Gene expression of selenoproteins can be regulated by thioredoxin(Txn) silence in chicken cardiomyocytes

Journal of Inorganic Biochemistry 177 (2017) 118–126

Contents lists available at ScienceDirect

Journal of Inorganic Biochemistry journal homepage: www.elsevier.com/locate/jinorgbio

Gene expression of selenoproteins can be regulated by thioredoxin(Txn) silence in chicken cardiomyocytes☆

MARK

Jie Yang, Sattar Hamid, Qi Liu, Jingzeng Cai, Shiwen Xu⁎, Ziwei Zhang⁎ College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, PR China

A R T I C L E I N F O

A B S T R A C T

Keywords: Thioredoxin (Txn) RNA interference Chicken cardiomyocytes Selenoproteins

Thioredoxin (Txn) system is the most crucial antioxidant defense mechanism in myocardium. The aim of this study was to clarify the effect of Txn low expression on 25 selenoproteins in chicken cardiomyocytes. We developed a Se-deficient model (0.033 mg/kg) and Txn knock down cardiomyocytes model (siRNA) studies. Western Blot, Quantitative Real-time PCR (qPCR) were performed, and correlation analysis, heat map were used for further analysis. Both low expression of Txn models are significantly decreased (P < 0.05) the mRNA levels of Deiodinase 1, 2 (Dio 1, 2), Glutathione Peroxidase 1, 2, 3, 4 (Gpx 1, 2, 3, 4), Thioredoxin Reductase 1, 2, 3 (TR 1, 2, 3), Selenoprotein t (Selt), Selenoprotein w (Selw), Selenoprotein k (Selk), selenoprotein x1 (Sepx1), and significantly increased (P < 0.05) the mRNA levels of the rest of selenoproteins. Correlation analysis showed that Deiodinase 3 (Dio 3), Selenoprotein m (Selm), 15-kDa Selenoprotein (Selp15), Selenoprotein h (Selh), Selenoprotein u (Selu), Selenoprotein i (Seli), Selenoprotein n (Seln), Selenoprotein p1 (Sepp1), Selenoprotein o (Selo), Selenoprotein s (Sels), Selenoprotein synthetase 2 (Sels2) and Selenoprotein p (Selp) had a negative correlation with Txn, while the rest of selenoproteins had a positive correlation with Txn. Combined in vivo and in vitro we can know that hamper Txn expression can inhibit Gpx 1, 2, 3, 4, TR 1, 2, 3, Dio 1, 2, Selt, Selw, Selk, Sepx1, meanwhile, over expression the rest of selenoproteins. In conclusion, the different selenoproteins possess and exhibit distinct responses to silence of Txn in chicken cardiomyocytes.

1. Introduction The heart is an important organ in the body, abnormal heart function will cause organisms to become diseased. In a previous research, we had known that reduction-oxidation (redox) responses, as an important biological phenomenon, are participated in the occurrence and development for various diseases [1,2]. Selenium (Se) is known for its antioxidant, anti-inflammatory, chemo-preventive and antiviral properties [3], Se was involved in selenoproteins synthesis and there are 25 Selenoproteins that had been proved in chickens. Our lab has done a lot of research on Se deficiency, in our previous study, we had confirmed that Se deficiency can cause oxidative stress in different organs, including chicken myoblasts [4], immune organ [5], liver [6], pancreatic [7], digestive system [8], and also proved that Se deficiency can caused chickens cardiomyocytes oxidative stress [9]. Keshan Disease is the first reported case in human, it was backed in 1937 during an epidemic in some rural areas of China, which has been shown that it's associated with Se deficiency [10]. Changing in Se content can cause myocardial injury and reversible in human [11,12]. Zhang's study indicated that Se

☆ ⁎

deficiency led to the damage of mitochondrial structure and function in rats, resulting in heart failure [13]. In some articles, it has been shown that there is a close relationship between Se deficiency and cardiovascular disease [14,15]. Thus Se deficiency can cause cardiac tissue injury is an indisputable fact. In former study, we have successfully established Se deficiency in chicken myocardial injury model, and confirmed that Se deficiency can lead to apoptosis of heart [16]. Thioredoxin (Txn), a kind of small protein (about 12 KDa), is ubiquitous in prokaryotic and eukaryotic organisms, it exist in the form of heat stable proteins as hydrogen carriers [17], and has redox-sensitive cysteine residues, formed two sulfur bond (-S-S-) reversibly, which makes that Txn can be oxidized and reduced in the presence of two forms [18], that is why Txn can play antioxygenation in the body. Txn plays its antioxidant function that must be under the assistant of thioredoxin reductase (TR), that is thought to be the only enzyme to deoxidize the oxidative Txn [19]. Txn, TR and Nicotinamide Adenine Dinucleotide Phosphate (NADPH) constitute the Txn system [20], which is a very important antioxidant system in the process of antioxidation. Drechsel's study revealed that Txn system plays a decisive

All authors have read the manuscript and agreed to submit it in its current form for consideration for publication in the Journal. Corresponding authors. E-mail addresses: [email protected] (S. Xu), [email protected] (Z. Zhang).

http://dx.doi.org/10.1016/j.jinorgbio.2017.08.027 Received 10 June 2017; Received in revised form 28 August 2017; Accepted 30 August 2017 Available online 04 September 2017 0162-0134/ © 2017 Elsevier Inc. All rights reserved.

Journal of Inorganic Biochemistry 177 (2017) 118–126

J. Yang et al.

at into 37 °C, 5% CO2 adherent culture box for 48 h.

role in inhibiting and eliminating reactive oxygen species (ROS) for intracellular oxidative damage [21]. Txn can deglutathionylate proteins in the presence of high levels of Oxidized Glutathione (GSSG) in conditions of oxidative stress, which will protect against reperfusion injury in mice [22], and inhibition of endogenous thioredoxin-1 in the heart of transgenic mice does not confer cardio-protection in ischemic postconditioning [23], in addition, Txn plays its important role in protecting myocardium by scavenging the excess oxygen radical, repairing the oxidized matrix protein, regulating the activity of transcription factors, inhibiting apoptosis and regulating intracellular redox balance [24], all of these are confirmed that Txn plays a vital role in the protection for some peroxidating-diseases. That Txn, as an important antioxidant, can regulate oxidative stress had been proved [25,26], which demonstrated that Txn and Se play similar physiological roles in living. Besides, Se exerts its biological function through the biosynthesis of Selenoproteins, and Se-deficiency can reduce the expression of selenoproteins in different organs, especially the expression of TR (TR1, TR2, TR3) had significantly decreased [27–29]. TR (TR1, TR2, TR3), act as an important part of Txn system, play a crucial role in redox reactions, which proved that Se-deficiency could impede the normal function of Txn system. As equally important antioxidant system, Txn system and selenoproteins, there must be a close relationship, however, less report about their mutual relation was be submitted. We developed a Se-deficient induced myocardial injury model (0.033 mg/kg) for in-vivo and Txn knock down cardiomyocytes culture model (siRNA) for in-vitro studies. The aim of this present study was to clarify the effect of Se deficiency induced Txn low expression in chicken myocardium and Txn knock down in chicken cardiomyocytes for 25 selenoproteins.

2.3. Established the Txn knock down model Cardiomyocyte attain 80% confluence after about 48 h of incubation. In chicken cardiomyocyte primary culture, Txn was knockeddown using siRNA(sense 5′-CCAAGAUGUUGCUACACACUGUGAU-3′, anti-sense 5′-AUCACAGUGUGUAGCAACAUCUUGG-3′. Subsequent to two times wash with opti-MeM (pre-temperature). All cells were randomly divided into two groups, N (normal group) and KD (knock down group). Normal cells were treated with 2 mL of Opti-MEM (Invitrogen). Knock down group cells were transfected with 3 μL of 20 μM siRNAs, 3 μL of Lipofectamine RNAi MAX Reagent (Invitrogen) in 2 mL of OptiMEM. Post-transfection for approximately 48 h, the cells were harvested for analysis.

2.4. Determination of the protein expression of Txn For total protein extraction, protein lysis solutions were subjected to 15% SDS-polyacrylamide gel electrophoresis under reducing conditions. The separated proteins were then transferred to nitrocellulose membrane for 2 h at 100 mA in a tank transfer apparatus containing Tris-glycine buffer and 20% methanol. Membrane was blocked with 5% skim milk for 24 h and incubated overnight with diluted primary antibodies against Txn (1:1000, Proteintech, China),

2.5. Determination of the mRNA expression of Txn and selenoproteins

2. Materials and methods

Total RNA was isolated from heart tissues and cardiomyocytes by using Trizol reagent according to the manufacturer's instructions (Roche, Basel, Switzerland). The dried RNA pellets were re-suspended in 50 μL of diethyl-pyrocarbonatetreated water. The concentration and purity of the total RNA was determined through spectrophotometer. cDNA was synthesized from 5 μg of the total RNA using oligo dT primers and Superscript II reverse transcriptase according to the manufacturer's instructions (Promega, Beijing, China). cDNA was diluted at a ratio of 1:5 with sterile water and stored at −80 °C. Primer Premier Software (PREMIER Biosoft International, USA) was used to design specific primers for Txn, Deiodinase 1, 2, 3 (Dio1, Dio2, Dio3), Glutathione Peroxidase 1, 2, 3, 4 (Gpx1, Gpx2, Gpx3, Gpx4), TR1, TR2, TR3, Selenoprotein t (Selt), Selenoprotein w (Selw), Selenoprotein k (Selk), and Sepx1, Selenoprotein m (Selm), 15-kDa Selenoprotein (Selp15), Selenoprotein h (Selh), Selenoprotein u (Selu), Selenoprotein i (Seli), Selenoprotein n (Seln), Selenoprotein p1 (Sepp1), Selenoprotein o (Selo), Selenoprotein s (Sels), Selenoprotein synthetase 2 (Sels2), Selenoprotein p (Selp), β-actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), based on known chicken sequences (Table 1). General PCR was first performed to confirm the specificity of the primers. Quantitative real-time PCR (qPCR) was performed with a Roche detection system (Applied Biosystems, Foster City, CA). Reactions were performed in a 20 μL reaction mixture containing 10 μL of the 2 × SYBR Green I PCR Master Mix (Roche, Basel, Switzerland), 2 μL cDNA, 0.4 μL of each primer (10 μM), 0.4 μL of 50 × ROX reference Dye II and 6.8 μL of PCR grade water. The PCR procedure for Txn Dio1, Dio2, Dio3, Gpx1, Gpx2, Gpx3, Gpx4, TR1, TR2, TR3, Selt, Selw, SelK, and Sepx1, Selm, Selp15, Selh, Selu, Seli, Seln, Sepp1, SelO, Sels, SelS2, Selp, β-actin and GAPDH consisted of 95 C for 30 s followed by 40 cycles of 95 C for 15 s, 60 C for 30 s and 60 C for 30 s. For each PCR reaction, Dissociation Curve 1.0 Software (Applied Biosystems) was used to analyze Dissociation curves in order to detect and eliminate possible primer-dimers and non-specific amplification. The relative abundance of each mRNA was calculated according to the method of Pfaffl. (Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45.)

All procedures used in this experiment were approved by the Institutional Animal Care and Use Committee of Northeast Agricultural University. 2.1. Se deficiency muscular dystrophy chicken models replicated One hundred and eighty one-day-old chickens, (Weiwei Co. Ltd., Harbin, China), were randomly divided into two groups, C and L (90 chickens/group). They were maintained either on a Se-sufficient diet (C group) containing 0.23 mg/kg or Se-deficient diet (L group) containing 0.033 mg/kg, for 25 days. Composition of Se deficient feed and detail process for establishing the Se-deficiency model had been described by our group [16]. 2.2. Primary cardiomyocytes culture Twelve days old chicken embryos were used to obtain primary cardiomyocytes for culture. Subsequent to surface disinfection (use 75% alcohol), chest was dissected to collect the apical portion of pericardium (about 1/3 heart), immediately transferred to phosphate buffered solution (PBS) (4 °C) and washed to remove fat, connective tissue and blood clots. Later, the myocardial tissue was cut into small pieces and washed 3 times using PBS. After, enzymatic digestion with collagenase-II (0.1 g %) for 15 min in a constant temperature magnetic stirrer (37 °C, 100 r/min) for assimilation, centrifugation, an equal volume of Dulbecco's Modified Eagle Medium (DMEM)/F12 containing 10% fetal bovine serum and 1× mycillin was added to terminate digestion. Pellet was redigested until the small tissue fragments are completely digested. All supernatant was collected with 300 mesh and 500 mesh filter respectively. The cell suspension was centrifuged at 600 rpm for 5 min and resuspended in DMEM/F12 two times, in disposable Petri dishes for differential adhesion (the first is 1 h, second is 1.5 h). Non-adherent cells (cardiomyocytes) were collected, centrifuged at 600 rpm, counted, plated in 6-well plates at 3 × 105 and incubated 119

Journal of Inorganic Biochemistry 177 (2017) 118–126

J. Yang et al.

Table 1 The primers used in the present study. Gene

Forward primer(5′-3′)

Reverse primer(5′-3′)

Txn GPX1 GPX2 GPX3 GPX4 TR1 TR2 TR3 Dio1 Dio2 Dio3 Sepn Selk Sels Sepw Selt Selh Selm Sep15 Seli Selu Selpb Sepp1 SelO Sepx1 SPS2 β-actin GAPDH

TGATGTGGTGTTCATTGAAATTGA ACGGCGCATCTTCCAAAG ACGGCACCAACGAGGAGAT CCTGCAGTACCTCGAACTGA CTTCGTCTGCATCATCACCAA TACGCCTCTGGGAAATTCGT GCTCTTAAAGATGCCCAGCACTAC CCTGGCAAAACGCTAGTTGTG GCGCTATACCACAGGCAGTA ATTTGCTGATCACGCTTCAG CTGTGCATTCGCAAGAAGAT CAGGATCCATGCTGAGTTCCA GAAGAGGGCCTCCAGGAAAT GCGTCGCCATCTATCTCATCGT TGGTGTGGGTCTGCTTTACG AGGAG TACAT GCGGG TCATCA CATCGAGCACTGCCGTAG AAGAAGGACCACCCAGACCT ACTTGGCTTCTCCAGTAACTTGCT TGCCAGCCTCTGAACTGGAT GATGCTTTCAGGCTTCTTCC AGGCCAACAGTACCATGGAG CCAAGTGGTCAGCATTCACATC CCAGCGTTAACCGGAATGAT TGGCAAGTGTGGCAATGG CGTTGGGTATCGGAACTGAC CCGCTCTATGAA GGCTACGC AGAACATCATCCCAGCGT

GGCATGCACTTCACATCACAGT TGTTCCCCCAACCATTTCTC TTCAGGTAGGCGAAGACGG CTTCAGTGCAGGGAG GATCT TCGACGAGCTGAGTGTAATTCAC CTTGCAAGGCTTGTCCCAGTA GAACAGCTTGAGCCATCACAGA CGCACCATTACTGTGACATCTAGAC GGTCTTGCAAATGTCACCAC GCTCAGAAACAGCACCATGT GCCGACTTGAAGAAGTCCAG GAGAGGACGATGTAACCCGTAAAC CAGCCATTGGTGGTGGACTAG TCTTCTGCCTTCGCTTCTGTTCTT CCAAAGCTGGAAGGTGCAA GACAGACAGGAAGGATGCTATGTG GACACCTCGAAGCTGTTCCT GCTGTCCTGTCTCCCTC ATC GCCTACAGAATGGATCCAACTGA TGCAAACCCAGACATCACCAT CTGTCTTCCTGCTCCAATCA GTGGTGAGGATGGAGATGGT ATGACGACCACCCTCACGAT ATGCGCCTCCTGGATTTCT GAATTTGAGCGAGCTGCTGAAT CGTCCACCAGAGGGTAGAAA CTCTCG GCTGTGGTGGTGAA AGCCTTCACTACCCTCTTG

2.6. Statistical analysis Statistical analyses were performed using GraphPad Prism 5.0 software, and all data was assessed using one-way ANOVA. Mean comparisons were conducted by using a Bonferroni t-test when the main effect was significant, where P b 0.05 was considered a statistically significant difference. In addition Correlation analysis was used to determine the relationship between individual variations using GraphPad Software Prism 5 (version 5.01, GraphPad Software, Inc., La Jolla, USA). Ranking of genes by degree of differential expression of selenoproteins was analyzed with a heat map using the R Programming Language version 3.2.1. 3. Results

Fig. 1. Effects of Se deficiency on the mRNA levels of Txn, TR1, TR2, and TR3 genes in Cardiomyocytes. The results were calculated from at least three independent experiments, n = 3. The data are expressed as the means ± SD. C indicates the control groups; L indicates the Se deficiency groups, * shows significant difference from the corresponding control (P < 0.05).

3.1. Development of Se deficient model Successful establishment of Se deficiency model was confirmed subsequent to the onset of typical exudative diathesis (ED), the mRNA and protein levels of the Txn were significantly decreased (P < 0.05) in L group (Figs. 1 and 2), Compared to C group, the mRNA and protein levels were decreased by 74% and 60% respectively.

Fig. 2. Effects of Se deficiency on the protein levels of Txn genes in Cardiomyocytes. C indicates the control groups; L indicates the Se deficiency groups. β-actin was selected as the reference, * shows significant difference from the corresponding control (P < 0.05) n = 3.

120

Journal of Inorganic Biochemistry 177 (2017) 118–126

J. Yang et al.

3.3. mRNA expression of selenoproteins in cardiomyocytes and heart tissues Effects of Txn knock down on mRNA abundance of selenoproteins (Dio1, Dio2, Dio3, Gpx1, Gpx2, Gpx3, Gpx4, TR1, TR2, TR3, Selt, Selw, Selk, and Sepx1, Selm, Selp15, Selh, Selu, Seli, Seln, Sepp1, Selo, Sels, Sels2, Selp) in chicken cardiomyocytes are shown (Fig. 5), qPCR results revealed that mRNA expression of Dio1, Dio2, Gpx1, Gpx2, Gpx3, Gpx4, TR1, TR2, TR3, Selt, Selw, Selk, and Sepx1 significantly decreased (P < 0.05), and Dio3, Selm, Selp15, Selh, Selu, Seli, Seln, Sepp1, Selo, Sels, Sels2 and Selp significantly increased (P < 0.05) in KD group compared to N group. Effects of Se deficiency on mRNA abundance of selenoproteins in chicken heart tissue are shown (Fig. 6), qPCR results revealed the same results with chicken cardiomyocytes. 3.4. Correlation analysis Fig. 3. Effects of Txn knock down on the mRNA levels of Txn, TR1, TR2, and TR3 genes in Cardiomyocytes. The results were calculated from at least three independent experiments, n = 3. The data are expressed as the means ± SD. N indicates the normal groups; KD indicates the knock down groups, * shows significant difference from the corresponding normal (P < 0.05).

Correlation analysis (Tables 2, 3), exhibit a highly positive correlation among Txn and selenoproteins sets, separately, the expression levels of Dio1, Dio2, Gpx1, Gpx2, Gpx3, Gpx4, TR1, TR2, TR3, Selt, Selw, SelK and Sepx1 had a positive correlation with Txn, and the expression levels of Dio3, Selm, Selp15, Selh, Selu, Seli, Seln, Sepp1, Selo, Sels, Sels2 and Selp had a negative correlation with that of Txn. 3.5. Heat map analysis Heat map (Fig. 7) results revealed that Dio1, Dio2, Gpx1, Gpx2, Gpx3, Gpx4, TR1, TR2, TR3, Selt, Selw, Selk, Sepx1 have a low expression, and Dio3, Selm, Selp15, Selh, Selu, Seli, Seln, Sepp1, Selo, Sels, Sels2 Selp have a high expression in Se-deficient chicken heart and Txn knock down cardiomyocytes. 4. Discussion Selenium (Se) is well established as an essential trace mineral of fundamental importance for normal physiological processes in living organism, Se exerts its physiological role through the synthesis of selenoproteins, till now, there are 24 selenoproteins genes in rodents, 25 selenoproteins in human and birds, 38 selenoproteins genes in zebra fish have been identified [30]. Selenocysteine (Sec) as an important amino acid was involved in the synthesis of Se. Selenoproteins were classified into two major categories, C terminus-selenoproteins (TR1, TR2, TR3, Seli, Selk, Selo and Sels) and the N terminus-selenoproteins (Gpx1, Gpx, Gpx3, Gpx4, Dio1, Dio2, Dio3, Selh, Selm, Seln, Selt, Sepw, Sels2, and Selp15), depending on the Sec location in C terminus or N terminus [31]. In our previous study, we have done a lot of research work about the effects of Se-deficiency on selenoprotein expression in different chicken organs and cells, and we had known that the mRNA expression levels of the selenoproteins were generally decreased by Se deficiency in immune organ [32], adipose tissue [33], neutrophils [34],

Fig. 4. Effects of Txn knock down on the protein levels of Txn genes in Cardiomyocytes. N indicates the normal groups; KD indicates the knock down groups. β-actin was selected as the reference, * shows significant difference from the corresponding normal (P < 0.05) n = 3.

3.2. Txn knock down experimental model development Successful establishment of Txn knock down model was confirmed subsequent to the significantly decreased gene expression. In the Txn knock down cardiomyocytes the gene of Txn was significantly decreased (P < 0.05) in KD group both protein and mRNA levels (Figs. 3 and 4). Compared to N group, the mRNA and protein levels were decreased by 75% and 78% respectively.

Fig. 5. Effects of Txn knock down on the mRNA levels of 25 selenoproteins in Cardiomyocytes. The results were calculated from at least three independent experiments, n = 3. The data are expressed as the means ± SD. N indicates the normal groups; KD indicates the knock down groups, * shows significant difference from the corresponding normal (P < 0.05).

121

Journal of Inorganic Biochemistry 177 (2017) 118–126

J. Yang et al.

Fig. 6. Effects of Se deficiency on the mRNA levels of 25 selenoproteins in heart tissue. The results were calculated from at least three independent experiments, n = 3. The data are expressed as the means ± SD. C indicates the control groups; L indicates the Se deficiency groups, * shows significant difference from the corresponding control (P < 0.05).

vitro, we detected the expression of selenoproteins respectively. Our results revealed, combine in vivo and in vitro, that hamper Txn expression can inhibit the expression of Gpx1, Gpx2, Gpx3, Gpx4 TR1, TR2, TR3 Dio1, Dio2, Selt, Selw, Selk, Sepx1, meanwhile, over expression of Dio3, Selm, Selp15, Selh, Selu, Seli, Seln, Sepp1, Selo, Sels, Sels2 and Selp. Selenoproteins, as vital form of Se, play its antioxidant function, Gpx (Gpx1, Gpx2, Gpx3, Gpx4) can catalyze GSH into GSSG, which can protect the cell membrane from oxide and damage through transfer of the toxic peroxide reduction into hydroxyl compounds nontoxic. TR(TR1, TR2, TR3), are important selenoproteins, is also an important member of the Txn system, plays an irreplaceable role in maintaining the redox balance of the body. It has been reported that Se can influence the metabolism of tetraiodothyronine(T4) to riiodothyronine(T3) by the Dios(Dio1, Dio2, Dio3) [54], which agrees with our former research in chicken thyroids [55]. That Selw, SelK as important selenoprotein, can prevent oxidative stress has been confirmed [56,57], which indicated that they may play similar roles with Txn in the metabolism of chicken heart. As for those selenoproteins that with the decrease of Txn increased significantly, probably because they bear different biological functions in the body, at least there is negative adjustment relationship between them. Our correlation analysis also supported this results, which illustrates that Dio1, Dio2, Gpx1, Gpx2, Gpx3, Gpx4, TR1, TR2, TR3, Selt, Selw, SelK and Sepx1 had a positive correlation with Txn, while Dio3, Selm, Selp15, Selh, Selu, Seli, Seln, Sepp1, Selo, Sels, Sels2 and Selp had a negative correlation with Txn. Meanwhile, Heat map results suggest the same results again. Gpx (Gpx1, Gpx2, Gpx3, Gpx4) and TR (TR1, TR2, TR3), Dio (Dio1, Dio2) Selw, SelK have a low expression, and Dio3, Selm, Selp15, Selh, Selu, Seli, Seln, Sepp1, Selo, Sels, Sels2 Selp have a high expression in Sedeficient chicken heart and Txn knock down cardiomyocytes. All of these findings indicated that Txn deficiency-induced disorder selenoproteins may link Txn with antioxidative function, and they play a certain role in regulating the expressions of selenoproteins. Expect that, Selt and Sepx1 were firstly proved that they may have antioxidant effect, the specific biological function remains to be further studied.

aorta vessels [35], erythrocytes [36], Pancreas [27], lymphocytes [37], and chicken muscles [29]. In 1937, Keshan disease has happened in Keshan Region of Heilongjiang Province and it's an endemic disease in China. Later, it has been proved that the occurrence of Keshan disease has been related with Se deficiency, and it seems an effective way to relieve and prevent the symptom by supplementing Se [10,38]. Se deficient diets not only increase the disease rate of congestive heart failure in human [39,40], but also lead to cardiovascular diseases in lambs [41]. Abundant studies have indicated that different degrees of myocardial damage can be caused by Se deficiency in different organisms. In our previous study, we had proved that Se deficiency could cause severe oxidative stress in chickens [42,43]. Thioredoxin (Txn) is a small redox-active protein, and has two cysteine residues, which can be obtained in oxidation and reduction reactions for different physiological environment. In the present study, we successfully replicated the Se deficient model, and detected the expression of Txn, TR1, TR2, TR3 down-regulated, at the same time, we had known that Txn, TR1, TR2, TR3 and NADPH comprise the antioxidant system, which has very important role in organism. Txn can execute its own distinctively antioxidant function, a genetic and conservative way, through influence of the expression of some transcription factors [44]. Txn-deficiency will make mitochondrial redox homeostasis imbalanced [45], and Txn systems can regulate hyperoxicmediated death when pulmonary epithelial cells exposed to hyperoxic [46]. Previous study had revealed that inhibition of endogenous Txn in the heart can increases oxidative stress and cardiac hypertrophy [47], overexpression of Txn in transgenic mice can reduce the adriamycininduced cardiotoxicity [48], and the application of Txn recombinant can be treatment of heart disease [49]. Selenoprotein and Txn are inextricably linked for their equally important antioxidant function. Seleno-tetrapeptide was thought to serve an important role of a proteinlinked GSSG and shuttles electrons from the disulfide center within the TR domain to either the glutaredoxin domain or Trx [50]. Txn can use GSH-(Glutathione) independent route to deglutathionylate endothelial nitric oxide synthase and protect against myocardial infarction [51], and it plays an important role in the regulation of myocardial injury [52]. Subsequent observations revealed that Txn can protect tissue from over oxidation, however the exact relationship between Txn and selenoproteins has never been reported. Accordingly the present study was designed to investigate the role of Txn in the expression of selenoproteins. In our former experiment, we did a prediction of the molecular interaction between Txn and selenoproteins, and we had demonstrated that there are an interaction in the protein structure between them [53]. When we successfully established chicken Se-deficiency model, we detected the down expression of Txn system genes (including Txn, TR1, TR2 and TR3), which is the most crucial antioxidant defense mechanism in cell; hamper in Txn system may compromise cell survival through oxidative stress induction. Meanwhile, that Se-deficiency can inhibit the expression of selenoproteins and induce damage through ROS in chicken different organs had been proved. Therefore there is possible relationship between Txn and selenoproteins; in order to further verify this view, we established the Txn knock down model for in

5. Conclusion In conclusion, physiological response to external stimuli is a complex process. It is impossible for any physiological action to only have a response. Combing the in vitro and in vivo experiments, we can conclude that the inhibition expression of Txn gene can inhibit expression of some important selenoproteins like glutathione peroxidase (Gpx1, Gpx2, Gpx3, Gpx4), thioredoxin reductase (TR1, TR2, TR3) and deiodinase (Dio1, Dio2), Selt, Selw, SelK, Sepx1, that might be because they have the same biological function. Abbreviations Txn Dio 1 Dio 2 Dio 3 Gpx 122

Thioredoxin Deiodinase 1 Deiodinase 2 Deiodinase 3 Glutathione Peroxidase

123

Txn Dio1 Dio2 Dio3 GPX1 GPX2 GPX3 GPX4 TR1 TR2 TR3 Selm Selp15 Selt Selw Selh Selu SelK Seli Seln Sepx1 Sepp1 SelO Sps2 Sels

Txn Dio1 Dio2 Dio3 GPX1 GPX2 GPX3 GPX4 TR1 TR2 TR3 Selm Selp15 Selt Selw Selh Selu SelK Seli Seln Sepx1 Sepp1 SelO Sps2 Sels

0.9282 − 0.714 − 0.988 0.6816 − 0.877 − 0.997 0.8965 − 0.974 − 0.864 − 0.961 − 0.98

−0.7 −0.86 0.603 −0.66 −0.9 0.824 −0.89 −0.91 −0.93 −0.92

0.992 0.978 0.828 −0.48 0.748 0.665 0.499 0.73 0.564 0.825 0.968 −0.93 −0.91 0.928

Selw

Selt

0.9676 0.8471 0.7968 − 0.42 0.7999 0.8085 0.6773 0.8403 0.7822 0.8507 0.9765 − 0.962 − 0.993

0.867 −0.378 0.76 0.634 0.312 0.576 0.382 0.834 0.93 −0.834 −0.813 0.847 0.978 −0.575 −0.763 0.445 −0.501 −0.81 0.804 −0.781 −0.928 −0.834 −0.826

0.948

Dio1

0.948 0.822 − 0.484 0.768 0.716 0.578 0.787 0.654 0.839 0.984 − 0.96 − 0.956 0.968 0.992 − 0.73 − 0.918 0.651 − 0.75 − 0.947 0.855 − 0.938 − 0.899 − 0.959 − 0.961

Txn

− 0.67 0.92 0.997 − 0.9 0.961 0.823 0.927 0.958

− 0.92 − 0.76 − 0.77 0.353 − 0.8 − 0.85 − 0.7 − 0.84 − 0.83 − 0.84 − 0.94 0.929 0.982 − 0.99 − 0.86 0.671

− 0.73 − 0.57 − 0.21 0.93 − 0.16 − 0.18 − 0.89 − 0.95 − 0.82 − 0.26 − 0.62 0.874 0.788 − 0.71 − 0.7 0.671 − 0.98 0.763 0.695 − 0.33 0.847 0.357 0.876 0.838

Selu

− 0.82 − 0.676 0.291 − 0.829 − 0.261 − 0.834 − 0.806

0.651 0.445 0.12 − 0.899 0.108 0.176 0.961 0.966 0.893 0.196 0.551 − 0.833 − 0.764 0.682 0.603 − 0.981 − 0.666

SelK

0.969 0.148 0.355 0.351 0.992 0.867 − 0.619 − 0.723 0.8 0.748 − 0.158 − 0.805 0.108 − 0.539 − 0.805 0.982 − 0.645 − 0.947 − 0.615 − 0.669

0.768 0.76 0.974 0.183

− 0.484 − 0.378 0.0892 0.1828 0.1908 − 0.76 − 0.776 − 0.607 0.0694 − 0.33 0.6507 0.5127 − 0.42 − 0.484 0.9299 0.3528 − 0.899 0.4928 0.3891 0.0143 0.5961 0.0682 0.6543 0.5901

GPX1

Dio3

Selh

0.089 0.974 0.891 0.097 0.346 0.272 0.988 0.895 − 0.649 − 0.72 0.797 0.828 − 0.211 − 0.767 0.12 − 0.458 − 0.786 0.955 − 0.644 − 0.988 − 0.646 − 0.682

0.822 0.867

Dio2

0.899 −0.679 0.925 0.535 0.868 0.895

−0.75 −0.501 −0.458 0.493 −0.539 −0.66 −0.904 −0.928 −0.978 −0.573 −0.753 0.87 0.911 −0.877 −0.663 0.763 0.92 −0.82

Seli

0.276 0.426 0.49 0.947 0.827 −0.617 −0.745 0.809 0.665 −0.178 −0.848 0.176 −0.66 −0.83 0.97 −0.674 −0.862 −0.614 −0.679

0.716 0.634 0.891 0.191 0.969

GPX2

Table 2 Calculations of the Pearson correlation coefficients of 25 selenoproteins in selenium deficiency chicken heart.

−0.902 0.971 0.848 0.948 0.973

−0.947 −0.81 −0.786 0.389 −0.805 −0.83 −0.691 −0.841 −0.805 −0.849 −0.964 0.949 0.99 −0.997 −0.899 0.695 0.997 −0.676 0.899

Seln

0.956 0.971 0.208 0.514 −0.782 −0.757 0.677 0.499 −0.894 −0.704 0.961 −0.904 −0.691 0.328 −0.816 −0.216 −0.782 −0.776

0.578 0.312 0.097 −0.76 0.148 0.276

GPX3

− 0.775 − 0.954 − 0.745 − 0.792

0.8552 0.804 0.9553 0.0143 0.9823 0.9695 0.3278 0.5238 0.5127 0.9896 0.9337 − 0.748 − 0.839 0.8965 0.8244 − 0.332 − 0.901 0.2909 − 0.679 − 0.902

Sepx1

0.95 0.431 0.725 − 0.929 − 0.899 0.84 0.73 − 0.949 − 0.836 0.966 − 0.928 − 0.841 0.524 − 0.94 − 0.468 − 0.929 − 0.92

0.787 0.576 0.346 − 0.776 0.355 0.426 0.956

GPX4

0.7389 0.9904 0.9972

− 0.938 − 0.781 − 0.644 0.5961 − 0.645 − 0.674 − 0.816 − 0.94 − 0.875 − 0.71 − 0.915 0.991 0.9941 − 0.974 − 0.893 0.8472 0.9612 − 0.829 0.925 0.9708 − 0.775

Sepp1

0.394 0.63 − 0.82 − 0.84 0.782 0.564 − 0.82 − 0.83 0.893 − 0.98 − 0.8 0.513 − 0.88 − 0.37 − 0.82 − 0.84

0.654 0.382 0.272 − 0.61 0.351 0.49 0.971 0.95

TR1

0.75 0.776

− 0.899 − 0.928 − 0.988 0.068 − 0.947 − 0.862 − 0.216 − 0.468 − 0.367 − 0.978 − 0.948 0.752 0.801 − 0.864 − 0.906 0.357 0.823 − 0.261 0.535 0.848 − 0.954 0.739

SelO

0.918 − 0.7 − 0.78 0.851 0.825 − 0.26 − 0.84 0.196 − 0.57 − 0.85 0.99 − 0.71 − 0.98 − 0.69 − 0.74

0.839 0.834 0.988 0.069 0.992 0.947 0.208 0.431 0.394

TR2

0.9957

−0.959 −0.834 −0.646 0.6543 −0.615 −0.614 −0.782 −0.929 −0.822 −0.693 −0.919 1 0.9814 −0.961 −0.93 0.8758 0.9269 −0.834 0.8683 0.9475 −0.745 0.9904 0.7501

Sps2

−0.92 −0.95 0.976 0.968 −0.62 −0.94 0.551 −0.75 −0.96 0.934 −0.91 −0.95 −0.92 −0.94

0.984 0.93 0.895 −0.33 0.867 0.827 0.514 0.725 0.63 0.918

TR3

− 0.96 − 0.83 − 0.68 0.59 − 0.67 − 0.68 − 0.78 − 0.92 − 0.84 − 0.74 − 0.94 0.996 0.995 − 0.98 − 0.92 0.838 0.958 − 0.81 0.895 0.973 − 0.79 0.997 0.776 0.996

Sels

0.982 − 0.962 − 0.93 0.874 0.929 − 0.833 0.87 0.949 − 0.748 0.991 0.752 1 0.996

− 0.96 − 0.834 − 0.649 0.651 − 0.619 − 0.617 − 0.782 − 0.929 − 0.823 − 0.696 − 0.92

Selm

− 0.964 − 0.833 − 0.683 0.597 − 0.665 − 0.671 − 0.771 − 0.918 − 0.829 − 0.736 − 0.937 0.997 0.993 − 0.979 − 0.929 0.842 0.953 − 0.806 0.887 0.97 − 0.789 0.996 0.778 0.997 1

Selpb

− 0.993 − 0.912 0.788 0.982 − 0.764 0.911 0.99 − 0.839 0.994 0.801 0.981 0.995

− 0.956 − 0.813 − 0.72 0.513 − 0.723 − 0.745 − 0.757 − 0.899 − 0.84 − 0.782 − 0.949 0.982

Selp15

J. Yang et al.

Journal of Inorganic Biochemistry 177 (2017) 118–126

124

Txn Dio1 Dio2 Dio3 GPX1 GPX2 GPX3 GPX4 TR1 TR2 TR3 Selm Selp15 Selt Selw Selh Selu SelK Seli Seln Sepx1 Sepp1 SelO Sps2 Sels Selpb

Txn Dio1 Dio2 Dio3 GPX1 GPX2 GPX3 GPX4 TR1 TR2 TR3 Selm Selp15 Selt Selw Selh Selu SelK Seli Seln Sepx1 Sepp1 SelO Sps2 Sels Selpb

0.8094 − 0.9054 − 0.6504 0.7522 − 0.6089 − 0.9707 0.9861 − 0.1825 − 0.6173 − 0.9347 − 0.9265 − 0.4631

− 0.8769 − 0.3418 0.31264 − 0.2955 − 0.8287 0.7103 − 0.2736 − 0.4895 − 0.8599 − 0.8425 − 0.57

0.63051 0.77418 0.6559 − 0.9153 0.8191 0.82403 0.84379 0.71167 0.98172 0.89025 0.93898 − 0.2984 − 0.3906 0.80938

Selw

Selt

0.4847 0.9567 0.9001 − 0.8933 0.9481 0.9284 0.608 0.7871 0.788 0.9295 0.9483 − 0.6964 − 0.6981

0.9828 − 0.944 0.996 0.9902 0.4297 0.9287 0.8091 0.972 0.8708 − 0.829 − 0.858 0.9567 0.7742 − 0.967 − 0.824 0.8432 − 0.792 − 0.995 0.9646 − 0.454 − 0.82 − 0.984 −0.986 − 0.682

0.6892

Dio1

0.6892 0.7098 − 0.8044 0.7321 0.7718 0.1336 0.9008 0.7667 0.7662 0.4814 − 0.5866 − 0.7228 0.4847 0.6305 − 0.8069 − 0.7237 0.4886 − 0.7158 − 0.6774 0.4738 − 0.919 − 0.9018 − 0.7638 − 0.7779 − 0.996

Txn

− 0.9409 0.9985 0.7664 − 0.7386 0.7149 0.9508 0.7661 0.7893 0.765

− 0.7237 − 0.8236 − 0.9131 0.691 − 0.8002 − 0.8073 0.1533 − 0.8894 − 0.4599 − 0.7274 − 0.4387 0.9805 0.9979 − 0.6504 − 0.3418 0.7513

−0.8069 −0.967 −0.9293 0.99582 −0.9859 −0.9923 −0.5168 −0.9529 −0.923 −0.9977 −0.887 0.71294 0.78492 −0.9054 −0.8769

0.75133 −0.7042 0.71783 0.97612 −0.8813 0.55026 0.82717 0.99646 0.99592 0.78551

Selu

− 0.9321 − 0.7902 0.84804 − 0.436 − 0.8065 − 0.7452 − 0.7623 − 0.5291

0.48864 0.8432 0.9166 − 0.6374 0.7983 0.78457 − 0.0658 0.78388 0.378 0.70132 0.51314 − 0.9881 − 0.9512 0.75223 0.31264 − 0.7042 − 0.9409

SelK

0.9982 0.4698 0.9419 0.8568 0.9888 0.8866 − 0.791 − 0.835 0.9481 0.8191 − 0.986 − 0.8 0.7983 − 0.767 − 0.997 0.9439 − 0.485 − 0.824 − 0.996 − 0.997 − 0.719

0.7321 0.996 0.9701 − 0.97

− 0.8044 − 0.9442 − 0.8922 − 0.9699 − 0.9777 − 0.5787 − 0.9306 − 0.9542 − 0.9948 − 0.9043 0.64596 0.72699 − 0.8933 − 0.9153 0.99582 0.69101 − 0.6374 0.6552 0.96157 − 0.8543 0.52863 0.78796 0.9877 0.98448 0.77549

GPX1

Dio3

Selh

−0.892 0.9701 0.9667 0.2554 0.9449 0.7163 0.9264 0.7653 −0.916 −0.937 0.9001 0.6559 −0.929 −0.913 0.9166 −0.89 −0.96 0.9365 −0.539 −0.886 −0.949 −0.957 −0.719

0.7098 0.9828

Dio2

0.73079 − 0.703 0.72866 0.94688 0.73188 0.75671 0.76078

− 0.7158 − 0.7918 − 0.8898 0.6552 − 0.7673 − 0.7756 0.2056 − 0.8703 − 0.4197 − 0.6914 − 0.3897 0.97653 0.99301 − 0.6089 − 0.2955 0.71783 0.99854 − 0.9321

Seli

0.4558 0.958 0.8706 0.9916 0.8727 − 0.7861 − 0.8397 0.9284 0.824 − 0.9923 − 0.8073 0.7846 − 0.7756 − 0.9904 0.9225 − 0.5322 − 0.8466 − 0.9977 − 0.9994 − 0.759

0.7718 0.9902 0.9667 − 0.9777 0.9982

GPX2

Table 3 Calculations of the Pearson correlation coefficients of 25 selenoproteins in cardiomyocytes of Txn knock down.

−0.9629 0.4123 0.7778 0.9909 0.9891 0.6618

−0.6774 −0.9953 −0.9602 0.9616 −0.9967 −0.9904 −0.5148 −0.9114 −0.8513 −0.9845 −0.9134 0.7705 0.8049 −0.9707 −0.8287 0.9761 0.7664 −0.7902 0.7308

Seln

0.2399 0.7307 0.5575 0.8164 0.1378 0.093 0.608 0.8438 −0.517 0.1533 −0.066 0.2056 −0.515 0.472 0.2609 0.045 −0.513 −0.48 −0.052

0.1336 0.4297 0.2554 −0.579 0.4698 0.4558

GPX3

− 0.218 − 0.669 − 0.918 − 0.915 − 0.467

0.4738 0.9646 0.9365 − 0.854 0.9439 0.9225 0.472 0.801 0.7033 0.9021 0.8823 − 0.795 − 0.78 0.9861 0.7103 − 0.881 − 0.739 0.848 − 0.703 − 0.963

Sepx1

0.8093 0.9331 0.7081 − 0.827 − 0.905 0.7871 0.7117 − 0.953 − 0.889 0.7839 − 0.87 − 0.911 0.801 − 0.75 − 0.958 − 0.944 − 0.956 − 0.903

0.9008 0.9287 0.9449 − 0.931 0.9419 0.958 0.2399

GPX4

0.8637 0.5046 0.5308 0.9441

− 0.919 − 0.4539 − 0.5385 0.5286 − 0.4852 − 0.5322 0.2609 − 0.7501 − 0.4516 − 0.4928 − 0.1159 0.5654 0.6889 − 0.1825 − 0.2736 0.5503 0.7149 − 0.436 0.7287 0.4123 − 0.2178

Sepp1

0.924 0.895 − 0.39 − 0.5 0.788 0.982 − 0.923 − 0.46 0.378 − 0.42 − 0.851 0.703 − 0.452 − 0.626 − 0.898 − 0.887 − 0.716

0.767 0.809 0.716 − 0.954 0.857 0.871 0.731 0.809

TR1

0.81682 0.83796 0.9264

− 0.9018 − 0.8195 − 0.8863 0.78796 − 0.8241 − 0.8466 0.04504 − 0.9584 − 0.6258 − 0.7934 − 0.4822 0.87634 0.94848 − 0.6173 − 0.4895 0.82717 0.95083 − 0.8065 0.94688 0.77782 − 0.6685 0.86369

SelO

0.9145 − 0.7 − 0.764 0.9295 0.8902 − 0.998 − 0.727 0.7013 − 0.691 − 0.985 0.9021 − 0.493 − 0.793 − 0.998 − 0.995 − 0.742

0.7662 0.972 0.9264 − 0.995 0.9888 0.9916 0.5575 0.9331 0.924

TR2

0.99926 0.74511

− 0.7638 − 0.9841 − 0.9485 0.9877 − 0.996 − 0.9977 − 0.5127 − 0.9444 − 0.8984 − 0.998 − 0.8992 0.74362 0.80141 − 0.9347 − 0.8599 0.99646 0.7661 − 0.7452 0.73188 0.99085 − 0.9178 0.50463 0.81682

Sps2

− 0.4589 − 0.494 0.9483 0.939 − 0.887 − 0.4387 0.5131 − 0.3897 − 0.9134 0.8823 − 0.1159 − 0.4822 − 0.8992 − 0.882 − 0.4337

0.4814 0.8708 0.7653 − 0.9043 0.8866 0.8727 0.8164 0.7081 0.8945 0.9145

TR3

0.7622

−0.778 −0.986 −0.957 0.9845 −0.997 −0.999 −0.48 −0.956 −0.887 −0.995 −0.882 0.7646 0.8226 −0.926 −0.842 0.9959 0.7893 −0.762 0.7567 0.9891 −0.915 0.5308 0.838 0.9993

Sels

0.9836 −0.6964 −0.2984 0.7129 0.9805 −0.9881 0.9765 0.7705 −0.7948 0.5654 0.8763 0.7436 0.7646 0.6306

−0.5866 −0.8287 −0.9157 0.646 −0.7909 −0.7861 0.1378 −0.8274 −0.3903 −0.6998 −0.4589

Selm

− 0.996 − 0.6822 − 0.7189 0.7755 − 0.7195 − 0.759 − 0.0523 − 0.9027 − 0.7157 − 0.7422 − 0.4337 0.6306 0.7599 − 0.4631 − 0.57 0.7855 0.765 − 0.5291 0.7608 0.6618 − 0.4668 0.9441 0.9264 0.7451 0.7622

Selpb

− 0.6981 − 0.3906 0.7849 0.9979 − 0.9512 0.993 0.8049 − 0.7802 0.6889 0.9485 0.8014 0.8226 0.7599

− 0.7228 − 0.8576 − 0.9373 0.727 − 0.8348 − 0.8397 0.093 − 0.905 − 0.5 − 0.7644 − 0.494 0.9836

Selp15

J. Yang et al.

Journal of Inorganic Biochemistry 177 (2017) 118–126

Journal of Inorganic Biochemistry 177 (2017) 118–126

J. Yang et al.

Selh Selu Seli Seln Selo Sels Sels 2 Sepp1 Selp Sepx1 Selp15 Se Sec GSH GSSG NADPH PBS DMEM Redox ROS ED GAPDH qPCR

Selenoprotein h Selenoprotein u Selenoprotein i Selenoprotein n Selenoprotein o Selenoprotein s Selenoprotein synthetase 2 Selenoprotein p1 Selenoprotein p Selenoprotein x1 15-kDa Selenoprotein Selenium Selenocysteine Glutathione Oxidized Glutathione Nicotinamide Adenine Dinucleotide Phosphate Phosphate Buffered Solution Dulbecco's Modified Eagle Medium Reduction-oxidation Reactive Oxygen Species Exudative Diathesis Glyceraldehyde-3-phosphate Dehydrogenase Quantitative real-time PCR

Acknowledgments This study was supported by the National Natural Science Foundation of China (31402267), Heilongjiang Province Science Foundation for Youths (QC2014C015), Heilongjiang Postdoctoral Fund (LBHZ-13028), Foundation for Young Talents in Higher Education of Heilongjiang, China (UNPYSCT-2015009), “Young Talents” Project of Northeast Agricultural University (14QC20), Degree and graduate education teaching reform project in Heilongjiang province (JGXM_HLJ_201676), The degree and graduate education teaching reform project in Heilongjiang province (JGXM_HLJ_201676). References [1] N.F. Benina, M.I. Cheganova, Activity of oxidation-reduction enzymes in patients with chronic inflammatory lung diseases depending on the degree of hypoxemia, Klin. Med. 52 (3) (1974) 26. [2] D. Iua, State of the oxidation-reduction processes in children with the after effects of paralytic diseases (poliomyelitis and infantile cerebral paralysis), Pediatriia 11 (1974) 60–61. [3] L.V. Papp, et al., From selenium to selenoproteins: synthesis, identity, and their role in human health, Antioxid. Redox Signal. 9 (7) (2007) 775–806. [4] H.D. Yao, et al., Selenoprotein W serves as an antioxidant in chicken myoblasts, Biochim. Biophys. Acta 1830 (4) (2013) 3112–3120. [5] Z.W. Zhang, et al., Effects of oxidative stress on immunosuppression induced by selenium deficiency in chickens, Biol. Trace Elem. Res. 149 (3) (2012) 352–361. [6] Yao, L., et al., Roles of oxidative stress and endoplasmic reticulum stress in selenium deficiency-induced apoptosis in chicken liver. 2015. 28(2): p. 255–265. [7] R. Wang, et al., Dietary selenium influences pancreatic tissue levels of selenoprotein W in chickens, J. Inorg. Biochem. 105 (9) (2011) 1156. [8] J. Yu, et al., The role of nitric oxide and oxidative stress in intestinal damage induced by selenium deficiency in chickens, Biol. Trace Elem. Res. 163 (1) (2015) 144–153. [9] J. Yang, et al., Interplay between autophagy and apoptosis in selenium deficient cardiomyocytes in chicken, J. Inorg. Biochem. 170 (2017) 17. [10] J. Loscalzo, Keshan disease, selenium deficiency, and the selenoproteome, N. Engl. J. Med. 370 (18) (2014) 1756–1760. [11] I. Alexanian, et al., Selenium contributes to myocardial injury and cardiac remodeling in heart failure, Int. J. Cardiol. 176 (1) (2014) 272–273. [12] W. Saliba, R. El Fakih, W. Shaheen, Heart failure secondary to selenium deficiency, reversible after supplementation, Int. J. Cardiol. 141 (2) (2010) E26–E27. [13] M. Zhang, et al., The alterations of heart function and cardiac mitochondria in selenium deficiency rats, Heart 99 (2013) A24-A24. [14] G. Floresmateo, et al., Selenium and coronary heart disease: a meta-analysis, Am. J. Clin. Nutr. 84 (4) (2006) 762–773. [15] C. Benstoem, et al., Selenium and its supplementation in cardiovascular disease–what do we know? Nutrients 7 (5) (2015) 3094–3118. [16] J. Yang, et al., Interplay between autophagy and apoptosis in selenium deficient cardiomyocytes in chicken ☆, J. Inorg. Biochem. (2017) 17–25. [17] A. Pinheiro, et al., NMR solution structure of the reduced form of thioredoxin 1

Fig. 7. Heat map of relative mRNA levels of selenoprotein genes. Rows represent the probe sets. RNA gene expression is shown using the indicated pseudo color scale from blue (0) to red (2.00) relative to values. Red squares represent increased significantly (P < 0.05), blue squares represent decreased significantly (P < 0.05). Data are presented as the mean ± SD.

Gpx 1 Gpx 2 Gpx 3 Gpx 4 TR TR1 TR2 TR3 Selt Selw Selk Selm

Glutathione Peroxidase 1 Glutathione Peroxidase 2 Glutathione Peroxidase 3 Glutathione Peroxidase 4 Thioredoxin Reductase Thioredoxin Reductase 1 Thioredoxin Reductase 2 Thioredoxin Reductase 3 Selenoprotein t Selenoprotein w Selenoprotein k Selenoprotein m 125

Journal of Inorganic Biochemistry 177 (2017) 118–126

J. Yang et al.

Biol. Trace Elem. Res. 161 (3) (2014) 328–333. [38] S.Y. Liu, Protective effects of vitamin E and selenium on myocardial mitochondria in rats–a study on the pathogenic factors and pathogenesis of Keshan disease, Zhonghua Yu Fang Yi Xue Za Zhi 24 (4) (1990) 214–216. [39] C.S. Li, Selenium deficiency and endemic heart failure in China: a case study of biogeochemistry for human health, Ambio 36 (1) (2007) 90–93. [40] J.S. Chen, An original discovery: selenium deficiency and Keshan disease (an endemic heart disease), Asia Pac. J. Clin. Nutr. 21 (3) (2012) 320–326. [41] S.A. Rezaei, B. Dalir-Naghadeh, Association of plasma and heart homocysteine and blood malondialdehyde with cardiovascular diseases induced by acute selenium deficiency in lambs, Small Rumin. Res. 83 (1–3) (2009) 22–28. [42] H. Yao, et al., Selenium deficiency mainly influences the gene expressions of antioxidative selenoproteins in chicken muscles, Biol. Trace Elem. Res. 161 (3) (2014) 318. [43] X. Gao, et al., Selenium deficiency-induced inflammation and increased expression of regulating inflammatory cytokines in the chicken gastrointestinal tract, Biol. Trace Elem. Res. 173 (1) (2016) 1–9. [44] S. Izawa, et al., Thioredoxin deficiency causes the constitutive activation of Yap1, an AP-1-like transcription factor in Saccharomyces cerevisiae, J. Biol. Chem. 274 (40) (1999) 28459–28465. [45] E. Holzerova, et al., Human thioredoxin 2 deficiency impairs mitochondrial redox homeostasis and causes early-onset neurodegeneration, Brain 139 (2) (2016). [46] B.J. Forred, et al., Detoxification of mitochondrial oxidants and apoptotic signaling are facilitated by thioredoxin-2 and peroxiredoxin-3 during hyperoxic injury, PLoS One 12 (1) (2017). [47] M. Yamamoto, et al., Inhibition of endogenous thioredoxin in the heart increases oxidative stress and cardiac hypertrophy, J. Clin. Investig. 112 (9) (2003) 1395–1406. [48] K. Shioji, et al., Overexpression of thioredoxin-1 in transgenic mice attenuates adriamycin-induced cardiotoxicity, Circulation 106 (11) (2002) 1403–1409. [49] S. Matsushima, D. Zablocki, J. Sadoshima, Application of recombinant thioredoxin1 for treatment of heart disease, J. Mol. Cell. Cardiol. 51 (4) (2010) 570–573. [50] Q.A. Sun, et al., Selenoprotein oxidoreductase with specificity for thioredoxin and glutathione systems, Proc. Natl. Acad. Sci. U. S. A. 98 (7) (2001) 3673–3678. [51] J. Subramani, et al., Thioredoxin uses a GSH-independent route to deglutathionylate endothelial nitric oxide synthase and protect against myocardial infarction, J. Biol. Chem. 291 (45) (2016). [52] K.B. Hadley, R.A. Sunde, Selenium regulation of thioredoxin reductase activity and mRNA levels in rat liver, J. Nutr. Biochem. 12 (12) (2001) 693–702. [53] Q. Liu, et al., Analysis of the interactions between thioredoxin and 20 selenoproteins in chicken, Biol. Trace Elem. Res. (2017) 1–14. [54] D.L. St Germain, V.A. Galton, The deiodinase family of selenoproteins, Thyroid 7 (4) (1997) 655. [55] S.L. Lin, et al., Selenium deficiency inhibits the conversion of thyroidal thyroxine (T-4) to triiodothyronine (T-3) in chicken thyroids, Biol. Trace Elem. Res. 161 (3) (2014) 263–271. [56] H. Ruan, et al., Selenium regulates gene expression of selenoprotein W in chicken skeletal muscle system, Biol. Trace Elem. Res. 145 (1) (2012) 59–65. [57] R. Fan, et al., Gene expression of selenoproteins can be regulated by selenoprotein K silencing in chicken myoblasts, Biometals 29 (4) (2016) 679.

from Sacharomyces cerevisiae, Proteins Struct. Funct. Bioinf. 70 (2) (2008) 584. [18] P.S. Peter, A. Malhotra, J. Sadoshima, Abstract 1689: thioredoxin prevents oxidative stress induced by diabetes mellitus, Circulation 114 (2006) II329. [19] S. Urig, K. Becker, On the potential of thioredoxin reductase inhibitors for cancer therapy, Semin. Cancer Biol. 16 (6) (2006) 452–465. [20] E.S. Arnér, A. Holmgren, Physiological functions of thioredoxin and thioredoxin reductase, Eur. J. Biochem. 267 (20) (2000) 6102. [21] D.A. Drechsel, Respiration-dependent H₂O₂ removal in brain mitochondria via the thioredoxin/peroxiredoxin system, J. Biol. Chem. 285 (36) (2010) 27850. [22] J. Subramani, et al., Thioredoxin uses a GSH-independent route to deglutathionylate endothelial nitric-oxide synthase and protect against myocardial infarction, J. Biol. Chem. 291 (45) (2016) 23374–23389. [23] V. Perez, et al., Inhibition of endogenous thioredoxin-1 in the heart of transgenic mice does not confer cardioprotection in ischemic postconditioning, Int. J. Biochem. Cell Biol. 81 (2016) 315–322. [24] M.T. Rached, et al., FoxO1 is a positive regulator of bone formation by favoring protein synthesis and resistance to oxidative stress in osteoblasts, Cell Metab. 11 (2) (2010) 147–160. [25] E. Junn, et al., Vitamin D3 up-regulated protein 1 mediates oxidative stress via suppressing the thioredoxin function, J. Immunol. 164 (12) (2000) 6287–6295. [26] A. Mitsui, et al., Overexpression of human thioredoxin in transgenic mice controls oxidative stress and life span, Antioxid. Redox Signal. 4 (4) (2002) 693. [27] X. Zhao, et al., Selenium deficiency influences nitric oxide and selenoproteins in pancreas of chickens, Biol. Trace Elem. Res. 161 (3) (2014) 341–349. [28] J.L. Zhang, et al., Selenium deficiency affects the mRNA expression of inflammatory factors and selenoprotein genes in the kidneys of broiler chicks, Biol. Trace Elem. Res. 171 (1) (2016) 201. [29] H. Yao, et al., Selenium deficiency mainly influences the gene expressions of antioxidative selenoproteins in chicken muscles, Biol. Trace Elem. Res. 161 (3) (2014) 318–327. [30] M. Mariotti, et al., Composition and evolution of the vertebrate and mammalian selenoproteomes, PLoS One 7 (3) (2012) e33066. [31] F.L. Aachmann, et al., Solution structure of selenoprotein W and NMR analysis of its interaction with 14-3-3 proteins, J. Biol. Chem. 282 (51) (2007) 37036. [32] S.L. Lin, et al., Selenium deficiency inhibits the conversion of thyroidal thyroxine (T 4) to triiodothyronine (T 3) in chicken thyroids, Biol. Trace Elem. Res. 161 (3) (2014) 263–271. [33] Y. Liang, et al., Effect of selenium on selenoprotein expression in the adipose tissue of chickens, Biol. Trace Elem. Res. 160 (1) (2014) 41–48. [34] X. Li, et al., Effects of selenium-lead interaction on the gene expression of inflammatory factors and selenoproteins in chicken neutrophils ☆, Ecotoxicol. Environ. Saf. 139 (2017) 447–453. [35] D. Qiang, et al., Selenium deficiency influences the expression of selenoproteins and inflammatory cytokines in chicken aorta vessels, Biol. Trace Elem. Res. 173 (2) (2016) 1–13. [36] Y. Luan, et al., Selenium deficiency influences the mRNA expression of selenoproteins and cytokines in chicken erythrocytes, Biol. Trace Elem. Res. 171 (2) (2016) 427–436. [37] W. Zhao, et al., Four endoplasmic reticulum resident selenoproteins may be related to the protection of selenium against cadmium toxicity in chicken lymphocytes,

126