Gene Expression of Four Targets In Situ of the First Trimester Maternal-fetoplacental Interface

Journal Pre-proof Gene Expression of Four Targets In Situ of the First Trimester Maternal-fetoplacental Interface Sandra A. Founds, Donna B. Stolz

PII:

S0040-8166(19)30360-X

DOI:

https://doi.org/10.1016/j.tice.2019.101313

Reference:

YTICE 101313

To appear in:

Tissue and Cell

Received Date:

22 August 2019

Revised Date:

19 October 2019

Accepted Date:

5 November 2019

Please cite this article as: Founds SA, Stolz DB, Gene Expression of Four Targets In Situ of the First Trimester Maternal-fetoplacental Interface, Tissue and Cell (2019), doi: https://doi.org/10.1016/j.tice.2019.101313

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

1 Gene Expression of Four Targets In Situ of the First Trimester Maternal-fetoplacental Interface

Sandra A. Founds1* and Donna B. Stolz2 University of Pittsburgh

Associate Professor, School of Nursing Member Magee-Womens Research Institute

2

Associate Professor, Cell Biology Associate Director, Center for Biologic Imaging

Correspondence to

ro

*

of

1

Sandra Founds, PhD 3500 Victoria St. 448 Victoria Building University of Pittsburgh Pittsburgh

re

-p

PA 15261 [email protected]

Highlights

Pathways analysis indicated potential network interactions among a subset of

lP



preeclampsia candidate genes in early human placental tissues. In situ hybridization of EPAS1, FSTL3, IGFBP1, and SEMA3C demonstrated differential

ur na



expression between fetoplacental and maternal tissues of each target at the first trimester placental interface. 

Commonly considered a decidual biomarker, IGFBP1 was also expressed by

Jo

fetoplacental cells.

2

1. Introduction Preeclampsia complicates 3–10% of all pregnancies and continues to be one of the leading causes of maternal mortality worldwide.1-4 Mothers and offspring who survive the disorder are subsequently at increased risk of later life cardiovascular diseases.5-8 Elucidating the molecular pathogenesis of preeclampsia has been challenging in this heterogeneous

of

pregnancy disorder which becomes clinically apparent after mid-gestation.1 Preeclampsia is a complex trait, meaning that it varies by maternal, fetal, and placental genetic and epigenetic

ro

factors interacting with environmental effects to produce several phenotypes.9-13

Impaired spiral artery remodeling due to decreased trophoblast invasion may produce

-p

hypoxia, oxidative stress, and other metabolic disruptions that can lead to certain types of

re

preeclampsia, such as early onset preeclampsia with severe features, and/or other pregnancy complications such as fetal growth restriction.13 In an effort to examine early molecular

lP

signatures of pathogenesis in the first trimester maternal-fetoplacental interface, we had previously conducted a genome-wide microarray analysis of chorionic villus sampling (CVS)

ur na

surplus tissues at ~11.5 weeks of gestation from pregnancies that developed preeclampsia and uncomplicated outcomes. Transcriptome differences yielded a panel of 36 novel candidate genes in preeclampsia pregnancies, months before the onset of clinical signs or symptoms.14,15 Because the snap-frozen CVS samples had included tissues of the maternal-fetoplacental

Jo

interface, in situ hybridization (ISH) localization studies were also previously conducted to determine whether the candidates were expressed by maternal, fetoplacental, or cells of both compartments. The most down regulated gene, LAIR2 (gene names in Table 1), was found to be expressed only by the invasive extravillous trophoblast at the leading edge of the anchoring cell columns and in remodeling spiral arteries of first trimester termination tissues from women who had no chronic disease. These data demonstrated LAIR2 expression in tissues of unknown pregnancy outcomes at the gestational age and site of spiral artery remodeling, thereby

3 implicating the candidate in critical processes for placental development with potential to affect normal versus adverse outcomes.16,17 Our current project is another step in the line of investigation with the preeclampsia CVS candidate gene panel. The genes for the current study were selected because they networked with LAIR2 in our bioinformatics pathways analysis.14 Pathways and gene-gene interactions among the 36 candidates from the CVS tissues had been queried using Ingenuity Pathways

15,18

of

Analysis software, a database of molecular algorithms built from curated research findings.14, A network predicted to affect Cellular Movement-Reproductive System Development and

ro

Function-Cell Morphology incorporated 14 of the candidates from the CVS panel, including

LAIR2.18 Four other candidates interacting in this network, i.e., EPAS1, FSTL3, IGFBP1, and

-p

SEMA3C, were all down regulated in the early placental tissues of preeclampsia compared with

re

expression in tissues of uncomplicated pregnancies (Table 1).14,15

lP

The current study, therefore, aimed to quantify mRNA expression of these four additional genes in early pregnancy by applying our previous localizations methods.16,17 Because there

ur na

was a dearth of information about expression of these genes in early placentation tissues, as well as lack of safe access to placental tissues in ongoing human gestation, we investigated expression signals in first trimester decidua and villous tissues of pregnancy terminations. We questioned whether each of the four targets would be expressed by maternal, fetoplacental, or

Jo

both types of cells in the first trimester of any human pregnancy, regardless of outcomes later in gestation or at birth. Knowledge of the timing and level of gene expression by cytologic or histologic site could lead to a better understanding of gene function.21,22

4 2. Materials and Methods 2.1 Samples Following ethical review board approval, formalin-fixed paraffin-embedded (FFPE) tissue samples archived by our tertiary hospital were utilized. First trimester placental tissues from 10 women who underwent terminations for non-medical indications were selected. Inclusion criteria were blocks of placental tissue from women with singleton fetuses at 8 through 12 completed

of

weeks of gestation based on ultrasound parameters. Exclusion criteria were maternal disorders, such as diabetes, hypertension, other chronic diseases, or fetal or placental anomalies. Tissue

ro

blocks were de-identified. Each block was processed to provide 5 μm-thick sections. One

randomly selected slide per case was submitted for hybridization for each of the four gene

re

-p

expression experiments.

2.2 ISH procedures

lP

We implemented our previously published methods for ISH to probe these termination tissues with gene-specific riboprobes in the antisense and sense control orientations. Human

ur na

cDNA for each gene (Open Biosystems; Thermo Scientific, Huntsville, AL) was re-amplified by real-time polymerase chain reaction (RT-PCR) with gene-specific primer sets (Integrated DNA Technologies Inc., Coralville, IA) (Table 2).16,17 The PCR products were ligated to the pGEM-T vector (Promega, Madison, WI). The DNA was sequenced for verification. Restriction digest was

Jo

performed to linearize the plasmids. Gene-specific riboprobes were synthesized by in vitro transcription with a Maxiscript SP6/T7 kit (Thermo Fisher, Pittsburgh, PA). Unincorporated nucleotides were removed using RNA Mini Quick Spin Columns (Roche, Indianapolis, IN).

Pretreated FFPE sections were deparaffinized in xylenes and rinsed with ethanol. Sections were hybridized with 35S-UTP-labeled riboprobes at 50oC overnight with 0.1M dithiothreitol in the hybridization mix. Tissue sections were coated with NTB-2 emulsion (Kodak, Rochester, NY)

5 and exposed at 10oC for 14-28 days based on the intensity of the silver grain signals per cell (Table 2). Sections were counterstained with hematoxylin (Vector) and mounted with Permount (both products from Fisher Scientific, Pittsburgh, PA). Control ISH experiments were performed with the sense sequence of each gene-specific probe.16,17

2.3 Data acquisition

of

Data collection was conducted using an Olympus Provis I Fluorescence microscope with the MagnaFire 2.1 digital imaging system (Olympus, Melville, NY). Polarizing filters, a 10x

ro

eyepiece, and a 20x objective with oil were used for dark field imaging of the ISH silver grains which appeared as white spotted staining. Hybridized tissue sections of 10 cases per gene were

-p

evaluated for overall mRNA expression signal distribution. Fields were randomly selected for

re

areas with positive/negative/intermediate silver grain signal. At least three to five fields were imaged in each section of every case per target, i.e., up to ~50 images for each target.

lP

Every field was also imaged in color, using light microscopy of the hematoxylin stained tissues at the same magnification and location. The silver grains appeared as black spotted in

ur na

the bright field images. Threshold settings were optimized and maintained for consistency of imaging parameters across all slides hybridized in the 10 cases for each gene. The digital images were imported to NIS Elements AR version 5.02 capture and analysis software (Nikon, Melville, NY). A binary layer created within the software by merging the dark

Jo

field image with the background-corrected bright field image. Bright spots set at 1 pixel were detected, representing the grayscale intensity of silver grains of candidate mRNA expression. Overall distribution of the silver grains in each tissue section was evaluated. The density of silver grains was semi-quantified within “regions of interest” (NIS Elements term) which were hand-drawn around randomly selected subsets of cells within tissues and structures in the upper bright field layer depicting hematoxylin staining. Fourteen to 38 regions of interest (average 25) were collected per field image. These regions captured the numeric “binary area

6 fraction” (NIS Elements term) which indicated the proportion of an area in pixels squared (px2) containing bright white spots (positive silver grain ISH staining signal) in the lower layer dark field image. The binary area fraction data from each region of interest were exported to an Excel spreadsheet. Determination of cell types for the regions of interest was based on our prior localizations of LAIR2 16,17 and morphologic features detectable at 200x in hematoxylin

of

counterstained ISH fields. Villous trophoblast, anchoring cell columns, and sheets of decidua were distinguishable. Trophoblast were identifiable as single or clustered polygonal cells with

ro

nuclei that were larger than those of decidua. Trophoblast nuclei were pleomorphic,

hyperchromatic or irregular. The magnification level, hematoxylin only counterstaining, overlap

-p

of cells due to section thickness, and random selection of regions of interest per cell type led to

re

categorizing cytotrophoblast and syncytiotrophoblast as a single group, labeled as villous trophoblast. Decidual cells were characterized by round to polygonal morphology with sharply

lP

defined borders in cross section. The nuclei were single round, and relatively hypochromic, containing large prominent nucleoli.59-60

ur na

Cell types were categorized within tissue structures as background (no cells), villous trophoblast, villous stroma, anchoring cell column, decidua expressing low to no signal (area with ≤ 5% of cells with silver grain signal), decidua with medium expression (area with 40-50% of cells were positive for signal), or decidua with high expression (area with ≥ 90% of cells

Jo

expressed signal).21 Scoring of decidua was determined across all cases of each target, rather than by comparison of the four hybridization experiments. Preliminary reads were conducted by two independent reviewers (SAF, WTP), then the PI (SAF) selected the regions of interest and conducted verifications with placental pathologists (JFB, WTP). Regions of interest were collected in antisense sections devoid of tissue (blank) as baseline for comparison of the gene expression signal in various cell types. Internal control was also provided by non-expressing cells of the same type.61

7

2.4 Data analysis Descriptive statistics (mean, standard deviation, median, and interquartile range) were obtained from all regions of interest for each gene target in all cases. The Shapiro-Wilk test was used to analyze the distribution of the binary area fraction data. The Kruskal-Wallis test was used to analyze the data for expression of each gene by cell type. Descriptive statistics and

of

plots were used to explore variation in expression by cell type and gestational age. Relative expression among cell types for each target was normalized by subtracting the median

ro

background signal from the median value by cell type, and dividing the higher binary area

fraction by the lower binary area fraction.21,62 IBM SPSS Statistics 24 (Armonk, NY) software

re

-p

was utilized and significance level set at p ≤ .05 for all analyses.

2.5 IHC procedures

lP

Immunohistochemistry (IHC) was conducted in separate additional slides of the same 10 cases, in order to inform the reads of cell types visualized in the ISH sections with only

ur na

hematoxylin counterstaining. IHC proceeded in a semi-automated manner with FFPE tissue sections. We optimized antibodies utilizing positive control tissues, followed by optimization of dilutions in placental tissues prior to staining the cases for this study (Table 3). The slides were loaded on the Leica Bond-Max Fully Automated IHC and ISH Staining System (Leica, Buffalo

Jo

Grove, IL). The program was run according to manufacturer’s instructions. Briefly, slides were deparaffinized using Bond Dewax Solution (AR9222), dehydrated with alcohol, incubated with Bond Epitope Retrieval Solution 1 (AR9961), incubated with primary antibody (Table 6) and with a Bond Polymer Refine detection kit (DS9800). Slides were stained with diaminobenzidine tetrahydrochloride (DAB) incubation followed by hematoxylin staining.

8 IHC sections were examined and imaged with the same systems used for ISH. Morphology was evaluated qualitatively. Images captured using settings that differed for each target were unadjusted for presentation as the data in Figures 2-5.

3. Results 3.1 Tissue samples from the first trimester

of

In this current localization study of the in situ expression of the four genes of interest at the maternal-fetoplacental interface, the average gestational age of the 10 cases was 10.2

ro

weeks ([wks] SD ± 1.55 wks; range 8-12 weeks 3 at 8 wks, 6 at 11 wks, 1 at 12 wks).

Consistent with the ethics review, the available de-identified data provided to the team did not

-p

include the number of days in the gestational week or additional maternal clinical/demographic

re

characteristics of the termination tissues that were utilized. Case 9 was the only sample at 12 weeks of gestation and no decidua was found in its sections that were hybridized for this study.

lP

Among the other cases that did include decidua, few endometrial glands or spiral arteries were

ur na

present, leading us to assess these structures qualitatively rather than quantitatively.

3.2 Gene expression differed by cell type The overall binary area fraction of gene expression signal in all cases of each target was non-normally distributed (Shapiro-Wilk test, p < .001; Table 4). The nonparametric distributions

Jo

led to the use of the median binary area fraction of ISH signal, which differed significantly among cell types for hybridization of each target (Kruskal-Wallis test, p < .001; Table 5). Background signal within each hybridization experiment did not differ between antisense sections with signal and control sense sections without signal (Figure 1) and did not vary significantly among cases within each hybridization (SD ≤ .001).

Insert Figure 1 and legend

9

3.2.1 EPAS1 The strongest EPAS1 expression was in fetoplacental tissue where the highest density of silver grains occurred in cells of the anchoring cell columns, as exemplified in Figure 2. The binary area fraction of EPAS1 signal was 1.62 times higher in anchoring cell columns compared to villous trophoblast and 4.2 times higher than in villous stroma. Villous trophoblast signals

of

were 2.6 times higher than in the villous stroma (Table 5; Figure 2G). Signal was also seen in areas of decidua. The binary area fraction of high expressing

ro

decidua was 1.45 greater than medium expressing decidua and 3.2 times higher than in low expressing decidua; whereas, medium expressing decidua demonstrated 2.2 times higher

-p

binary area fraction than low expressing decidua (Table 5; Figure 2G).

re

Villous trophoblast demonstrated significantly more EPAS1 mRNA silver grain expression signal than decidua. Cells in the anchoring cell column demonstrated binary area

lP

fraction 1.31 times greater than in high expressing decidua. Villous trophoblast expressed ISH signal 1.2 times higher than medium expressing decidua (Table 5; Figure 2G). EPAS1 in each

ur na

cell type increased by week of gestation (Figure 2H). Spiral arteries ranged from no mRNA expression to low or moderate concentrations of silver grains in a few spiral arteries (data not shown). Few cell islands across cases also

Jo

expressed high concentrations of silver grains, as well as antigen staining (Figure 2C).

Insert Figure 2 and legend

3.2.2 FSTL3 The highest concentrations of FSTL3 silver grains were seen in cells of the anchoring cell columns. Villous trophoblast expressed mRNA moderately. The binary fraction area of

10 FSTL3 in cells of the anchoring cell columns was 8.5 times higher than in villous trophoblast, whereas, there was little to no expression by the villous stroma (Table 5; Figure 3). Decidua generally demonstrated no signal, but occasional areas demonstrated weak staining. Only low expressing decidua yielded binary fraction area data; whereas, no regions of interest were found with medium or high expressing areas of decidual cells. The binary fraction area was 17 times higher in anchoring cell columns compared with

of

low expressing decidua. Villous trophoblast produced twice as much FSTL3 signal as low expressing decidua (Table 5; Figure 3G). Sections of villous trophoblast appeared to increase

ro

expression with gestational age, but expression by gestational age in decidua could not be assessed (Figure 3H).

-p

Across all cases, three sections included trophoblast in cell islands, where signals were

re

highly concentrated. Cells in endometrial glands and spiral arteries stained at low levels,

ur na

Insert Figure 3 and legend

lP

whereas others of these structures contained cells that expressed no mRNA.

3.2.3 IGFBP1

Occasional moderate silver grain staining in some cells of the anchoring cell columns

Jo

was visualized. The binary area fraction was similar with overall low IGFBP1 signal across all regions of villous trophoblast and cells in anchoring cell columns. There was no expression in villous stroma (Table 5; Figure 4). Some decidua was negative, while other areas demonstrated very high concentrations

of silver grains (Figure 4). The binary area fraction in high expressing decidua was 20 times greater than in low expressing decidua, and four times greater than medium expressing decidua.

11 IGFBP1 signal in high expressing decidua was 20 times higher than in villous trophoblast and cells of anchoring cell columns and five times higher in medium expressing decidua than villous trophoblast and cells of anchoring cell columns (Table 5; Figure 4G). The few endometrial glands and spiral arteries visualized contained no signal. Expression increased in decidua by gestational age (Figure 4H).

of

Insert Figure 4 and legend

ro

3.2.4 SEMA3C

Trophoblast contained nuclear and cytoplasmic SEMA3C mRNA expression signals

-p

(Figure 5). The strongest silver grain concentration was seen in cells of the anchoring cell

than in villous trophoblast (Table 5).

re

columns. SEMA3C binary area fraction was nine times higher in cells of anchoring cell columns

lP

Some areas of decidua contained low concentrations of silver grains. Medium expressing decidua had the highest binary area fraction, compared with no signal in low

ur na

expressing decidua. No regions of interest were identified as high expressing areas of decidua (Figure 5G).

Cells in anchoring cell columns expressed three times higher signal than medium expressing decidua. Binary area fraction in medium expressing decidua was three times higher

Jo

than in villous trophoblast (Figure 5G). Signal in villous trophoblast increased by weeks of gestation (Figure 5H). A few cell islands among cases and cells in the chorionic plate expressed signal,

whereas cells in endometrial glands and spiral arteries were negative for ISH staining (Figure 5).

Insert Figure 5 and legend

12

4. Discussion

4.1 Demonstrated differences in expression between compartments In this follow up study, we investigated whether EPAS1, FSTL3, IGFBP1, and SEMA3C

of

would be expressed by cells of the maternal, fetoplacental, or both compartments of the human first trimester interface. These candidates were predicted to interact with innate immune

ro

biomarker LAIR2 in a molecular network identified through pathways analysis of all 36 genes from our prior initial microarray study. This functional network incorporated 39 percent of the

-p

CVS panel (Figure 6).18 Each of the five candidates had been down regulated in our first

re

trimester surplus CVS specimens, supporting the potential for decreased function in Cellular Movement- Reproductive System Development and Function-Cell Morphology in early placental

lP

development of preeclampsia pregnancies.14-18 The results of the current localizations corroborate that this subset of four genes is present and transcribing mRNA in different

ur na

compartments of the first trimester maternal-fetoplacental interface in human pregnancy.

Jo

Insert Figure 6 and legend

Semi-quantitating gene expression in situ augments molecular knowledge of the early

developing placental interface where defective maternal vascular response to trophoblast invasion can lead to many pregnancy complications.23-25 Our previous LAIR2 ISH studies localized mRNA expression specifically to invasive extravillous trophoblast in anchoring cell columns and stages of remodeling spiral arterioles, but no transcription was found in decidua.16,17 In contrast, all four additional candidates in this current study were expressed to

13 differing extents by both maternal and fetoplacental compartments. These localizations can serve to contextualize the bioinformatically predicted data of recent single cell RNA sequencing (RNAseq) studies of early tissues at 6-14 weeks26 and 6-11 weeks of gestation.27 Samples such as ours at or before 12 weeks reflect maternal-fetoplacental interactions in the relatively low oxygen metabolic milieu prior to the onset of placental function with maternal blood flowing

of

through the spiral arteries to the intervillous space.23-25

4.2 Higher fetoplacental expression

ro

FSTL3 and SEMA3C were both more highly expressed by fetoplacental cells, but also demonstrated decidual expression. Within the functional network of interest (Figure 6), FSTL3

-p

regulated follicle stimulating hormone secretion28 and SEMA3C was regulated by MAPK/ERK

re

kinase.29 FSTL3 functions in activin signaling and Bone Morphogenetic Protein (BMP) signaling to regulate cell-cell adhesion, fibronectin binding, and activin binding, while SEMA3C interacts

lP

with neuropilin and plexin to affect axon guidance, immune response, and blood vessel remodeling.19,20 Hypoxia upregulated FSTL3 in term primary human trophoblast30 and

ur na

trophoblast cell lines.31 Knock out of FSTL3 in cultured cell line trophoblast decreased proliferation, migration, invasion and lipid storage, but increased apoptosis.31 SEMA3C expression was higher in proliferating than in secretory endometrial cells of nonpregnant women.32 Together, these studies support involvement of FSTL3 and SEMA3C in the Cellular

Jo

Movement-Reproductive System Development and Function-Cell Morphology network in tissues of the first trimester maternal-fetoplacental interface. We find no previous studies demonstrating FSTL3 expression in situ at the early human

maternal-fetoplacental interface. Petraglia’s group had used RT-PCR to assess FSTL3 gene expression and IHC to evaluate antigen in first trimester and term trophoblast, decidua, and fetal membranes.33 All of these cell types at both gestational ages expressed FSTL3 mRNA, but site and relative quantity were not determined. Darker bands on their agarose gels depicted stronger

14 expression in first trimester than in term trophoblast, and bands from decidua were weaker than trophoblast at each time point.33 These data were consistent with our findings in first trimester semi-quantitation in situ, and concomitantly, our methods added precision to concentrations of FSTL3 transcribed at these sites. Our prior findings of FSTL-3 in maternal circulation, taken with the findings of the current study, may suggest that the elevated mid-gestation FSTL-3 which tripled the odds of preeclampsia outcomes34 may have been attributable to both sides of the

of

maternal-fetoplacental interface with higher secretion from the fetoplacental compartment. Our prior measurements of FSTL-3 in maternal circulation during pregnancy34 may have been

ro

attributable to both maternal decidua and trophoblast, but with higher secretion from the fetoplacental compartment.

-p

SEMA3C expression was more fetoplacental and increased by weeks of gestation,

re

although some areas of maternal decidua also expressed this candidate gene at lower moderate levels. Cells in anchoring cell columns expressed the highest levels of SEMA3C. To

lP

our knowledge, this is the first in situ localization study with this gene in any human maternalfetoplacental tissues. RNAseq demonstrated SEMA3C expression in placental samples, and in

ur na

endometrial tissue of nonpregnant women,35 which was consistent with quantitative RT-PCR studies of SEMA3C in the endometrium;32 however, no data are available for this candidate in pregnancy decidua or trophoblast. With our prior finding of SEMA3C down regulation in the first trimester CVS samples,14,15 the data herein localizing the highest expression to cells in the

Jo

anchoring cell columns may indicate reduced axonal guidance and angiogenesis by these cells in early placentae of preeclampsia adverse pregnancy outcomes.

4.3 More Relatively equivocal expression To our knowledge, this is the first study to examine ex vivo human placental sections localizing EPAS1 mRNA expression patterns at the early maternal-fetoplacental interface. EPAS1 expression increased with gestational age in both maternal and fetoplacental tissues;

15 however, signal was 31% higher in cells of the anchoring cell columns, compared with cells in high expressing decidual areas. Villous trophoblast expressed 18% higher EPAS1 than the medium expressing decidua. Differential expression of this candidate between compartments was less marked than differences in expression between maternal versus fetoplacental cell types for FSTL3, SEMA3C, or IGFBP1. In the functional network, EPAS1 demonstrated 11 potential molecular interactions

of

(Figure 6). EPAS1 interacted with its own protein,36 AKT,37 collagen type I, collagen type IV,38 ERK,39 FN1,38 insulin, MAP kinase, MEK,39 PI3K complex,40 and VEGF.41 Among these

ro

interactions, ERK, MAP kinase, and MEK functioned with EPAS1 in human placental mesenchymal stem cells.39

-p

EPAS1, also known as hypoxia inducible factor 2 alpha (HIF2A), encodes a transcription

re

factor that is induced by falling oxygen levels19,42 to function in angiogenesis, cell differentiation, signal transduction, and embryonic development.20 Relative hypoxia in normal first trimester

lP

tissues regulates trophoblast differentiation and promotes invasiveness of extravillous trophoblast,43,44 which is congruent with our data identifying the highest EPAS1 expression in

ur na

cells of the anchoring cell columns. These data support that the down regulated EPAS1 in our prior CVS microarray could indicate decreased trophoblast response to oxygen levels in the first trimester placental tissues of preeclampsia pregnancies.14,15 On the other side of the developing interface, up to 50% of the cells in the decidua are

Jo

maternal immune cells.45 Although EPAS1 has been found by others to be up regulated 15-fold in first trimester decidual macrophages compared to macrophages isolated from maternal blood,46 and to be expressed by decidual natural killer cells,26 we find no prior studies of EPAS1 expression in decidual stroma as visualized in our tissues.

4.4 Higher decidual expression

16 IGFBP1 localized mainly to decidual cells with expression increasing by gestational weeks in the first trimester. This candidate was also expressed at overall low levels by fetoplacental tissues, although cells in some anchoring cell columns stained moderately. IGFBP1 interacted with nine molecules in the functional network of interest (Figure 5). IGFBP1 interacted with its own protein,47 alpha catenin, AKT,48 ERK,49 FN1,50 focal adhesion kinase,51 insulin,52 PI3K complex,53 and SRC family.51 EPAS1 and IGFBP1 both interact with

of

five of the same molecules.18 IGFBP1 encodes secreted protein that circulates in the plasma and binds IGF-I and -2,

ro

affecting cell migration and metabolism. Low levels of IGFBP-1 have been associated with

impaired glucose tolerance, vascular disease, and hypertension in humans,32 aberrations that

-p

contribute to the development of preeclampsia.14,15 Expression of this candidate had been

re

demonstrated by ISH previously, but only in the yolk sac and placental vessels of rats.54 IGFBP1 is commonly considered to be a marker of endometrial decidualization.55-58 A recent

lP

RNAseq of single cells at the first trimester maternal-fetoplacental interface localized IGFBP1 in two of three distinct classes of decidual cells.26 Our data not only corroborate this function in

ur na

maternal decidualized endometrium, but additionally support trophoblast as sites of mRNA transcription, consistent with RNAseq studies that identified placental production of IGFBP1. Among eight placental samples submitted for quantitative IGFBP1 transcriptomics analysis, an average of 48.1% of the cells were trophoblast, 21.3% endothelial cells, and 30.6% other cell

Jo

types.35 The localization of IGFBP1 to both compartments could indicate more of a decidual defect with down regulation in preeclampsia, while fetoplacental expression could also contribute to various subtypes of the disorder. The within sample variability in expression of IGFBP1 in decidua could be related to the different types of decidual stroma, as well as the classes of leukocytes comprising decidual tissue.26

4.5 Limitations

17 Specifying distinct cell types within the maternal versus fetoplacental compartments was challenging with hematoxylin only counterstaining of the ISH sections and the use of 200x magnification. In addition, the one-dimensional plane of the images limited the ability to determine silver grain signals in different cell types that may have overlapped. Due to the constraints of our methods, for example, immune cells were potentially classified as “decidua.” Proliferative versus invasive extravillous trophoblast were grouped as “cells of anchoring cell

of

columns,” while villous cytotrophoblast and syncytiotrophoblast were classified as “villous trophoblast.” Semi-quantitation rather than precise quantitation resulted from our approach. The

ro

methodological issues were mitigated by morphologic information added by the IHC sections. Combining ISH with IHC or with IHC dual staining could enhance precision in determining cell

-p

types in decidua and classes of trophoblast, but such methods are difficult to optimize together,

re

and sensitivity of one or both methods can be affected when combined.21 As mentioned, safe access to tissues and cells of the developing placental interface in

lP

ongoing pregnancies also posed potential challenges to this study. While it is unlikely, based on prevalence of the disorder, the sites of target gene expression in our samples could have

ur na

differed in tissues of women with and without later preeclampsia. The tissues from terminated pregnancies with unknown outcomes may have been affected by subsequent adverse versus uncomplicated outcomes. Nonetheless, these initial efforts to elucidate the sites and relative expression of the four target genes may contribute to better understanding of early molecular

Jo

interactions at the maternal-fetoplacental interface.

5. Conclusions Knowledge of the location, timing, and semi-quantitative mRNA expression in the first

trimester maternal versus fetoplacental compartments provides at least preliminary insight to better targeting future studies of gene function in specific cell types.21,22 Studies of the candidates need to be conducted in primary human cells and tissues rather than immortalized

18 cell lines.16,17,63 Studies in serial sections and tissues that include spiral arterioles and endometrial glands are also indicated. Our localization and relative quantitation data for the network of candidates discovered in CVS of preeclampsia versus uncomplicated pregnancies 14,15

add spatial in situ context for single cell RNAseq predicted findings.26,27 Considering these

genes as a group in functional interaction may elucidate early normal maternal-fetoplacental

of

development and pathogenesis in adverse pregnancy outcomes.64

Funding

ro

The study was supported by funding from the National Institutes of Nursing Research

re

-p

R03NR013961, 2013-2016.

Acknowledgements

lP

University of Pittsburgh Institutional Review Board protocol number PRO09020349 Consultation and collaborations with the following:

ur na

Jeffrey F. Bonadio, MD, pathologist

Carlos Castro, DMD, MD, Magee-Womens Institute Histocore Dina Fradkin, BSN, RN, Undergraduate Research Mentee W. Tony Parks, MD, pathologist

Jo

Todd A. Reinhart, ScD, ISH lab

Callen Wallace and Jonathan Franks University of Pittsburgh Center for Biologic Imaging

19 References 1. American College of Obstetricians and Gynecologists (ACOG), ACOG Task Force on Hypertension in Pregnancy, Hypertension in pregnancy, Report of the American College of Obstetricians and Gynecologists’ Task Force on hypertension in pregnancy. Obstet Gynecol 2013, 122, 1122-1131, doi: 10.1097/01.AOG.0000437382.03963.88.

of

2. Booker, W.A.; Ananth, C.V.; Wright, J.D.; Siddiq, Z.; D'Alton, M.E.; Cleary, K.L.; Goffman, D.; Friedman, A.M. Trends in comorbidity, acuity, and maternal risk associated with preeclampsia

ro

across obstetric volume settings. J Matern Fetal Neonatal Med 2018,12, 1-8, doi:

-p

10.1080/14767058.2018.1446077.

re

3. Gasse, C.; Boutin, A.; Demers, S.; Chaillet, N.; Bujold, E. Body mass index and the risk of hypertensive disorders of pregnancy: The great obstetrical syndromes (GOS) study.

lP

J Matern Fetal Neonatal Med 2017, 13, 1-6, doi: 10.1080/14767058.2017.1399117.

ur na

4. Polsani, S.; Phipps, E.; Jim, B. Emerging new biomarkers of preeclampsia. Adv Chronic Kidney Dis 2013, 20, 271-279, doi: 10.1053/j.ackd.2013.01.001.

5. McDermott, M.; Miller, E.C.; Rundek, T.; Hurn, P.D.; Bushnell, C.D. Preeclampsia:

Jo

Association with posterior reversible encephalopathy syndrome and stroke. Stroke, 2018, 49, 524-530, doi: 10.1161/STROKEAHA.117.018416.

6. Rice, M.M.; Landon, M.B.; Varner, M.W.; Casey, B.M.; Reddy, U.M.; R.J. Wapner; … Blackwell, S.C.; Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) Maternal-Fetal Medicine Units (MFMU) Network. Pregnancy-associated

20 hypertension and offspring cardiometabolic health, Obstet Gynecol 2018, 131, 313-321, doi: 10.1097/AOG.0000000000002433.

7. Riegel, B.; Moser, D.K.; Buck, H.G.; Dickson, V.V.; Dunbar, S.B.; Lee, C.S.; … Webber, D.E. American Heart Association Council on Cardiovascular and Stroke Nursing; Council on Peripheral Vascular Disease; and Council on Quality of Care and Outcomes Research. Self-

of

care for the prevention and management of cardiovascular disease and stroke: A scientific

2017, 6, pii: e006997. doi: 10.1161/JAHA.117.006997.

ro

statement for healthcare professionals from the American Heart Association. J Am Heart Assoc.

-p

8. Wu, P.; Haththotuwa, R.; Kwok, C.S.; Babu, A.; Kotronias, R.A.; Rushton, C. et al.

re

Preeclampsia and future cardiovascular health: A systematic review and meta-analysis. Circ

lP

Cardiovasc Qual 2017, 10, e003497. doi: 10.1161/CIRCOUTCOMES.116.003497.

9. Alpoim, P.N.; Gomes, K.B.; Pinheiro Mde, B.; Godoi, L.C.; Jardim, L.L.; Muniz, L.G.; Sandrim,

ur na

V.C.; Fernandes, A.P.; Dusse, L.M. Polymorphisms in endothelial nitric oxide synthase gene in early and late severe preeclampsia. Nitric Oxide 2014, 42, 19-23, doi: 10.1016/j.niox.2014.07.006.

Jo

10. Founds, S.A.; Dorman, J.S.; Conley, Y.P. Microarray technology applied to the complex disorder of preeclampsia. J Obstet Gynecol Neonatal Nurs 2008, 37,146-157, doi: 10.1111/j.1552-6909.2008.00232.x.

11. Leavey, K.; Bainbridge, S.A.; Cox, B.J. Large scale aggregate microarray analysis reveals three distinct molecular subclasses of human preeclampsia. PLoS One 2015, 10, e0116508, doi: 10.1371/journal.pone.0116508.

21

12. Liang, M.; Niu, J.; Zhang, L.; Deng, H.; Ma, J.; Zhou, W.; Duan, D.; Zhou, Y.; Xu, H.; Chen, L. Gene expression profiling reveals different molecular patterns in G-protein coupled receptor signaling pathways between early- and late-onset preeclampsia. Placenta 2016, 40, 52-59, doi: 10.1016/j.placenta.2016.02.015.

of

13. Than, N.G.; Romero, R.; Tarca, A.L.; Kekesi, K.A.; Xu, Y.; Xu, Z.; Juhasz, K.; Bhatti, G.; Leavitt, R.J.; Gelencser, Z.; Palhalmi, J.; … Papp Z. Integrated Systems Biology Approach

-p

1661, doi: 10.3389/fimmu.2018.01661. eCollection 2018.

ro

Identifies Novel Maternal and Placental Pathways of Preeclampsia. Front Immunol 2018, 8,

re

14. Founds, S.A.; Conley, Y.P.; Lyons-Weiler, J.F.; Jeyabalan, A.; Hogge, W.A.; Conrad, K.P. Altered global gene expression in first trimester placentas of women destined to develop

lP

preeclampsia. Placenta 2009, 30, 15-24, doi: 10.1016/j.placenta.2008.09.015.

ur na

15. Founds, S.A.; Terhorst, L.A.; Conrad, K.P.; Hogge, W.A.; Jeyabalan, A.; Conley, Y.P. Gene expression in first trimester preeclampsia placenta. Biol Res Nurs 2011, 13, 134-139, doi: 10.1177/1099800410385448.

Jo

16. Founds, S.A.; Fallert-Junecko, B.; Reinhart, T.A.; Conley, Y.P.; Parks, W.T. LAIR2 localizes specifically to sites of extravillous trophoblast invasion. Placenta 2010, 31, 880-885, doi: 10.1016/j.placenta.2010.07.005.

17. Founds, S.A.; Fallert-Junecko, B.; Reinhart, T.A.; Parks, W.T. LAIR2-expressing extravillous trophoblasts associate with maternal spiral arterioles undergoing physiologic conversion. Placenta 2013, 34, 248-255, doi: 10.1016/j.placenta.2012.09.017.

22

18. IPA, QIAGEN Inc., https://www.qiagenbioinformatics.com/products/ingenuitypathwayanalysis.

19. National Center for Biotechnology Information (NCBI) GENE

of

https://www.ncbi.nlm.nih.gov/gene

ro

20. Amigo http://amigo.geneontology.org/amigo/gene_product/UniProtKB:Q99814_NCBI 2018

-p

21. Carter, B.S.; Fletcher, J.S.; Thompson, R.C. Analysis of messenger RNA expression by in situ hybridization using RNA probes synthesized via in vitro transcription. Methods 2010, 52,

re

322-331, doi:10.1016/j.ymeth.2010.08.001.

lP

22. Chen, C-C.; Wada, K.; Jarvis, E.D. Radioactive in situ hybridization for detecting diverse gene expression patterns in tissue. Journal of Visualized Experiments : JoVE 2012, 62, 3764,

ur na

doi: 10.3791/3764.

23. Burton, G.J.; Jauniaux, E. The cytotrophoblastic shell and complications of pregnancy.

Jo

Placenta 2017, 60, 134-139, doi: 10.1016/j.placenta.2017.06.007.

24. Khong, T.Y.; De Wolf, F.; Robertson, W.B.; Brosens, I. Inadequate maternal vascular response to placentation in pregnancies complicated by pre-eclampsia and by small-forgestational age infants. Br J Obstet Gynaecol 1986, 93, 1049-1059.

25. Latendresse, G.; Founds, S. The fascinating and complex role of the placenta in pregnancy and fetal well-being. J Midwifery Womens Health 2015, 60, 360-370, doi: 10.1111/jmwh.12344.

23

26. Vento-Tormo, R.; Efremova, M.; Botting, R.A.; Turco, M.Y.; Vento-Tormo, M.; Meyer, K.B.; Park, J.E.; Stephenson, E.; Polański, K.; Goncalves, A.; …Teichmann, S.A. Single-cell reconstruction of the early maternal-fetal interface in humans. Nature 2018, 563, 347-353, doi: 10.1038/s41586-018-0698-6.

of

27. Suryawanshi, H.; Morozov, P.; Straus, A.; Sahasrabudhe, N.; Max, K.E.A.; Garzia, A.; Kustagi, M.; Tuschl, T.; Williams, Z. A single-cell survey of the hu man first-trimester placenta

ro

and decidua. Sci Adv 2018, 31, 4(10):eaau4788, doi: 10.1126/sciadv.aau4788. eCollection 2018

-p

Oct.

re

28. Sidis, Y.; Schneyer, A.L.; Keutmann, H.T. Heparin and activin-binding determinants in

lP

follistatin and FSTL3. Endocrinology 2005, 146,130-136.

29. Joseph, E.W.; Pratilas, C.A.; Poulikakos, P.I.; Tadi, M.; Wang, W.; Taylor B.S.; … Rosen, N.

ur na

The RAF inhibitor PLX4032 inhibits ERK signaling and tumor cell proliferation in a V600E BRAF-selective manner. Proc Natl Acad Sci USA 2010, 107, 14903-14908, doi: 10.1073/pnas.1008990107.

Jo

30. Biron-Shental ,T.; Schaiff, W.T.; Rimon, E.; Shim, T.L.; Nelson, D.M.; Sadovsky, Y. Hypoxia enhances the expression of follistatin-like 3 in term human trophoblasts. Placenta 2008, 29, 5157.

31. Xie, J.; Xu, Y.; Wan, L.; Wang, P.; Wang, M.; Dong, M. Involvement of follistatin-like 3 in preeclampsia. Biochem Biophys Res Commun 2018, 506, 692-697, doi: 10.1016/j.bbrc.2018.10.139.

24

32. Ferreira, G.D.; Capp, E.; Jauckus, J.; Strowitzki, T.; Germeyer, A. Expression of semaphorin class 3 is higher in the proliferative phase on the human endometrium. Arch Gynecol Obstet 2018, 297, 1175-1179, doi: 10.1007/s00404-018-4719-3.

33. Ciarmela, P.; Florio, P.; Toti, P.; Franchini, A.; Maguer-Satta, V.; Ginanneschi, C.; Ottaviani,

of

E.; Petraglia, F. Human placenta and fetal membranes express follistatin-related gene mRNA

ro

and protein. J Endocrinol Invest 2003, 26, 641-645.

34. Founds, S.A.; Ren, D.; Roberts, J.M.; Jeyabalan, A.; Powers, R.W. Follistatin-like 3 across

-p

gestation in preeclampsia and uncomplicated pregnancies among lean and obese women,

re

Reprod Sci 2015, 22, 402-409, doi: 10.1177/1933719114529372.

lP

35. Fagerberg, L.; Hallström, B.M.; Oksvold, P.; Kampf, C.; Djureinovic, D.; Odeberg, J;.... Uhlén, M. Analysis of the human tissue-specific e xpression by genome-wide integration of

ur na

transcriptomics and antibody-based proteomics. Mol Cell Proteomics 2014, 13, 397-406, doi: 10.1074/mcp.M113.035600, https://www.proteinatlas.org/ENSG00000075223SEMA3C/tissue/placenta#rnaseq.

36. Steunou, A.L.; Ducoux-Petit, M;. Lazar, I.; Monsarrat, B.; Erard, M.; Muller C.;… Nieto, L.

Jo

Identification of the hypoxia-inducible factor 2α nuclear interactome in melanoma cells reveals master proteins involved in melanoma development. Mol Cell Proteomics 2013, 12, 736-748, doi: 10.1074/mcp.M112.020727.

37. Kietzmann, T.; Samoylenko, A.; Roth, U.; Jungermann, K. Hypoxia-inducible factor-1 and hypoxia response elements mediate the induction of plasminogen activator inhibitor-1 gene expression by insulin in primary rat hepatocytes. Blood 2003, 101, 907-914.

25

38. Kusuma, S.; Zhao, S.; Gerecht, S. The extracellular matrix is a novel attribute of endothelial progenitors and of hypoxic mature endothelial cells. FASEB J 2012, 26, 4925-4936, doi: 10.1096/fj.12-209296.

39. Zhu, C.; Yu, J.; Pan, Q.; Yang, J.; Hao, G.; Wang, Y.; Li, L.; Cao, H. Hypoxia-inducible

of

factor-2 alpha promotes the proliferation of human placenta-derived mesenchymal stem cells

ro

through the MAPK/ERK signaling pathway, Sci Rep 2016, 6, 35489, doi: 10.1038/srep35489.

40. Datta, K.; Li, J.; Bhattacharya, R.; Gasparian, L.; Wang, E.; Mukhopadhyay, D. Protein

-p

kinase C zeta transactivates hypoxia-inducible factor alpha by promoting its association with

re

p300 in renal cancer. Cancer Res 2004, 64, 456-462.

lP

41. Chae, K.S.; Kang, M.J.; Lee, J.H.; Ryu, B.K.; Lee, M.G.; Her, N.G.; Ha, T.K.; Han, J.; Kim, Y.K.; Chi, S.G. Opposite functions of HIF-α isoforms in VEGF induction by TGF-β1 under non-

ur na

hypoxic conditions. Oncogene 2011, 30, 1213-1228.

42. Hu, C.J.; Wang, L.Y.; Chodosh, L.A.; Keith, B.; Simon, M.C. Differential roles of hypoxiainducible factor 1alpha (HIF-1alpha) and HIF-2alpha in hypoxic gene regulation. Mol Cell Biol

Jo

2003, 23, 9361–9374.

43. Genbacev, O.; Zhou, Y.; Ludlow, J.W.; Fisher, S.J. Regulation of human placental development by oxygen tension. Science 1997, 277, 1669–1672.

44. James, J.L.; Stone, P.R.; Chamley, L.W. The regulation of trophoblast differentiation by oxygen in the first trimester of pregnancy. Hum Reprod Update 2006, 12, 137-144.

26

45. Hsu, P.; Nanan, R.K.H. Innate and adaptive immune interactions at the fetal–maternal interface in healthy human pregnancy and pre-eclampsia. Frontiers in Immunology 2014, 5, 125. doi:10.3389/fimmu.2014.00125.

46. Gustafsson, C.; Mjösberg, J.; Matussek, A.; Geffers, R.; Matthiesen, L.; Berg, G.; Sharma,

for immunosuppressive phenotype. PLoS One 2008, 3, e2078, doi:

-p

ro

10.1371/journal.pone.0002078.

of

S.; Buer, J.; Ernerudh, J. Gene expression profiling of human decidual macrophages: Evidence

47. Lang, C.H.; Vary, T.C.; Frost, R.A. Acute in vivo elevation of insulin-like growth factor (IGF)

re

binding protein-1 decreases plasma free IGF-I and muscle protein synthesis. Endocrinology

lP

2003, 144, 3922-3933.

48. Fardini, Y.; Masson, E.; Boudah, O.; Ben Jouira, R.; Cosson, C.; Pierre-Eugene, C.; Kuo,

ur na

M.S.; Issad, T. O-glcNacylation of FoxO1 in pancreatic β cells promotes Akt inhibition through an IGFBP1-mediated autocrine mechanism. FASEB J 2014, 28, 1010-1021, doi: 10.1096/fj.13238378.

Jo

49. Ziegelbauer, J.; Wei, J.; Tjian, R. Myc-interacting protein 1 target gene profile: a link to microtubules, extracellular signal-regulated kinase, and cell growth. Proc Natl Acad Sci USA 2004, 101, 458-463.

27 50. Leu, J.I.; Crissey, M.A.; Taub, R. Massive hepatic apoptosis associated with TGF-beta1 activation after Fas ligand treatment of IGF binding protein-1-deficient mice. J Clin Invest 2003, 111, 129-139.

51. Ammoun, S.; Schmid, M.C.; Zhou, L.; Ristic, N.; Ercolano, E.; Hilton, D.A.; Perks, C.M.; Hanemann, C.O. Insulin-like growth factor-binding protein-1 (IGFBP-1) regulates human

of

schwannoma proliferation, adhesion and survival. Oncogene 2012, 31, 1710-1722.

ro

52. Lindgren, B.F.; Jacobson, S.H.; Brismar, K. Insulin-glucose infusion given before

-p

hemodialysis increases IGF-I in type 2 diabetes patients with chronic kidney disease. Growth

re

Horm IGF Res 2010, 20, 422-426.

53. Cichy, S.B.; Uddin, S.; Danilkovich, A.; Guo, S.; Klippel, A.; Unterman, T.G. Protein kinase

lP

B/Akt mediates effects of insulin on hepatic insulin-like growth factor-binding protein-1 gene expression through a conserved insulin response sequence. J Biol Chem 1998, 273, 6482-

ur na

6487.

54. Zhou, J. Bondy, Insulin-like growth factor-II and its binding proteins in placental

Jo

development. Endocrinology 1992, 131, 1230-1240.

55. Brewer, M.T.; Stetler, G.L.; Squires, C.H.; Thompson, R.C.; Busby, W.H.; Clemmons, D.R. Cloning, characterization, and expression of a human insulin-like growth factor binding protein, Biochem Biophys Res Commun 1988, 152, 1289-1297. Erratum in Biochem Biophys Res Commun 1988, 155, 1485.

28 56. Brinkman, A.; Groffen, C.; Kortleve, D.J.; Geurts, A.; van Kessel, S.L. Drop, isolation and characterization of a cDNA encoding the low molecular weight insulin-like growth factor binding protein (IBP-1). EMBO J 1988, 7, 2417-2423.

57. Koistinen, R.; Kalkkinen, N.; Huhtala, M.L;. Seppälä, M.; Bohn, H.; Rutanen, E.M. Placental protein 12 is a decidual protein that binds somatomedin and has an identical N-terminal amino

of

acid sequence with somatomedin-binding protein from human amniotic fluid. Endocrinology

ro

1986, 118, 1375-1378.

58. Vinketova, K.; Mourdjeva, M.; Oreshkova, T. Human decidual stromal cells as a component

-p

of the implantation niche and a modulator of maternal immunity. J Pregnancy 2016,

re

2016:8689436, doi: 10.1155/2016/8689436.

lP

59. Baergen, R.N.; Benirschke, K. Manual of Pathology of the Human Placenta, Second Ed.;

ur na

Springer: New York, 2011, ISBN-13: 978-1441974938.

60. Benirschke, K.; Kaufmann, P.; Baergen, R.N. Pathology of the Human Placenta, Fifth Ed.; Springer: New York, 2006, ISBN-13: 978-0387267388.

Jo

61. Goustin, A.S.; Betsholtz, C.; Pfeifer-Ohlsson, S.; Persson, H.; Rydnert, J.; Bywater, M.; Holmgren, G.; Heldin, C.H.; Westermark, B.; Ohlsson, R. Coexpression of the sis and myc proto-oncogenes in developing human placenta suggests autocrine control of trophoblast growth. Cell 1985, 41,301-312.

29 62. Fallert, B.A.; Reinhart, T.A. Improved detection of simian immunodeficiency virus RNA by in situ hybridization in fixed tissue sections: Combined effects of temperatures for tissue fixation and probe hybridization. J Virol Methods 2002, 99, 23-32.

63. Apps, R.; Sharkey, A.; Gardner, L.; Male, V.; Trotter, M.; Miller, N.; North, R.; Founds, S.; Moffett, A. Genome-wide expression profile of first trimester villous and extravillous human

of

trophoblast cells. Placenta 2011, 32, 33-43, doi: 10.1016/j.placenta.2010.10.010.

ro

64. Founds, S. Systems biology for nursing in the era of big data and precision health.

Jo

ur na

lP

re

-p

Nurs Outlook 2018, 66, 283-292, doi: 10.1016/j.outlook.2017.11.006.

30 Figure Caption

Figure 1. Examples of silver grain background staining. Bright field images depict equivalence of background staining between sections of EPAS1 sense control (A) compared to EPAS1 antisense signal (B) and between SEMA3C sense control (C) versus anti-sense signal (D). Black

of

staining indicates positive target expression signal. Original magnification 200x, A-D.

Figure 2. EPAS1: representative images and graphical plots of gene expression summary data.

ro

In these examples, cells forming an anchoring cell column in center-left of panels A and B

(outlined in B) highly expressed EPAS1. White staining in dark field images and black staining in

-p

bright field images indicate positive target expression signal. Antigen staining with EPAS-1 in

re

brown (C) supported cell type identification in ISH images, such as cells in the anchoring cell columns (arrows) and cell islands (arrowhead). Areas of decidua demonstrated diffusely

lP

distributed silver grains, as well as higher densities in discrete cells (e.g. arrow, E). IHC staining of EPAS-1 occurred in some decidual cells (F). The binary area fraction of EPAS1 varied by cell type (G) and by gestational age in maternal and fetoplacental tissues (H). Abbreviations in

ur na

plots, Figures 2-5: background (BGD), villous stroma (VS), villous trophoblast (TB), anchoring cell column (ACC), decidua with low, medium, or high expression (D-L, D-M, D-H; definitions in Methods/Materials).

Jo

Figure 3. FSTL3: representative images and graphical plots of gene expression summary data. Villous trophoblast expressed FSTL3 (A, B) in ISH silver grains. White staining in dark field images and black staining in bright field images indicate positive target expression signal. FSTL3 staining (brown DAB) supported identification cells types identified in ISH images (C). The areas of decidua in the upper half to right side of D and E demonstrated diffusely distributed ISH silver grains (D, E) and a spiral artery (arrowhead, E). The lower left cluster of high density silver

31 grains occurred in trophoblast adjacent to the border of the decidua (D, E) (arrow, E). Mild FSTL-3 antigen staining occurred in the decidua with moderate staining in the endometrial gland which extends from the lower left through center to right in this image (arrow, F); whereas strong IHC occurred in the trophoblast cell island located in the lower right (arrowhead, F). The binary area fraction of FSTL3 varied by cell type (G) and may increase by gestational age in

of

fetoplacental cells (H).

ro

Figure 4. IGFBP1: representative images and graphical plots of gene expression summary

data. Low to moderate silver grain densities in the villous trophoblast at the right contrast with

-p

strong signals in decidua on the left (A, B) (arrow to decidua, B). White staining in dark field images and black staining in bright field images indicate positive target expression signal.

re

Trophoblast stained with IGFBP-1 in brown supports cell type identification in the ISH images.

lP

Decidual ISH was very dense in some cells and diffuse throughout this tissue (D, E). Decidua staining with IGFBP-1 also complements ISH cell type identifcation (F). The binary area fraction

ur na

of IGFBP1 varied by cell type (G) and may increase in decidua by gestational age (H).

Figure 5. SEMA3C: representative images and graphical plots of gene expression summary data. Villous trophoblast stained with varied densities in ISH (A, B). White staining in dark field

Jo

images and black staining in bright field images indicate positive target expression signal. SEMA-3C stained brown in villous trophoblast, villous stroma, and fibrinoid (arrowhead; extracellular matrix), lending support to the interpretation of cell types in the ISH images (C). Images of decidua included some villous trophoblast on the left hand side (D, E) (arrow, E). Silver grains were diffusely distributed in decidua, but high density in some trophoblast. SEMA-

32 3C stained diffusely in decidua, similar to the ISH signals (F). The binary area fraction of SEMA3C varied by cell type (G) and increased by gestational age in fetoplacental cells (H).

Figure 6. Network of molecular interactions in the Cellular Movement-Reproductive System

of

Development-Cell Morphology, depicting potential functional relationships among the candidate

Jo

ur na

lP

re

-p

ro

genes of interest (circled).14,15,18

of

ro

-p

re

lP

ur na

Jo

33

Fig 1

of

ro

-p

re

lP

ur na

Jo

34

Fig 2

of

ro

-p

re

lP

ur na

Jo

35

Fig 3

of

ro

-p

re

lP

ur na

Jo

36

Fig 4

of

ro

-p

re

lP

ur na

Jo

37

Fig 5

of

ro

-p

re

lP

ur na

Jo

38

Fig 6

39

Table 1. Candidate genes in a functional network18 Gene Name

Gene

Locus

Description of Biological Process19,20

2p21

Transcription factor involved in the induction of

Symbol Endothelial PAS

EPAS1

domain protein 1

genes regulated by oxygen reduction FSTL3

19p13.3

Negative regulation of BMP signaling pathway

Insulin-like growth

IGFBP1

7p12.3

Regulation of cell growth; signal transduction

LAIR2

19q13.4

Protein binding

of

Follistatin-like 3

Leukocyte-associated

ro

factor binding protein 1

-p

immunoglobulin-like

Sema domain,

re

receptor 2 SEMA3C 7q21.11

domain (Ig), short basic

ur na

domain, secreted,

protein tyrosine kinase signaling pathway;

lP

immunoglobulin

Jo

(semaphorin) 3C

Immune response; transmembrane receptor

development; response to drug

40 Table 2. cDNA and Primer sets for ISH MGC Human cDNA

Catalog number

Oligo Sequence

Days Hybridized

(forward; reverse) MHS6278-

ATGACAGCTGACAAGGAGAA

(CloneId:6305604)

202833305

GAAGAAGTCCCGCTCTGTGG

FSTL3

MHS6278-

TCTCTGCGTTCGCCATGCGT

(CloneId:2962889)

202826560

AGCGGCCCCGGTACATGA

IGFBP1

MHS6278-

ATGTCAGAGGTCCCCGTTG

(CloneId:30337849)

202806064

GGTGACATGGAGAGCCTTC

SEMA3C

MHS6278-

ATGGCATTCCGGACAATTTG

(CloneId:4824598)

202807144

AGAGCAGCGTCCTTTTCCAGA

ro

-p

re lP ur na Jo

21

21

of

EPAS1

14

28

41 Table 3. Antibodies for IHC of protein encoded by each candidate gene Company

Catalog

Description

number

tissues *

dilution 1:1000

CD

CABT-

Mouse anti-human

Bone, colon,

Creative

50495MH

monoclonal antibody

Fallopian tube,

Diagnostics FSTL-3

Optimized

placenta, tonsil

CD

DPABH-

Rabbit anti-human

Colon, Fallopian

Creative

08873

polyclonal antibody

tube, placenta,

Diagnostics

spleen, tonsil

abx104395

Rabbit anti-human

1:50

Bone, colon,

1:10

Placenta, spleen

-p

IGFBP-1 ABBEXA

1:10

of

EPAS-1

Positive control

ro

Antigen

polyclonal antibody CD

DPABH-

Rabbit anti-human

3C

Creative

26444

polyclonal antibody

re

SEMA-

Jo

ur na

* https://www.proteinatlas.org/

lP

Diagnostics

Fallopian tube, placenta, tonsil

42

Table 4. Descriptive data of relative gene expression per target Gene

EPAS1 FSTL3 IGFBP1 SEMA3C

N Regions of interest selected 863

594

956

716

.011

.003

.004

.003

Std. Deviation

.007

.005

.007

.003

Minimum

< .001

< .001

< .001

< .001

Maximum

.031

.028

.040

.023

Median

.011

.001

.001

.002

.0001

< .001

-p

re

Percentiles 25th .005

ro

Mean

.001

.001

.001

.002

75th .016

.004

.003

.003

< .001

< .001

< .001

lP

50th (Median) .011

Shapiro-Wilk p-value

< .001

Jo

ur na

* Proportion of area in px2 with positive ISH staining

of

Binary area fraction *

43

Table 5. Relative gene expression by cell type Median Binary Area Fraction IGFBP1 SEMA3C

.001

< .001

< .001

.001

Villous stroma

.006

< .001

< .001

.001

Villous trophoblast

.014

.002

.001

.002

Anchoring cell column

.022

.017

.001

.010

Decidua low expression *

.006

.001

.001

.001

Decidua medium expression *

.012

---

.005

Decidua high expression *

.017

---

< .001

< .001

* See text for criteria

---

< .001

< .001

ur na

lP

--- No regions of interest with mRNA expression signal

Jo

.004

.020

re

Kruskal-Wallis p-value

ro

Background

-p

EPAS1 FSTL3

of

Cell typed by location