Ireland Ltd. All rights reserved PII S0304-3940 (97 )0 0511-9

M. Fujinaga, J.C. Scott / Neuroscience Letters 231 (1997) 108–112 Table 1 Summary of developmental events during the early rat embryogenesis examined in the present study based on a modified Theiler’s staging system GD Stage 8

9 10a

9

10b 11a 11b 11c 12/s1–2 12/s3–4

10

12/s5–6

12/s7–8 13/s9–10 13/s11–12

General events

Heart related events

Primitive streak appears Amniotic folds become visible Notochordal process appears Neural groove becomes visible Neural plate becomes visible Foregut pocket Cardiac primordial becomes visible cells appear First pair of somites becomes visible Cardiac cells begins to show contraction Bilateral cardiac tubes meet in the midline Heart begins to beat as an organ Neural tube begins Cardiac looping to close becomes apparent Allantois makes connection Yolk sac circulation with chorion becomes visible Axial rotation begins Heart rate reaches almost 100 beats/min

differentiation of neural crest cells occurs during these stages. Second, Huang et al. have recently identified in rat and human hearts clusters of adrenergic cells that secrete catecholamines but do not have characteristic morphological features of neuronal or chromaffin cells of sympathoadrenal cell lineage; the investigators named these cells ‘intrinsic cardiac adrenergic cells’ [7]. Thus, these studies suggest that catecholamines may be produced in cells of other origins than the sympathoadrenal lineage. In this study we examined the ontogeny of gene expression of catecholamine synthesizing enzymes during rat embryogenesis using RT-PCR assays to determine whether catecholamine synthesis occurs before the neural crest cells appear. In addition, gene expression of b adrenoceptor subtypes, one of the target membrane receptors of catecholamines, was also examined. Timed-pregnant Sprague–Dawley rats were obtained by breeding the rats for 2 h between 0800 and 1000 h (Bantin and Kingman, Inc., Fremont, CA, USA); artificial lighting between 0600 and 1800 h. GD 0 was established by examining the rats immediately after mating and determining that a copulatory plug was present. Every 3 h between GD 8 and GD 10, rats were anesthetized with isoflurane-nitrous oxideoxygen and embryos were removed from the uterus. Embryos were staged by a modified Theiler’s staging system [5] for those without visible somites, and by the number of somite pairs for those with visible somites as shown in Table 1. Embryos were then pipetted into microtubes (1.5

109

ml volume) on dry ice using with a minimum amount of Hank’s balanced salt solution, typically 10–20 ml for each transfer, and stored at −70°C for subsequent isolation of total RNAs. Total RNAs were isolated from embryos using the methods based on the original description by Chomczynski and Sacchi [2] and pooled for each stage. For each stage the total RNA concentration of the pooled specimens was assessed by measuring the absorption at 260–280 nm with a spectrophotometer; the quality of total RNA for each stage was examined by fractionating of 5 mg of total RNA stained with ethidium bromide in formaldehyde/1% agarose gel by electrophoresis to confirm clear bands for 28s and 18s ribosomal RNAs. The remaining total RNAs were diluted to a 0.5 mg/ml concentration, aliquots of 1 mg/2 ml each were prepared (approximately 25– 30 sets) and stored at −70°C for subsequent RT-PCR assays. RT-PCR assays were performed using a Gene Amp RTPCR Reagent kit and DNA Thermal Cycler Model 480 (Perkin Elmer Cetus, Norwalk, CT, USA). Primers sequences were designed using MacVector sequence analysis software (Eastman Kodak, Rochester, NY, USA) and are shown in Table 2. The adequacy of the protocol for each assay was confirmed using total RNAs isolated from adult adrenal medulla and heart, and the specificity was confirmed by restriction analyses. In brief, total RNA (1 mg each) from embryos at different stages was reverse transcribed in 20 ml of solution consisting of 0.75 mM backward primer, 5 mM MgCl2, 1 × PCR buffer (from kit), 1 mM of dNTP, 1 U of RNase inhibitor, and 2.5 U of reverse transcriptase. The reaction conditions were 42°C for 15 min, 99°C for 5 min and 5°C for 5 min. The products were then subjected to PCR using backward and forward primers in 100 ml of a solution consisting of 2 mM MgCl2, 1 × PCR buffer, and 2.5 U Table 2 Sequences of primers for RT-PCR assays and expected sizes of products (nucleotides (nt); positions; Gene Bank Accession number) TH (546 nt; 502–1047; M10244) Forward TCCCCTGGTTCCCAAGAAAAG Backward CAAATGTGCGGTCAGCCAAC AAD (436 nt; 871–1306; M27716) Forward GGTGTATGGCTGCACATTGATG Backward AGACCAACCCGAGGATGACTTC DBH (449 nt; 841–1289; L12407) Forward TTCCCCATGTTCAACGGACC Backward GCGAGCACAGTAATCACCTTCC PNMT (439 nt; 130–568; X14211) Forward CAGGTCCTCATTGACATCGGCT Backward ATGTAGGTGCGAAGGTCTCGGA b1 adrenoceptor subtype (441 nt; 281–721; J05561) Forward CATCGTAGTGGGCAACGTGTTG Backward AAATCGCAGCACTTGGGGTC b2 adrenoceptor subtype (538 nt; 2334–2871; L39264) Forward ACTTCTTGCTGGCACCCAATG Backward TCCTTGGCATAACAGTCGATGG b3 adrenoceptor subtype (583 nt; 237–819; M74716) Forward CAAAAACGGCTCTCTGGCTTTC Backward GGGCATATTGGAGGCAAAGG

110

M. Fujinaga, J.C. Scott / Neuroscience Letters 231 (1997) 108–112

AmpliTaq polymerase. The PCR condition were 1 cycle of 95°C for 2 min, 35 cycles of 95°C for 1 min and 60°C for 1 min with a 1 s extension after each cycle, terminated by 1 cycle of 72°C for 7 min. PCR products (7.5 ml each) were then fractionated with 6× gel loading buffer containing ethidium bromide and bromphenol blue dye (1.5 ml each) by 2% agarose gel electrophoresis and Polaroid pictures were taken on a UV transilluminator. RT-PCR assays were repeated at least two times for each gene, and representative photos of the results are shown in Fig. 1. TH mRNA was first detected at stage 10a and was detected at all later stages (n = 2). l-Aromatic amino acid decarboxylase (AAD) mRNA was detected at all stages examined (n = 2). DBH mRNA was detected only at stage 10a (n = 6). PNMT mRNA was first detected at Stage 11c, and was strongly expressed after stage 12/s5–6 (n = 5). b1 and b2 Adrenoceptor subtype mRNAs were detected at all stages examined (n = 2), whereas b3 adrenoceptor subtype mRNA was detected only between stage 10a and stage 11b (n = 3). The results from the present study indicate that gene expression of catecholamine synthesizing enzymes occurs in rat embryos at much earlier stages than previously demonstrated, and each enzyme shows a different pattern of gene expression. The most significant finding is that these gene expressions occur before the appearance of neural crest cells. Neural crest cells first appear during development in the dorsal part of the neural tube around the time when it begins to close, i.e. at stage 12 on late GD 9 [24]. In the present study gene expression of TH, the rate-limiting enzyme for catecholamine synthesis, occurs at stage 10a on

Fig. 1. Agarose gel (2%) electrophoresis of RT-PCR products from rat embryos, stages 9 through 13/s11–12 by enzyme and receptor subtype. (Image was inverted for clarity.) Molecular weight size markers are in the first (left) lane. Expected RT-PCR product sizes are listed in Table 2. The ribosomal 28s bands from each stage were fractionated from 5 mg of total RNA (as used for RT-PCR assays) in formaldehyde/1% agarose gel. AR, Adrenoceptor subtype.

late GD 8, strongly suggesting that catecholamine synthesis capability is not limited to the cells of neural crest cell origin. These findings support the previously cited findings by Huang et al. [7]. The expression pattern of mRNA for PNMT, the enzyme for the synthesis of epinephrine from norepinephrine, is of interest. PNMT mRNA was first detected at stage 11c (socalled ‘late neural plate stage’) on mid GD 9, and was strongly expressed after stage 12/s5–6 on late GD 9. (NB, the RT-PCR assay used in the present study was not fully quantitative.) The former developmental stage corresponds to the time when cardiac cells begin to differentiate [11] and the latter when the heart beat is initiated [6] (Table 1). Although localization of PNMT mRNA during these stages is still needed to be examined, Ebert et al. reported that PNMT mRNA and PNMT enzyme activity were specifically localized in the rat heart on GD 11 [4]. These results suggest that epinephrine produced in the embryo, most likely in cardiac cells, may be involved in the development of the heart itself, particularly in the initiation and maintenance of the heart beat during the embryogenesis. This speculation is consistent with a hypothesis proposed by Pollack that catecholamines are involved in pacemaking activity in the adult heart [17]. The interpretation and significance of expression patterns of the other enzyme mRNAs is less clear at this time. For example, AAD mRNA was detected at all stages examined in the present study, i.e. from stage 9 (so-called ‘primitive streak stage’) on GD 8 through stage 13/s11–12 on mid GD 10. TH mRNA was detected at stage 10a (so-called ‘early amnion stage’) on late GD 8 and remained expressed during all later stages. DBH mRNA was detected only at stage 10a on early GD 9 but not at other stages. Explanations for these different patterns may be found by examining their roles in catecholamine synthesis and/or the biochemical characters of their products. For example, AAD is an enzyme that is involved in decarboxylation of various amino acids not only for that of l-dihydroxyphenylalanine (l-Dopa) to dopamine, e.g. 5-hydroxytryptophan, phenylalanine, tyrosine, tryptophan and histidine. Thus, its gene expression pattern may not directly reflect catecholamine synthesis. The result from present study suggests that decarboxylation of other amino acids is taking place during embryogenesis before catecholamine synthesis is initiated. TH is known to be regulated by a variety of mechanisms and may have a short turnover time to permit quick responses to conditional changes. This supposition is supported by the findings that TH mRNA expression was detected at all stages at approximately the same level after it first became detectable. Among these enzymes, DBH is the only one that has membrane-bound forms [8] suggesting that turn over of this enzyme may be longer than the others. In addition, in neural synapses of adult animals norepinephrine, a product of DBH, is usually recycled by re-uptake mechanisms. Thus, once DBH is translated during stage 10a, further DBH gene expression may not be necessary during the stages exam-

M. Fujinaga, J.C. Scott / Neuroscience Letters 231 (1997) 108–112

ined in the present study. Further investigations are needed to precisely elucidate these findings, which include the quantitative analyses on the time course of each gene expression. Stage 10a, when TH and DBH mRNAs were first detected, correspond to the beginning of notochordal process development. The notochordal process (more commonly called ‘head process’ in mouse and rat) is a midline rod-like structure from which the notochord develops. The notochord defines the primitive axis of the embryo, and the embryonic ectoderm over it thickens to form the neural plate as the notochord develops. In chick embryos, catecholamines were detected by fluorescence histochemistry in the early neural tube and notochord during embryogenesis [12,16]. Although these investigators speculated that the catecholamines originated from the egg yolk rather than from synthesis in the embryo, they suggested that catecholamines might be involved in neural tube closure. Using a rat whole embryo culture system, Klug reported that b adrenoceptor antagonists administered on GD 9 through GD 11 caused morphological abnormalities including neural tube defects and heart malformations [13]. Thus, these findings support a hypothesis that catecholamines and b adrenoceptors are involved in the development of the neural tube and its closure as well as cardiac development. There are also other possible developmental roles of catecholamines. During embryogenesis, rat and mouse embryos are surrounded by decidua, a mass of glycogen and fat used by the embryo as an energy source before the placental circulation is established [9]. In adult animals, catecholamines and b adrenoceptors are involved in the metabolic control functions of glucose and fatty acids. For example, activation of b adrenoceptors in the liver and skeletal muscle stimulates glycogenolysis. Thus, one can speculate that catecholamines are also involved in glycogenolysis in the decidua during the embryogenesis. Interestingly, Schlumpf and Lichtensteiger reported that they detected catecholamines in the yolk sac on GD 10 in rats by fluorescence histochemistry, although they speculated that the catecholamines originated from maternal circulation rather than from synthesis in the embryo [20]. (The yolk sac is anatomically and functionally located between the embryo and decidua.) In addition, catecholamines may be involved in the regulation of various growth factors during the embryogenesis, as they are in adult animals for endocrine hormones such as growth hormone [15]. Catecholamines are endogenous ligands for adrenergic and dopaminergic transmembrane receptors. The ontogeny and roles of these receptors before the development of the sympathoadrenal, cardiovascular and central nervous systems in the embryo have not been well investigated. Results from the present study indicate that gene expression of b adrenoceptors appears earlier than their ligands, the catecholamines. For example, mRNAs for b1 and b2 adrenoceptor subtypes were detected at all stages examined (although it remains to be examined whether they are

111

truly functional at these stages). In contrast, mRNA for b3 adrenoceptor subtype showed a different pattern of expression, i.e. it was detected only between stage 10a and stage 11b. Interestingly, involvement of b3 adrenoceptor subtype in the control of fatty acid mobilization is known in adult rats, suggesting that this receptor subtype might be related with decidual metabolism as discussed above. Nevertheless, the significance of these findings remains unclear at this time and further investigation is required. Some might argue that the results from the present study are inconsistent with those from so-called knock out animals. TH and DBH deficient mouse models have been developed recently [14,22,25] and, in both models, homozygous animals are found to survive at least until GD 10 (equivalent to GD 12 in rats). It is also known from human cases that DBH deficiency is not lethal [18]. A b1 adrenoceptor subtype deficient mouse has been developed recently [19]. Similar to TH and DBH deficient models, homozygous animals are found to survive during the embryogenesis. However, the presence of catecholamines and b adrenoceptors during the same early developmental stages when knock out animals are still viable argues for the existence of compensatory mechanisms for the missing enzymes and receptor subtypes, rather than for a lack of importance during development. In summary, results from the present study indicate that gene expression of catecholamine synthesizing enzymes and b adrenoceptor subtypes occurs in rat embryos at much earlier stages than previously thought, and each enzyme and receptor subtype shows a different expression pattern. Expression of these genes before the neural crest cells appear suggests that capability of catecholamine synthesis is not limited to the cells of sympathoadrenal lineage and the cells of central nervous system. In addition, developmental roles for catecholamines during the embryogenesis, such as on the heart and neural tube development and glycogenolysis, have been suggested. These results along with recent findings from other investigators have opened new avenues of catecholamine research. This study was supported by Veterans Affairs. We would like to thank Dr. Chang-Duk Chang for his help establishing RT-PCR assays in our laboratory. [1] Bohn, M.C., Goldstein, M. and Black, I.B., Expression of phenylethanolamine N-methyltransferase in rat sympathetic ganglia and extra-adrenal chromaffin tissue, Dev. Biol., 89 (1982) 299–308. [2] Chomczynski, P. and Sacchi, N., Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem., 162 (1987) 156–159. [3] Cochard, P., Goldstein, M. and Black, I.B., Ontogenic appearance and disappearance of tyrosine hydroxylase and catecholamines in the rat embryo, Proc. Natl. Acad. Sci. USA, 75 (1978) 2986–2990. [4] Ebert, S.N., Baden, J.M., Mathers, L.H., Siddall, B.J. and Wong, D.L., Expression of phenylethanolamine N-methyltransferase in the embryonic rat heart, J. Mol. Cell. Cardiol., 28 (1996) 1653–1658. [5] Fujinaga, M., Brown, N.A. and Baden, J.M., Comparison of staging systems for the gastrulation and early neurulation period in rodents: a proposed new system, Teratology, 46 (1992) 183–190.

112

M. Fujinaga, J.C. Scott / Neuroscience Letters 231 (1997) 108–112

[6] Goss, C.M., The first contractions of the heart in rat embryos, Anat. Rec., 70 (1938) 505–524. [7] Huang, M.-H., Friend, D.S., Sunday, M.E., Singh, K., Haley, K., Austen, K.F., Kelly, R.A. and Smith, T.W., An intrinsic adrenergic system in mammalian heart, J. Clin. Invest., 98 (1996) 1298–1303. [8] Joh, T.H. and Hwang, O., Dopamine b-hydroxylase: biochemistry and molecular biology, Ann. N. Y. Acad. Sci., 493 (1987) 342–350. [9] Jollie, W.P., Electron microscopic observations on primary decidua formation in the rat, Am. J. Anat., 116 (1965) 217–236. [10] Jonakait, G.M., Rosenthal, M. and Morrell, J.I., Regulation of tyrosine hydroxylase mRNA in catecholaminergic cells of embryonic rat: analysis by in situ hybridization, J. Histol. Cytol., 37 (1989) 1–5. [11] Kaufman, M.H. and Navaratnam, V., Early differentiation of the heart in mouse embryo, J. Anat., 133 (1981) 235–246. [12] Kirby, M.L. and Gilmore, S.A., A fluorescence study on the ability of the notochord to synthesize and store catecholamines in early chick embryos, Anat. Rec., 173 (1972) 469–478. [13] Klug, S., Whole embryo culture: interpretation of abnormal development in vitro, Reprod. Toxicol., 5 (1991) 237–244. [14] Kobayashi, K., Morita, S., Sawada, H., Mizoguchi, T., Yamada, K., Nagatsu, I., Hata, T., Watanabe, Y., Fujita, K. and Nagatsu, T., Targeted disruption of the tyrosine hydroxylase locus results in severe catechol-amine depletion and perinatal lethality in mice, J. Biol. Chem., 270 (1995) 27235–27243. [15] Krieg, R.J., Perkins, S.N., Johnson, J.H., Rogers, J.P., Arimura, A. and Cronin, M.J., b-Adrenergic stimulation of growth hormone (GH) release in vivo, and subsequent inhibition of GH-releasing factorinduced GH secretion, Endocrinology, 122 (1988) 531–537. [16] Lawrence, I.E. and Burden, H.W., Catecholamines and morphogenesis of the chick embryo neural tube and notochord, Am. J. Anat., 137 (1973) 199–208.

[17] Pollack, G.H., Cardiac pacemaking: an obligatory role of catecholamines?, Science, 196 (1977) 731–738. [18] Robertson, D., Haile, V., Perry, S.E., Robertson, R.M., Phillips III, J.A. and Biaggioni, I., Dopamine beta-hydroxylase deficiency. A genetic disorder of cardiovascular regulation, Hypertension, 18 (1991) 1–8. [19] Rohrer, D.K., Desai, K.H., Jasper, J.R., Stevens, M.E., Regula, D.P., Barsh, G.S., Bernstein, D. and Kobilka, B.K., Targeted disruption of the mouse beta1-adrenergic receptor gene: developmental and cardiovascular effects, Proc. Natl. Acad. Sci. USA, 93 (1996) 7375– 7380. [20] Schlumph, M. and Lichtensteiger, W., Catecholamines in the yolk sac epithelium of the rat, Anat. Embryol., 156 (1979) 177–187. [21] Teitelman, G., Baker, H., Joh, T.H. and Reis, D.J., Appearance of catecholamine-synthesizing enzymes during development of rat sympathomimetic nervous system: possible role of tissue environment, Proc. Natl. Acad. Sci. USA, 76 (1979) 509–513. [22] Thomas, S.A., Matsumoto, A.M. and Palmiter, R.D., Noradrenaline is essential for mouse fetal development, Nature, 374 (1995) 643– 646. [23] Verhofstad, A.A.J., Hokfelt, T., Goldstein, M., Steinbusch, H.W.M. and Joosten, H.W.J., Appearance of tyrosine hydroxylase, aromatic amino-acid decarboxylase, dopamine b-hydroxylase and phenylethanolamine N-methyltransferase during the ontogenesis of the adrenal medulla, Cell Tissue Res., 200 (1979) 1–13. [24] Weston, J.A., The migration and differentiation of neural crest cells, Adv. Morphogenesis, 8 (1970) 41–114. [25] Zhou, Q.-Y., Quaife, C.J. and Palmiter, R.D., Targeted disruption of the tyrosine hydroxylase gene reveals that catecholamines are required for mouse fetal development, Nature, 374 (1995) 640–643.