- Email: [email protected]
Gene expression profile of rabbit cartilage by expressed sequence tag analysis
Gene 424 (2008) 147–152
Contents lists available at ScienceDirect
Gene j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / g e n e
Gene expression profile of rabbit cartilage by expressed sequence tag analysis Hyuck Joon Kwon a, Hidetoshi Akimoto b, Yoshihiro Ohmiya b, Kenichi Honma c, Kazunori Yasuda a,d,⁎ a
Regenerative Medicine/Tissue Engineering Division, Research Center for Cooperative Projects, Graduate School of Medicine, Hokkaido University, Sapporo, Japan Department of Photobiology, Graduate School of Medicine, Hokkaido University, Sapporo, Japan c Department of Physiology, Graduate School of Medicine, Hokkaido University, Sapporo 060-0810, Japan d Department of Sports Medicine and Joint Surgery, Graduate School of Medicine, Hokkaido University, Kita-15 Nishi-7, Kita-ku, Sapporo 060-8638, Japan b
a r t i c l e
i n f o
Article history: Received 29 May 2008 Received in revised form 22 July 2008 Accepted 29 July 2008 Available online 6 August 2008 Received by A.J. van Wijnen Keywords: Rabbit cartilage Expressed sequence tag (EST) Expression profile Proteoglycan Collagen
a b s t r a c t Although the rabbit is commonly used as an animal model for the in vivo study of cartilage formation or regeneration, genetic approaches to the rabbit cartilage are rare. We constructed an expressed sequence tag (EST) library from rabbit cartilage tissue for the first time to establish the foundations for genetic study on rabbit cartilage. From our results, we identified 2387 unique genes among 4885 clones, corresponding to 1839 matched to characterized genes including 1618 genes with known function and 548 uncharacterized and novel genes. Gene expression profiles based on EST frequency show that type II collagen (COL2A1) and type X collagen (COL10A1) among collagen clones, proteoglycan 4 (PRG4) and decorin (DCN) among proteoglycan clones, and cartilage oligomeric matrix protein (COMP) and matrix Gla protein (MGP) among other extracellular matrix clones, are highly expressed in rabbit cartilage. In addition, gene expression analysis based on real-time PCR of these major extracellular matrix constituents showed that expression of col2a1 and col10a1 remains constant whereas the expression of prg4, dcn, and comp reveals substantial change with rabbit age. This EST library will provide a valuable resource with which to identify genes involved in the biochemical and physiological functions of rabbit cartilage, and will contribute to establishing the rabbit as an animal model for cartilage research. © 2008 Elsevier B.V. All rights reserved.
1. Introduction Articular (hyaline) cartilage, which covers the ends of all synovial joints with a lubricative surface, is a highly organized skeletal tissue with well-characterized histological, biochemical, and biomechanical properties, and allows smooth joint motion even under extreme weight (Cremer et al., 1998). Articular cartilage is frequently damaged due to trauma, pathologic alterations, and age-related degenerations. Recently, therefore, treatment of damaged cartilage is a significant and increasing health care concern. Because cartilage tissue is avascular and alymphatic tissue with low cell density (Hardingham et al., 2002; Cheung et al., 1978), this tissue has a very limited ability to repair itself. Therefore, it has been the prevalent strategy to fill an osteochondral defect with a tissue-engineered cartilage-like tissue or a cell-seeded
Abbreviations: EST, expressed sequence tag; cDNA, complementary DNA; bp, Base pairs; BLAST, Basic Local Alignment Search Tool; E-value, Expectation value; mRNA, Messenger RNA; NCBI, National Center for Biotechnology Information; PCR, Polymerase chain reaction; EST, expressed sequence tag; cDNA, complementary DNA; bp, Base pairs; BLAST, Basic Local Alignment Search Tool; E-value, Expectation value; mRNA, Messenger RNA; NCBI, National Center for Biotechnology Information; PCR, Polymerase chain reaction. ⁎ Corresponding author. Tel.: +81 11 706 7211; fax: +81 11 706 7822. E-mail address: [email protected] (K. Yasuda). 0378-1119/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2008.07.036
scaffold material by implantation surgery since the first report by Brittberg et al. (1994). Under this strategy, a number of studies have been conducted to apply various kinds of cells cultured in various types of scaffolds to create an implantable tissue-engineered cartilage tissue (Peterson et al., 2003; Hangody and Fules, 2003; Horas et al., 2003; Knutsen et al., 2004; Browne et al., 2005; Henderson et al., 2005; Ochi et al., 2004). However, it has been pointed out that this strategy has many problems for current clinical application (Smith et al., 2005; Feczko et al 2003; Driesang and Hunziker, 2000; Micheli et al., 2001; Redman et al., 2005). Thus, functional repair of articular osteochondral defects remains a major challenge for tissue regeneration medicine. Specifically, molecular–biological studies are needed to study cartilage regeneration. Expressed sequence tag (EST) libraries can provide a valuable resource to identify genes that are involved in the biochemical and physiological functions of cartilage. Therefore, construction of EST library from cartilage will be useful for genetic approaches in cartilage research. However, EST dataset from cartilage has been comparatively small because cartilage with the rich extracellular matrix and low density of chondrocytes is inconvenient tissue for the isolation of mRNA. Despite some reports about chondrocyte cell line or human cartilage tissue (Jung et al., 2004; Andreas et al., 2005; Kumar et al., 2001), EST library studies of native cartilage tissue in animal models are rare because it is difficult to obtain enough cartilage from animal models for EST library construction. Although animal models are
148
H.J. Kwon et al. / Gene 424 (2008) 147–152
Table 1 List of primers used in real-time PCR for abundantly expressed extracellular matrix genes isolated from rabbit cartilage plus GAPDH Primer ID
Primers (5′–3′)
COL2A1 II-F COL2A1-R COL10A1-F COL10A1-R PRG 4-F PRG 4-R DCN-F DCN -R COMP-F COMP-R GAPDH-F GAPDH-R
GGTGTGAGTCCAACGCCCCGCCC GTTTGACACGGAGTAGCACCATC GGAGAGCCAGGGTTGCCAG GTCCTCTCTCCCCTTGTTTTCC GAAAGGATTTGGAGGACTAACTGG GCCACCTCTCTTGAAAAAATACAC CTGCGAGAGCTTCACTTGGAC GGAAGCCTTTTTGGTGTTGTAC GACTTCCGGGCCTTCCAGAC GGTCGCTGTTCATGGTCTGC CCCTCAATGACCACTTTGTGAA AGGCCATGTGGACCATGAG
Expect size (bp)
Accession number
95
S83370.1
91
XM_001161595.1
100
XM_001107843.1
159
S76584.1
115
AF325902.1
93
L23961.1
important for the in vivo study of cartilage formation or developing tissue engineering for cartilage regeneration, only cDNA library preparation from mouse growth plate cartilage has been reported previously ( Okihana and Yamada, 1999). However, the mouse is not a suitable animal model for cartilage study because the joint size is too small to create an injured or damaged cartilage model. Thus, the rabbit is generally accepted as a standard model for cartilage research (Reinholz et al., 2004; Ueblacker et al., 2007; Ten Koppel et al., 2001). However, no studies have been reported on EST library construction from rabbit cartilage. Here, we describe the construction of an EST library from rabbit cartilage tissue for the first time. Our EST data shows the characteristics and expression profiles of genes in native cartilage tissue of rabbit. Furthermore, we demonstrate clear expression patterns of some extracellular matrix genes with high EST frequency through real-time PCR in 6–24-week-old rabbits. This study will be useful for genetic approaches in studying the mechanism of cartilage formation and for developing tissue engineering techniques for cartilage regeneration. 2. Materials and methods
converted to double-stranded DNA using a DNA repair enzyme (Invitrogen), in accordance with the manufacturer's instructions. This double-stranded DNA was transformed into Escherichia coli by electroporation, resulting in a normalized library containing 1.4 × 107 clones. 2.3. DNA sequencing and data analysis A total of 5184 cDNA clones from rabbit cartilage were randomly selected and analyzed. The 3′-ends of EST nucleotide sequences were determined and 5′-end EST sequencing was performed commercially by Shimadzu Corp using an RISA-384 multicapillary automated DNA sequencer. Vector-derived and ambiguous sequences were removed from collected EST sequences before computer-assisted analysis. Each sequence was aligned with all other EST sequences in nonredundant (NR) nucleotide sequences using the BLASTN (BLAST nucleotide) program. In general, E-value scores lower than 1.0e−4 were considered significant. 2.4. Real-time PCR analysis of rabbit cartilage Cartilage was obtained from knee joints of Japanese white rabbits aged 6, 12, 18, and 24 weeks. Total RNA was isolated by using TRIzol reagent and an RNA purification kit. RNA concentration was determined using the NanoDrop (NanoDrop Technologies) and reverse transcription reactions were performed with total RNA 0.2 μg using a cDNA synthesis kit (TaKaRa). Real-time PCR reactions for Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), COL2A1, COL10A1, PRG4, DCN, and COMP were conducted using the SYBR green system. Primer-set sequences are described in Table 1. Real-time PCR reactions using the Thermal Cycler Dice Real Time System (TaKaRa) were performed at 95 °C for 10 min, followed by 40 cycles of amplification consisting of denaturation steps at 95 °C for 15 s and extension steps at 60 °C for 1 min. When calculating the efficiency of qPCR primers, we made a standard curve in about 5 fold dilutions, that is, total RNA 100 ng, 20 ng, 4 ng, and 1 ng. We took ct (cycle threshold) value, plot this over the dilution factor and use the slope to calculate efficiency. The expression levels of genes were normalized to GAPDH levels.
2.1. Tissue and RNA purification 3. Results Rabbit cartilage was obtained from shoulder, hip, and knee joints of six-month-old Japanese white rabbits. Total RNA was isolated using TRIzol reagent (Invitrogen) and an RNA purification kit (Qiagen). Purity and integrity of RNA were assessed by absorbance at 260 nm/ 280 nm and agarose gel electrophoresis. The poly (A)+ RNA fraction was isolated with an mRNA isolation kit (Toyobo). 2.2. Construction of cDNA library cDNA was synthesized using the CloneMiner cDNA Library Construction Kit (Invitrogen), as described by the manufacturer. Briefly, we used poly (A)+ RNA to construct the first strand of cDNA using the Biotin-attB2-Oligo(dT) Primer and SuperScript II RT, and synthesized the second strand of cDNA using the first strand of cDNA as a template. The attB1 adapter was ligated to the 5′ end of the cDNA for directional cloning. A directional-cloned cDNA library was constructed in the pDONR 222 vector and then transformed into ElectroMAX DH10B T1 Phage Resistant cells. The doublestranded plasmid library was purified using the Wizard Plus Minipreps DNA Purification System (Promega). After heating at 95 °C for 3 min, 1 μl of 10-times buffer (1.2 M NaCl, 0.1 M Tris–HCl [pH 8], 50 mM ethylenediaminetetraacetic acid, 10% sodium dodecyl sulfate) and 1.5 μl water were added and hybridization was performed at 68 °C for 7 h. The remaining single stranded DNA was purified by hydroxyapatite chromatography at 60 °C and
3.1. Sequencing and analysis of ESTs To analyze expression profiles in rabbit cartilage, 5184 clones from a rabbit cartilage cDNA library were sequenced. The identities of cloned sequences were determined by a BLAST search. The average length of readable sequence was about 500 bps. Each sequence was aligned using BLASTN NCBI public nucleic acid database. Among the 5184 sequenced clones, 4885 were high quality, 31 were poor quality, and 268 were read-fail. Of the 4885 high quality clones, 4203 matched to previously described genes with a BLASTN E-value of ≤1.0e−4.
Table 2 Classification of 1839 rabbit cartilage ESTs into functional categories Functional categories
Number of independent clones
Ratio (%)
Signal transduction Protein metabolism Gene expression Metabolism Cell growth and maintenance Transport Immune response Apoptosis Cell cycle Unclassified
362 354 322 225 204 89 41 12 9 221
20.1 19.6 17.8 12.5 11.3 4.9 2.3 0.7 0.5 12.2
H.J. Kwon et al. / Gene 424 (2008) 147–152 Table 3 The 20 most frequently expressed genes in Rabbit cartilage Rank
Name
Number of ESTs
Percentage
Accession number
1
Cartilage oligomeric matrix protein (COMP) Cystatin C (CST3) Proteoglycan 4 (PRG4) Matrix Gla protein (MGP) Ferritin H-chain (FTH1) Decorin (DCN) Elongation factor 1 alpha (EEF1A1) Cytokine-like protein C17 (CYTL1) Clusterin (CLU) Translationally controlled 1 tumor protein (TPT1) Lectin, galactoside-binding, soluble, 3 binding protein (LGALS3BP) Beta-hexosaminidase-beta-subunit (HEXB) Osteoglycin (OGN) Fibronectin (FN) Connective tissue growth factor (CTGF) C-type lectin (CLEC4F) Cartilage intermediate layer protein (CLIP) Dual specificity phosphatase 1 (DUSP1) Ribosomal protein HL23 (RPHL23) Ribosomal protein S7 (RPS7)
145
2.97
AF325902.1
71 66 65 55 44 44 41 38 25
1.45 1.35 1.33 1.13 0.90 0.90 0.84 0.78 0.51
AB009342.1 XM_001107843.1 D21265.1 M63912.1 S76584.1 U09823.1 XM_001155365.1 AF118852.1 AJ277093.1
23
0.47
U06470.1
21
0.43
AY629244.1
21 18 18
0.43 0.37 0.37
AF487889.1 AF135404.1 NM_001901.2
18 17
0.37 0.35
XM_847555.1 XM_001498168.1
15
0.31
AK232967.1
15 15
0.31 0.31
XM_001501514.1 XM_001503631.1
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
149
genes (11.3%). The small categories comprised transport-related genes (4.9%), immune response-related genes (2.3%), apoptosis-related genes (0.7%), and cell cycle-related genes (0.5%). Of the 1839 sequences, 221(12.2%) matched annotated sequences; however, not enough information was available for them to be classified into one of the nine categories. Therefore, these sequences were termed unclassified. 3.3. The most highly expressed genes in rabbit cartilage The EST frequency of an individual gene corresponds to the expression level of that gene (Kawamoto et al., 2000). Therefore, the 20 most abundantly expressed genes in rabbit cartilage were identified by computing their relative EST frequency levels (Table 3). Because about 90% of cartilage is composed of extracellular matrix, sequences in the high expression group include genes encoding extracellular matrix components, such as proteoglycan (proteoglycan 4, PRG4; decorin, DCN), cartilage oligomeric matrix protein (COMP), matrix Gla protein (MGP), fibronectin (FN), connective tissue growth factor (CTGF), and cartilage intermediate layer protein (CILP). COMP was the most abundant transcript represented by 145 ESTs (about 3% of ESTs) in our library. In addition, our results show that the group of strongly expressed genes in rabbit cartilage encode proteins involved in protein metabolism (cystatin C, elongation factor-1 alpha, ribosomal proteins), metabolism (ferritin H-chain, beta-hexosaminidasebeta-subunit), signal transduction (cytokine-like protein C17, translationally controlled tumor protein-1, osteoglycin, C-type lectin, dualspecificity phosphatase 1), and the immune response (clusterin; lectin, galactoside-binding, soluble, 3 binding protein).
3.2. Functional annotation of known genes Redundancy analysis of the 4885 high quality ESTs with known gene matches resulted in 2387 nonoverlapping sequences. Of these 2387 nonredundant sequences, 1839 matched to previously described genes with a BLASTN E-value of ≤1.0e−4. The sequences that matched characterized gene sequences were classified into ten categories based on their biological roles (Table 2). We used the application AmiGO (http://www.godatabase.org) for the functional classification. Among the 1839 known genes, a large category of transcripts comprised signal transduction-related genes (20.1%), protein metabolism-related genes (19.6%), gene expression-related genes (17.8%), metabolismrelated genes (12.5%), and cell growth- and maintenance-related
3.4. Gene expression analysis of extracellular matrix proteins by EST frequency profiles ESTs for constituents of the extracellular matrix, which comprise about 90% of cartilage tissue, were analyzed separately in the collagen ESTs. Our EST library included nine collagen genes (type I, type II, type III, type V, type X, type XI, type XII, type XVI, and type XXVII; 53 ESTs). Fig. 1 shows that COL10A1, an abundant marker of prehypertrophic and hypertrophic chondrocytes, and COL2A1 (20.8%), an early cartilage matrix-marker upregulated upon chondrocyte differentiation, were strongly expressed in the collagen ESTs. The next most highly expressed genes were COL11A2 (11.3%), encoding type XI
Fig. 1. Relative expression levels of collagen genes. Numbers given indicate the percentage each collagen gene represented in the total collagen clones identified in the rabbit cartilage EST library (N = 53).
150
H.J. Kwon et al. / Gene 424 (2008) 147–152
Fig. 2. Relative expression levels of proteoglycan genes. Numbers given indicate the percentage each proteoglycan gene represented in the total proteoglycan clones identified in the EST library of rabbit cartilage (N = 147). PRG4, proteoglycan 4; DCN, decorin; AGC, aggrecan; PRELP, proline–arginine-rich end leucine-rich repeat protein; SDC2, syndecan2; BGN, biglycan; CSPG2, chondroitin sulfate proteoglycan 2; FMOD, fibromodulin; GPC6, glypican; SDC4, syndecan 4, SGCB, sarcoglycan, beta.
collagen, which is predominantly expressed in the cartilaginous matrices and forms fibrils with type II collagens (Mendler et al., 1989). The remaining collagen transcripts that were identified in our EST library included COL3A1 (9.4%), COL5A2 (7.5%), COL1A2 (3.8%), COL16A1 (3.8%), COL12A1 (1.9%), and COL27A1 (1.9%). Among these collagens, COL16A1 has been suggested to be important in later chondrogenesis and COL27A1 is highly expressed in cartilage, eye, and ear (Sekiya et al., 2002; Pace et al., 2003). Our results identified transcripts encoding 11 different proteoglycans (147 ESTs) (Fig. 2). The highly expressed proteoglycan genes were PRG 4 (56.8%) and DCN (30.1%). Aggrecan, a major early cartilage matrix component, comprised 3.4% of the 147 proteoglycan ESTs. Genes encoding other extracellular matrix proteins besides collagens and proteoglycans were identified (Fig. 3). Transcripts encoding these components of the extracellular matrix comprised
15 different genes (350 ESTs). The major transcripts in this group encoded COMPs (46.3%), MGP (18.6%), CTGF (10.3%), CILP (8.3%), and FN (7.4%), which are abundant in cartilage. 3.5. Real-time PCR based gene expression analysis of extracellular matrix genes We examined the expression of extracellular matrix genes that were abundantly expressed in our EST library over the first 24 weeks of life in rabbits. Gene expression analysis by real-time PCR showed that levels of expression for col2a1 and col10a1 were comparatively lower than prg4, dcn, and comp, which is consistent with our EST data (Fig. 4). These properties may be characteristic of rabbit cartilage that differs from those of other animal models. Furthermore, col2a1 and col10a1 were expressed constantly during growth, whereas prg4,
Fig. 3. Relative expression levels of genes encoding noncollagen/nonproteoglycan constituents of the extracellular matrix. Numbers given indicate the percentage each noncollagen/ nonproteoglycan gene represented in the total noncollagen/nonproteoglycan constituents of the extracellular matrix clones identified in the EST library of rabbit cartilage (N = 350). COMP, cartilage oligomeric matrix protein; MGP, matrix G protein; CTGF, cartilage transformation growth factor; CILP, cartilage intermediate layer protein; FN1, fibronectin 1; CHAD, chondroadherin; PLOD2, procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2; SPARC, secreted protein, acidic, rich cysteine; CHI3L1, chitinase 3-like 1; CILP 2, cartilage intermediate layer protein 2; CHID1, chitinase 1; CHI3L2, chitinase 3-like 2; HAPLN1, cartilage linking protein 1; EFEMP2, EGF-containing fibulin-like extracellular matrix protein 2; LAMA, laminin, alpha 4.
H.J. Kwon et al. / Gene 424 (2008) 147–152
151
Fig. 4. Gene expression patterns of Col2A1, Col10A1, proteoglycan 4, decorin, and COMP in rabbit cartilage at age 6 weeks, 12 weeks, 18 weeks, and 24 weeks. The expression of each gene was measured by quantitative real-time PCR and normalized by GAPDH expression levels. ▲, proteoglycan 4; , decorin; ■, cartilage oligomeric protein; ●, type II collagen; □, type X collagen. Expression values are average of quadruplicate PCR reactions from each sample.
◆
dcn, and comp showed increases in expression to high levels largely in weeks 6–18 and then decreased in weeks 18–24 (Fig. 4). These results indicate that the composition of rabbit cartilage changes during growth, which induces changes in the biochemical and mechanical properties of the cartilage. The gene expression data at six months of age show that prg4, dcn, and comp are more highly expressed than col2a1 and col10a1, and prg4 shows stronger expression than decorin, which is consistent with the results from our EST library. In contrast, comp showed lower expression at six months of age than prg4 or dcn, and col10a1 showed lower expression than col2a1, which is not consistent with the results from our EST library. This indicates that gene expression analysis based on EST frequency may have a limit to reflect the true expression profiles of genes. 4. Discussion Our results show gene expression profiles in cartilage from sixmonth-old Japanese white rabbits. Our EST library of rabbit cartilage showed that extracellular matrix proteins such as proteoglycan, COMP, MGP, FN, CTGF, CILP, and FN are highly expressed. This supports the cartilage specificity of these expression profiles. COMP and MGP are also expressed highly in an EST library of mouse cartilage, and FN is also highly expressed in an EST library of human fetal cartilage (19, 21). COMP is prominent in cartilage; however, it is also present in tendon and binds to type I collagen and type II collagen with high affinity and its normal function is largely unknown (Hedbom et al., 1992; DiCesare et al., 1994; Smith et al., 1997; Rosenberg et al., 1998). PRG 4 is secreted by chondrocytes in the superficial zone of articular cartilage, which are responsible for the lubrication of cartilage, and DCN is produced predominantly by mesenchymal stem cells, binds to type II collagen, and is involved in the control of fibrillogenesis (Schumacher et al., 1994; Demoor-Fossard et al., 2001). MGP has been identified as a calcification inhibitor in cartilage (Luo et al., 1997). CTGF is an abundant growth factor that coordinates chondrogenesis (Ivkovic et al., 2003). FN is a major extracellular matrix protein in cartilage and is an early marker of cartilage development (Imoto et al., 2002; Peter et al., 2002). CILP is an extracellular matrix protein abundant in cartilaginous tissues and inhibits transforming growth factor beta-mediated induction of cartilage matrix genes (Seki et al., 2005). However, although type II collagen showed the highest frequency in EST libraries of mouse and human cartilage (Kumar et al., 2001; Reinholz et al., 2004), in our EST library col2a1 did not have a high
frequency. Gene expression analysis based on real-time PCR also demonstrated that the expression of col2a1 were comparatively low to other main extracellular matrix components over the first 24 weeks of life in rabbits. This may be a characteristic of rabbit cartilage. It is important to understand an each characteristic property of cartilages of animal models for application of the results in study on the animal models to medical treatment of human. HAPLN1 is expressed predominantly in the early stage of cartilage development (Kou and Ikegawa, 2004). However, HAPLN1 shows moderate expression in our EST library of rabbit cartilage. Our EST library construction from the resting and proliferative zones of cartilage can explain why HAPLN1 was moderately expressed. Besides extracellular matrix proteins, it was shown that some proteins involved in protein metabolism, metabolism, signal transduction, and the immune response were strongly expressed in our EST library of rabbit cartilage. C-type lectin is cartilage specific and related to matrix organization (Neame et al., 1999). Osteoglycin is a small leucine-rich proteoglycan abundant in cartilage, bone matrix, and other connective tissues, and has osteoinductive activities (Kurita et al., 1996). Cytokine-like protein C17 has been found in proteome analysis of articular cartilage; however, its function is not known (Hermansson et al., 2004). Translationally controlled tumor protein-1 is also expressed in an EST library of human cartilage (Kumar et al., 2001). Ferritin, which is involved in metabolism, has an important role in juvenile rheumatoid arthritis and is abundant in an EST library of human fetal cartilage and a human chondrocyte cell line (Andreas et al., 2005; Kumar et al., 1999). Lectin, galactoside-binding, soluble, 3 binding protein, is reported to be involved in the attachment, invasion, and destruction of the bone joint (Janelle-Montcalm et al., 2007). This data also supports the cartilage specificity of these expression profiles. Ribosomal proteins and elongation factors are generally abundant housekeeping genes. However, the roles of cystatin C, clusterin, betahexosaminidase-beta-subunit, and dual-specificity phosphatase 1 in cartilage are unknown. Therefore, whether these proteins have specific functions in rabbit cartilage remains to be elucidated. Our results showed that there exist some inconsistencies between real-time PCR based expression data and EST frequency data. Realtime PCR based expression data showed that genes with high EST frequency such as prg4, dcn, and comp show higher expression than genes with low EST frequency such as col2a1 and col10a1. This shows that rough outlines of expression profiles are consistent between two methods. However, detailed comparisons of expression level among genes with high expression, that is, prg4, dcn, and comp or between genes with low expression, that is, col2a1 and col10a1 are not
152
H.J. Kwon et al. / Gene 424 (2008) 147–152
consistent between two methods. This indicates that EST frequencies in our EST data have a limit to reflect expression profiles in detail. It is speculated that this is because EST frequencies are calculated by random fluctuation from the limited number of analyzed ESTs. Despite this limitation of our EST data, the EST analysis shows entire snapshot of gene expression and specifics of transcript expressed in rabbit cartilage. Therefore, most genes with a high frequency of ESTs are important for cartilage formation or metabolism. Genes with an unexpectedly high frequency of ESTs may be components that play unknown but important roles in rabbit cartilage. Further study is needed to elucidate the functions of these genes. Although this is not a study to discover new genetic mechanism, this EST data is useful for future studies on identifying novel genes involved in cartilage formation or repair and making their mechanisms clear. The integration of in vivo and genetic studies in the rabbit model will contribute to elucidating the mechanisms involved in cartilage formation and in developing tissue engineering for cartilage regeneration. Acknowledgments This work was supported by grants from the Grant-in-Aid for Scientific Research (Nos.20240045), from the Ministry of Education, Science and Culture, Japan, and from Takeda Science Foundation, Japan. References Andreas, T., et al., 2005. Expression profiling of human fetal growth plate cartilage by EST sequencing. Matrix Biology 24, 530–538. Brittberg, M., Lindahl, A., Nilsson, A., Ohlsson, C., Isaksson, O., Peterson, L., 1994. Autologous chondrocyte transplantation. N. Engl. J. Med. 331, 889–895. Browne, J.E., et al., 2005. Clinical outcome of autologous chondrocyte implantation at 5 years in US subjects. Clin. Orthop. Relat. Res. 436, 237–245. Cheung, H.S., Cottrell, W.H., Stephenson, K., Nimni, M.E., 1978. In vitro collagen biosynthesis in healing and normal rabbit articular cartilage. J. Bone. Joint. Surg. 60A, 1076–1081. Cremer, M.A., Rosloniec, E.F., Kang, A.H., 1998. The cartilage collagens: a review of their structure, organization, and role in the pathogenesis of experimental arthritis in animals and in human rheumatic disease. J. Mol. Med. 76, 275–288. Demoor-Fossard, M., Galera, P., Santra, M., Iozzo, R.V., Pujol, J.P., Redini, F., 2001. A composite element binding the vitamin D receptor and the retinoic X receptor alpha mediates the transforming growth factor-beta inhibition of decorin gene expression in articular chondrocytes. J. Biol. Chem. 276, 36983–36992. DiCesare, P., Hauser, N., Lehman, D., Pasumarti, S., Paulsson, M., 1994. Cartilage oligomeric matrix protein (COMP) is an abundant component of tendon. FEBS Lett. 354, 237–240. Driesang, I.M., Hunziker, E.B., 2000. Delamination rates of tissue flaps used in articular cartilage repair. J. Orthop. Res. 18, 909–911. Feczko, P., et al., 2003. Experimental results of donor site filling for autologous osteochondral mosaicplasty. Arthroscopy 19, 755–761. Hangody, L., Fules, P., 2003. Autologous osteochondral mosaicplasty for the treatment of full-thickness defects of weight-bearing joints: ten years of experimental and clinical experience. J. Bone Jt. Surg. 85A, 25–32. Hardingham, T., Tew, S., Murdoch, A., 2002. Tissue engineering: chondrocytes and cartilage. Arthritis Res. 4 (suppl 3), S63–S68. Hedbom, E., et al., 1992. Cartilage matrix proteins. An acidic oligomeric protein (COMP) detected only in cartilage. J. Biol. Chem. 267, 6132–6136. Henderson, I., Francisco, R., Oakes, B., Cameron, J., 2005. Autologous chondrocyte implantation for treatment of focal chondral defects of the knee — a clinical, arthroscopic, MRI and histologic evaluation at 2 years. Knee 12, 209–216. Hermansson, M., et al., 2004. Proteomic analysis of articular cartilage shows increased type II collagen synthesis in osteoarthritis and expression of inhibinbA (activin A), a regulatory molecule for chondrocytes. J. Biol. Chem. 279, 43514–43521. Horas, U., Pelinkovic, D., Herr, G., Aigner, T., Schnettler, R., 2003. Autologous chondrocyte implantation and osteochondral cylinder transplantation in cartilage repair of the knee joint: a prospective, comparative trial. J. Bone Jt. Surg. 85A, 185–192.
Imoto, E., Kakuta, S., Hori, M., Yagami, K., Nagumo, M., 2002. Adhesion of a chondrocytic cell line (USAC) to fibronectin and its regulation by proteoglycan. J. Oral. Pathol. Med. 31, 35–44. Ivkovic, S., Yoon, B.S., Popoff, S.N., Safadi, F.F., Libuda, D.E., Stepheson, R.C., 2003. Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development. Development 130 (12), 2779–2791. Janelle-Montcalm, A., et al., 2007. Extracellular localization of galectin-3 has a deleterious role in joint tissues. Arthritis Res. Ther. 9 (1), R20. Jung, Y.K., et al., 2004. Gene expression profile of human chondrocyte HCS-2/8 cell line by EST sequencing analysis. Gene 330, 85–92. Kawamoto, S., et al., 2000. BodyMap: a collection of 3′ ESTs for analysis of human gene expression information. Genome Res. 10, 1817–1827. Knutsen, G., et al., 2004. Autologous chondrocyte implantation compared with microfracture in the knee. A randomized trial. J. Bone Jt. Surg. 86A, 455–464. Kou, I., Ikegawa, S., 2004. SOX9-dependent and -independent transcriptional regulation of human cartilage link protein. J. Biol. Chem. 279, 50942–50948. Kumar, S., et al., 2001. Identification and initial characterization of 5000 expressed sequenced tags (ESTs) each from adult human normal and osteoarthritic cartilage cDNA libaries. Osteoarthr. Cartil. 9, 641–653. Kurita, K., Shinomura, T., Ujita, M., 1996. Occurrence of PG-Lb, a leucine-rich small chondroitin/dermatan sulfate proteoglycan in mammalian epiphyseal cartilage: molecular cloning and sequence analysis of the mouse cDNA. Biochem. J. 318, 909–914. Luo, G., et al., 1997. Spontaneous calcification of arteries and cartilage in mice lacking matrix GLA protein. Nature 386, 78–81. Mendler, M., Eich-Bender, S.G., Vaughan, L., Winterhalter, K.H., Bruckner, P., 1989. Cartilage contains mixed fibrils of collagen types II, IX, and XI. J. Cell Biol. 108, 191–197. Micheli, L.J., et al., 2001. Autologous chondrocyte implantation of the knee: multicenter experience and minimum 3-year follow-up. Clin. J. Sport. Med. 11, 223–228. Neame, P.J., Tapp, H., Grimm, D.R., 1999. The cartilage-derived, C-type lectin (CLECSF1): structure of the gene and chromosomal location. BBA 1446, 193–202. Ochi, M., Adachi, A., Nobuto, H., Yanada, S., Ito, Y., Agung, M., 2004. Articular cartilage repair using tissue engineering technique—novel approach with minimally invasive procedure. Artif. Organs. 28, 28–32. Okihana, H., Yamada, K., 1999. Preparation of a cDNA library and preliminary assessment of 1400 genes from mouse growth cartilage. J. Bone Miner. Res. 14, 304–310. Pace, J.M., Corrado, M., Missero, C., Byers, P.H., 2003. Identification, characterization and expression analysis of a new fibrillar collagen gene, COL27A1. Matrix Biol. 22, 3–14. Peter, J., Sechrist, J., Luetolf, S., Loredo, G., Bronner-Fraser, M., 2002. Spatial expression of the alternatively spliced EIIIB and EIIIA segments of fibronectin in the early chicken embryo. Cell Commun. Adhes. 9, 221–238. Peterson, L., Minas, T., Rittberg, M., Lindahl, A., 2003. Treatment of osteochondritis dissecans of the knee with autologous chondrocyte transplantation: results at two to ten years. J. Bone. Jt. Surg. 85A, 17–24. Redman, S.N., Oldfield, S.F., Archer, C.W., 2005. Current strategies for articular cartilage repair. Eur. Cell Mater. 9, 23–32. Reinholz, G.G., Lu, L., Saris, D.B.F., Yaszemski, M.J., O'Driscoll, S.W., 2004. Animal models for cartilage reconstruction. Biomaterials 25, 1511–1521. Rosenberg, K., Olsson, H., Mörgelin, M., Heinegard, D., 1998. Cartilage oligomeric matrix protein shows high affinity zinc-dependent interaction with triple helical collagen. J. Biol. Chem. 273, 20397–20403. Schumacher, B.L., Block, J.A., Schmid, T.M., Aydelotte, M.B., Kuettner, K.E., 1994. A novel proteoglycan synthesized and secreted by chondrocytes of the superficial zone of articular cartilage. Arch. Biochem. Biophys. 311, 144–152. Seki, S., et al., 2005. A functional SNP in CILP, encoding cartilage intermediate layer protein, is associated with susceptibility to lumbar disc disease. Nat. genet. 37 (6), 607–612. Sekiya, I., Vuoristo, J.T., Larson, B.L., Prockop, D.J., 2002. In vitro cartilage formation by human adult stem cells from bone marrow stroma defines the sequence of cellular and molecular events during chondrogenesis. Proc. Natl. Acad. Sci. U. S. A. 99, 4397–4402. Smith, G.D., Knutsen, G., Richardson, J.B., 2005. A clinical review of cartilage repair techniques. J. Bone. Jt. Surg. 87B, 445–449. Smith, R.K., Zunino, L., Webbon, P., Heinegard, D., 1997. The distribution of cartilage oligomeric matrix protein (COMP) in tendon and its variation with tendon site, age and load. Matrix Biol. 16, 255–271. Ten Koppel, P.G.J., Van Osch, G.J.V.M., Verwoerd, C.D.A., Verwoerd-Verhoef, H.L., 2001. Development of alginate wound dressings linked with hybrid peptides derived from laminin and elastin. Biomaterials 22, 1407–1414. Ueblacker, P., et al., 2007. In vivo analysis of retroviral gene transfer to chondrocytes within collagen scaffolds for the treatment of osteochondral defects. Biomaterials 28 (30), 4480–4487.
Contents lists available at ScienceDirect
Gene j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / g e n e
Gene expression profile of rabbit cartilage by expressed sequence tag analysis Hyuck Joon Kwon a, Hidetoshi Akimoto b, Yoshihiro Ohmiya b, Kenichi Honma c, Kazunori Yasuda a,d,⁎ a
Regenerative Medicine/Tissue Engineering Division, Research Center for Cooperative Projects, Graduate School of Medicine, Hokkaido University, Sapporo, Japan Department of Photobiology, Graduate School of Medicine, Hokkaido University, Sapporo, Japan c Department of Physiology, Graduate School of Medicine, Hokkaido University, Sapporo 060-0810, Japan d Department of Sports Medicine and Joint Surgery, Graduate School of Medicine, Hokkaido University, Kita-15 Nishi-7, Kita-ku, Sapporo 060-8638, Japan b
a r t i c l e
i n f o
Article history: Received 29 May 2008 Received in revised form 22 July 2008 Accepted 29 July 2008 Available online 6 August 2008 Received by A.J. van Wijnen Keywords: Rabbit cartilage Expressed sequence tag (EST) Expression profile Proteoglycan Collagen
a b s t r a c t Although the rabbit is commonly used as an animal model for the in vivo study of cartilage formation or regeneration, genetic approaches to the rabbit cartilage are rare. We constructed an expressed sequence tag (EST) library from rabbit cartilage tissue for the first time to establish the foundations for genetic study on rabbit cartilage. From our results, we identified 2387 unique genes among 4885 clones, corresponding to 1839 matched to characterized genes including 1618 genes with known function and 548 uncharacterized and novel genes. Gene expression profiles based on EST frequency show that type II collagen (COL2A1) and type X collagen (COL10A1) among collagen clones, proteoglycan 4 (PRG4) and decorin (DCN) among proteoglycan clones, and cartilage oligomeric matrix protein (COMP) and matrix Gla protein (MGP) among other extracellular matrix clones, are highly expressed in rabbit cartilage. In addition, gene expression analysis based on real-time PCR of these major extracellular matrix constituents showed that expression of col2a1 and col10a1 remains constant whereas the expression of prg4, dcn, and comp reveals substantial change with rabbit age. This EST library will provide a valuable resource with which to identify genes involved in the biochemical and physiological functions of rabbit cartilage, and will contribute to establishing the rabbit as an animal model for cartilage research. © 2008 Elsevier B.V. All rights reserved.
1. Introduction Articular (hyaline) cartilage, which covers the ends of all synovial joints with a lubricative surface, is a highly organized skeletal tissue with well-characterized histological, biochemical, and biomechanical properties, and allows smooth joint motion even under extreme weight (Cremer et al., 1998). Articular cartilage is frequently damaged due to trauma, pathologic alterations, and age-related degenerations. Recently, therefore, treatment of damaged cartilage is a significant and increasing health care concern. Because cartilage tissue is avascular and alymphatic tissue with low cell density (Hardingham et al., 2002; Cheung et al., 1978), this tissue has a very limited ability to repair itself. Therefore, it has been the prevalent strategy to fill an osteochondral defect with a tissue-engineered cartilage-like tissue or a cell-seeded
Abbreviations: EST, expressed sequence tag; cDNA, complementary DNA; bp, Base pairs; BLAST, Basic Local Alignment Search Tool; E-value, Expectation value; mRNA, Messenger RNA; NCBI, National Center for Biotechnology Information; PCR, Polymerase chain reaction; EST, expressed sequence tag; cDNA, complementary DNA; bp, Base pairs; BLAST, Basic Local Alignment Search Tool; E-value, Expectation value; mRNA, Messenger RNA; NCBI, National Center for Biotechnology Information; PCR, Polymerase chain reaction. ⁎ Corresponding author. Tel.: +81 11 706 7211; fax: +81 11 706 7822. E-mail address: [email protected] (K. Yasuda). 0378-1119/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2008.07.036
scaffold material by implantation surgery since the first report by Brittberg et al. (1994). Under this strategy, a number of studies have been conducted to apply various kinds of cells cultured in various types of scaffolds to create an implantable tissue-engineered cartilage tissue (Peterson et al., 2003; Hangody and Fules, 2003; Horas et al., 2003; Knutsen et al., 2004; Browne et al., 2005; Henderson et al., 2005; Ochi et al., 2004). However, it has been pointed out that this strategy has many problems for current clinical application (Smith et al., 2005; Feczko et al 2003; Driesang and Hunziker, 2000; Micheli et al., 2001; Redman et al., 2005). Thus, functional repair of articular osteochondral defects remains a major challenge for tissue regeneration medicine. Specifically, molecular–biological studies are needed to study cartilage regeneration. Expressed sequence tag (EST) libraries can provide a valuable resource to identify genes that are involved in the biochemical and physiological functions of cartilage. Therefore, construction of EST library from cartilage will be useful for genetic approaches in cartilage research. However, EST dataset from cartilage has been comparatively small because cartilage with the rich extracellular matrix and low density of chondrocytes is inconvenient tissue for the isolation of mRNA. Despite some reports about chondrocyte cell line or human cartilage tissue (Jung et al., 2004; Andreas et al., 2005; Kumar et al., 2001), EST library studies of native cartilage tissue in animal models are rare because it is difficult to obtain enough cartilage from animal models for EST library construction. Although animal models are
148
H.J. Kwon et al. / Gene 424 (2008) 147–152
Table 1 List of primers used in real-time PCR for abundantly expressed extracellular matrix genes isolated from rabbit cartilage plus GAPDH Primer ID
Primers (5′–3′)
COL2A1 II-F COL2A1-R COL10A1-F COL10A1-R PRG 4-F PRG 4-R DCN-F DCN -R COMP-F COMP-R GAPDH-F GAPDH-R
GGTGTGAGTCCAACGCCCCGCCC GTTTGACACGGAGTAGCACCATC GGAGAGCCAGGGTTGCCAG GTCCTCTCTCCCCTTGTTTTCC GAAAGGATTTGGAGGACTAACTGG GCCACCTCTCTTGAAAAAATACAC CTGCGAGAGCTTCACTTGGAC GGAAGCCTTTTTGGTGTTGTAC GACTTCCGGGCCTTCCAGAC GGTCGCTGTTCATGGTCTGC CCCTCAATGACCACTTTGTGAA AGGCCATGTGGACCATGAG
Expect size (bp)
Accession number
95
S83370.1
91
XM_001161595.1
100
XM_001107843.1
159
S76584.1
115
AF325902.1
93
L23961.1
important for the in vivo study of cartilage formation or developing tissue engineering for cartilage regeneration, only cDNA library preparation from mouse growth plate cartilage has been reported previously ( Okihana and Yamada, 1999). However, the mouse is not a suitable animal model for cartilage study because the joint size is too small to create an injured or damaged cartilage model. Thus, the rabbit is generally accepted as a standard model for cartilage research (Reinholz et al., 2004; Ueblacker et al., 2007; Ten Koppel et al., 2001). However, no studies have been reported on EST library construction from rabbit cartilage. Here, we describe the construction of an EST library from rabbit cartilage tissue for the first time. Our EST data shows the characteristics and expression profiles of genes in native cartilage tissue of rabbit. Furthermore, we demonstrate clear expression patterns of some extracellular matrix genes with high EST frequency through real-time PCR in 6–24-week-old rabbits. This study will be useful for genetic approaches in studying the mechanism of cartilage formation and for developing tissue engineering techniques for cartilage regeneration. 2. Materials and methods
converted to double-stranded DNA using a DNA repair enzyme (Invitrogen), in accordance with the manufacturer's instructions. This double-stranded DNA was transformed into Escherichia coli by electroporation, resulting in a normalized library containing 1.4 × 107 clones. 2.3. DNA sequencing and data analysis A total of 5184 cDNA clones from rabbit cartilage were randomly selected and analyzed. The 3′-ends of EST nucleotide sequences were determined and 5′-end EST sequencing was performed commercially by Shimadzu Corp using an RISA-384 multicapillary automated DNA sequencer. Vector-derived and ambiguous sequences were removed from collected EST sequences before computer-assisted analysis. Each sequence was aligned with all other EST sequences in nonredundant (NR) nucleotide sequences using the BLASTN (BLAST nucleotide) program. In general, E-value scores lower than 1.0e−4 were considered significant. 2.4. Real-time PCR analysis of rabbit cartilage Cartilage was obtained from knee joints of Japanese white rabbits aged 6, 12, 18, and 24 weeks. Total RNA was isolated by using TRIzol reagent and an RNA purification kit. RNA concentration was determined using the NanoDrop (NanoDrop Technologies) and reverse transcription reactions were performed with total RNA 0.2 μg using a cDNA synthesis kit (TaKaRa). Real-time PCR reactions for Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), COL2A1, COL10A1, PRG4, DCN, and COMP were conducted using the SYBR green system. Primer-set sequences are described in Table 1. Real-time PCR reactions using the Thermal Cycler Dice Real Time System (TaKaRa) were performed at 95 °C for 10 min, followed by 40 cycles of amplification consisting of denaturation steps at 95 °C for 15 s and extension steps at 60 °C for 1 min. When calculating the efficiency of qPCR primers, we made a standard curve in about 5 fold dilutions, that is, total RNA 100 ng, 20 ng, 4 ng, and 1 ng. We took ct (cycle threshold) value, plot this over the dilution factor and use the slope to calculate efficiency. The expression levels of genes were normalized to GAPDH levels.
2.1. Tissue and RNA purification 3. Results Rabbit cartilage was obtained from shoulder, hip, and knee joints of six-month-old Japanese white rabbits. Total RNA was isolated using TRIzol reagent (Invitrogen) and an RNA purification kit (Qiagen). Purity and integrity of RNA were assessed by absorbance at 260 nm/ 280 nm and agarose gel electrophoresis. The poly (A)+ RNA fraction was isolated with an mRNA isolation kit (Toyobo). 2.2. Construction of cDNA library cDNA was synthesized using the CloneMiner cDNA Library Construction Kit (Invitrogen), as described by the manufacturer. Briefly, we used poly (A)+ RNA to construct the first strand of cDNA using the Biotin-attB2-Oligo(dT) Primer and SuperScript II RT, and synthesized the second strand of cDNA using the first strand of cDNA as a template. The attB1 adapter was ligated to the 5′ end of the cDNA for directional cloning. A directional-cloned cDNA library was constructed in the pDONR 222 vector and then transformed into ElectroMAX DH10B T1 Phage Resistant cells. The doublestranded plasmid library was purified using the Wizard Plus Minipreps DNA Purification System (Promega). After heating at 95 °C for 3 min, 1 μl of 10-times buffer (1.2 M NaCl, 0.1 M Tris–HCl [pH 8], 50 mM ethylenediaminetetraacetic acid, 10% sodium dodecyl sulfate) and 1.5 μl water were added and hybridization was performed at 68 °C for 7 h. The remaining single stranded DNA was purified by hydroxyapatite chromatography at 60 °C and
3.1. Sequencing and analysis of ESTs To analyze expression profiles in rabbit cartilage, 5184 clones from a rabbit cartilage cDNA library were sequenced. The identities of cloned sequences were determined by a BLAST search. The average length of readable sequence was about 500 bps. Each sequence was aligned using BLASTN NCBI public nucleic acid database. Among the 5184 sequenced clones, 4885 were high quality, 31 were poor quality, and 268 were read-fail. Of the 4885 high quality clones, 4203 matched to previously described genes with a BLASTN E-value of ≤1.0e−4.
Table 2 Classification of 1839 rabbit cartilage ESTs into functional categories Functional categories
Number of independent clones
Ratio (%)
Signal transduction Protein metabolism Gene expression Metabolism Cell growth and maintenance Transport Immune response Apoptosis Cell cycle Unclassified
362 354 322 225 204 89 41 12 9 221
20.1 19.6 17.8 12.5 11.3 4.9 2.3 0.7 0.5 12.2
H.J. Kwon et al. / Gene 424 (2008) 147–152 Table 3 The 20 most frequently expressed genes in Rabbit cartilage Rank
Name
Number of ESTs
Percentage
Accession number
1
Cartilage oligomeric matrix protein (COMP) Cystatin C (CST3) Proteoglycan 4 (PRG4) Matrix Gla protein (MGP) Ferritin H-chain (FTH1) Decorin (DCN) Elongation factor 1 alpha (EEF1A1) Cytokine-like protein C17 (CYTL1) Clusterin (CLU) Translationally controlled 1 tumor protein (TPT1) Lectin, galactoside-binding, soluble, 3 binding protein (LGALS3BP) Beta-hexosaminidase-beta-subunit (HEXB) Osteoglycin (OGN) Fibronectin (FN) Connective tissue growth factor (CTGF) C-type lectin (CLEC4F) Cartilage intermediate layer protein (CLIP) Dual specificity phosphatase 1 (DUSP1) Ribosomal protein HL23 (RPHL23) Ribosomal protein S7 (RPS7)
145
2.97
AF325902.1
71 66 65 55 44 44 41 38 25
1.45 1.35 1.33 1.13 0.90 0.90 0.84 0.78 0.51
AB009342.1 XM_001107843.1 D21265.1 M63912.1 S76584.1 U09823.1 XM_001155365.1 AF118852.1 AJ277093.1
23
0.47
U06470.1
21
0.43
AY629244.1
21 18 18
0.43 0.37 0.37
AF487889.1 AF135404.1 NM_001901.2
18 17
0.37 0.35
XM_847555.1 XM_001498168.1
15
0.31
AK232967.1
15 15
0.31 0.31
XM_001501514.1 XM_001503631.1
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
149
genes (11.3%). The small categories comprised transport-related genes (4.9%), immune response-related genes (2.3%), apoptosis-related genes (0.7%), and cell cycle-related genes (0.5%). Of the 1839 sequences, 221(12.2%) matched annotated sequences; however, not enough information was available for them to be classified into one of the nine categories. Therefore, these sequences were termed unclassified. 3.3. The most highly expressed genes in rabbit cartilage The EST frequency of an individual gene corresponds to the expression level of that gene (Kawamoto et al., 2000). Therefore, the 20 most abundantly expressed genes in rabbit cartilage were identified by computing their relative EST frequency levels (Table 3). Because about 90% of cartilage is composed of extracellular matrix, sequences in the high expression group include genes encoding extracellular matrix components, such as proteoglycan (proteoglycan 4, PRG4; decorin, DCN), cartilage oligomeric matrix protein (COMP), matrix Gla protein (MGP), fibronectin (FN), connective tissue growth factor (CTGF), and cartilage intermediate layer protein (CILP). COMP was the most abundant transcript represented by 145 ESTs (about 3% of ESTs) in our library. In addition, our results show that the group of strongly expressed genes in rabbit cartilage encode proteins involved in protein metabolism (cystatin C, elongation factor-1 alpha, ribosomal proteins), metabolism (ferritin H-chain, beta-hexosaminidasebeta-subunit), signal transduction (cytokine-like protein C17, translationally controlled tumor protein-1, osteoglycin, C-type lectin, dualspecificity phosphatase 1), and the immune response (clusterin; lectin, galactoside-binding, soluble, 3 binding protein).
3.2. Functional annotation of known genes Redundancy analysis of the 4885 high quality ESTs with known gene matches resulted in 2387 nonoverlapping sequences. Of these 2387 nonredundant sequences, 1839 matched to previously described genes with a BLASTN E-value of ≤1.0e−4. The sequences that matched characterized gene sequences were classified into ten categories based on their biological roles (Table 2). We used the application AmiGO (http://www.godatabase.org) for the functional classification. Among the 1839 known genes, a large category of transcripts comprised signal transduction-related genes (20.1%), protein metabolism-related genes (19.6%), gene expression-related genes (17.8%), metabolismrelated genes (12.5%), and cell growth- and maintenance-related
3.4. Gene expression analysis of extracellular matrix proteins by EST frequency profiles ESTs for constituents of the extracellular matrix, which comprise about 90% of cartilage tissue, were analyzed separately in the collagen ESTs. Our EST library included nine collagen genes (type I, type II, type III, type V, type X, type XI, type XII, type XVI, and type XXVII; 53 ESTs). Fig. 1 shows that COL10A1, an abundant marker of prehypertrophic and hypertrophic chondrocytes, and COL2A1 (20.8%), an early cartilage matrix-marker upregulated upon chondrocyte differentiation, were strongly expressed in the collagen ESTs. The next most highly expressed genes were COL11A2 (11.3%), encoding type XI
Fig. 1. Relative expression levels of collagen genes. Numbers given indicate the percentage each collagen gene represented in the total collagen clones identified in the rabbit cartilage EST library (N = 53).
150
H.J. Kwon et al. / Gene 424 (2008) 147–152
Fig. 2. Relative expression levels of proteoglycan genes. Numbers given indicate the percentage each proteoglycan gene represented in the total proteoglycan clones identified in the EST library of rabbit cartilage (N = 147). PRG4, proteoglycan 4; DCN, decorin; AGC, aggrecan; PRELP, proline–arginine-rich end leucine-rich repeat protein; SDC2, syndecan2; BGN, biglycan; CSPG2, chondroitin sulfate proteoglycan 2; FMOD, fibromodulin; GPC6, glypican; SDC4, syndecan 4, SGCB, sarcoglycan, beta.
collagen, which is predominantly expressed in the cartilaginous matrices and forms fibrils with type II collagens (Mendler et al., 1989). The remaining collagen transcripts that were identified in our EST library included COL3A1 (9.4%), COL5A2 (7.5%), COL1A2 (3.8%), COL16A1 (3.8%), COL12A1 (1.9%), and COL27A1 (1.9%). Among these collagens, COL16A1 has been suggested to be important in later chondrogenesis and COL27A1 is highly expressed in cartilage, eye, and ear (Sekiya et al., 2002; Pace et al., 2003). Our results identified transcripts encoding 11 different proteoglycans (147 ESTs) (Fig. 2). The highly expressed proteoglycan genes were PRG 4 (56.8%) and DCN (30.1%). Aggrecan, a major early cartilage matrix component, comprised 3.4% of the 147 proteoglycan ESTs. Genes encoding other extracellular matrix proteins besides collagens and proteoglycans were identified (Fig. 3). Transcripts encoding these components of the extracellular matrix comprised
15 different genes (350 ESTs). The major transcripts in this group encoded COMPs (46.3%), MGP (18.6%), CTGF (10.3%), CILP (8.3%), and FN (7.4%), which are abundant in cartilage. 3.5. Real-time PCR based gene expression analysis of extracellular matrix genes We examined the expression of extracellular matrix genes that were abundantly expressed in our EST library over the first 24 weeks of life in rabbits. Gene expression analysis by real-time PCR showed that levels of expression for col2a1 and col10a1 were comparatively lower than prg4, dcn, and comp, which is consistent with our EST data (Fig. 4). These properties may be characteristic of rabbit cartilage that differs from those of other animal models. Furthermore, col2a1 and col10a1 were expressed constantly during growth, whereas prg4,
Fig. 3. Relative expression levels of genes encoding noncollagen/nonproteoglycan constituents of the extracellular matrix. Numbers given indicate the percentage each noncollagen/ nonproteoglycan gene represented in the total noncollagen/nonproteoglycan constituents of the extracellular matrix clones identified in the EST library of rabbit cartilage (N = 350). COMP, cartilage oligomeric matrix protein; MGP, matrix G protein; CTGF, cartilage transformation growth factor; CILP, cartilage intermediate layer protein; FN1, fibronectin 1; CHAD, chondroadherin; PLOD2, procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2; SPARC, secreted protein, acidic, rich cysteine; CHI3L1, chitinase 3-like 1; CILP 2, cartilage intermediate layer protein 2; CHID1, chitinase 1; CHI3L2, chitinase 3-like 2; HAPLN1, cartilage linking protein 1; EFEMP2, EGF-containing fibulin-like extracellular matrix protein 2; LAMA, laminin, alpha 4.
H.J. Kwon et al. / Gene 424 (2008) 147–152
151
Fig. 4. Gene expression patterns of Col2A1, Col10A1, proteoglycan 4, decorin, and COMP in rabbit cartilage at age 6 weeks, 12 weeks, 18 weeks, and 24 weeks. The expression of each gene was measured by quantitative real-time PCR and normalized by GAPDH expression levels. ▲, proteoglycan 4; , decorin; ■, cartilage oligomeric protein; ●, type II collagen; □, type X collagen. Expression values are average of quadruplicate PCR reactions from each sample.
◆
dcn, and comp showed increases in expression to high levels largely in weeks 6–18 and then decreased in weeks 18–24 (Fig. 4). These results indicate that the composition of rabbit cartilage changes during growth, which induces changes in the biochemical and mechanical properties of the cartilage. The gene expression data at six months of age show that prg4, dcn, and comp are more highly expressed than col2a1 and col10a1, and prg4 shows stronger expression than decorin, which is consistent with the results from our EST library. In contrast, comp showed lower expression at six months of age than prg4 or dcn, and col10a1 showed lower expression than col2a1, which is not consistent with the results from our EST library. This indicates that gene expression analysis based on EST frequency may have a limit to reflect the true expression profiles of genes. 4. Discussion Our results show gene expression profiles in cartilage from sixmonth-old Japanese white rabbits. Our EST library of rabbit cartilage showed that extracellular matrix proteins such as proteoglycan, COMP, MGP, FN, CTGF, CILP, and FN are highly expressed. This supports the cartilage specificity of these expression profiles. COMP and MGP are also expressed highly in an EST library of mouse cartilage, and FN is also highly expressed in an EST library of human fetal cartilage (19, 21). COMP is prominent in cartilage; however, it is also present in tendon and binds to type I collagen and type II collagen with high affinity and its normal function is largely unknown (Hedbom et al., 1992; DiCesare et al., 1994; Smith et al., 1997; Rosenberg et al., 1998). PRG 4 is secreted by chondrocytes in the superficial zone of articular cartilage, which are responsible for the lubrication of cartilage, and DCN is produced predominantly by mesenchymal stem cells, binds to type II collagen, and is involved in the control of fibrillogenesis (Schumacher et al., 1994; Demoor-Fossard et al., 2001). MGP has been identified as a calcification inhibitor in cartilage (Luo et al., 1997). CTGF is an abundant growth factor that coordinates chondrogenesis (Ivkovic et al., 2003). FN is a major extracellular matrix protein in cartilage and is an early marker of cartilage development (Imoto et al., 2002; Peter et al., 2002). CILP is an extracellular matrix protein abundant in cartilaginous tissues and inhibits transforming growth factor beta-mediated induction of cartilage matrix genes (Seki et al., 2005). However, although type II collagen showed the highest frequency in EST libraries of mouse and human cartilage (Kumar et al., 2001; Reinholz et al., 2004), in our EST library col2a1 did not have a high
frequency. Gene expression analysis based on real-time PCR also demonstrated that the expression of col2a1 were comparatively low to other main extracellular matrix components over the first 24 weeks of life in rabbits. This may be a characteristic of rabbit cartilage. It is important to understand an each characteristic property of cartilages of animal models for application of the results in study on the animal models to medical treatment of human. HAPLN1 is expressed predominantly in the early stage of cartilage development (Kou and Ikegawa, 2004). However, HAPLN1 shows moderate expression in our EST library of rabbit cartilage. Our EST library construction from the resting and proliferative zones of cartilage can explain why HAPLN1 was moderately expressed. Besides extracellular matrix proteins, it was shown that some proteins involved in protein metabolism, metabolism, signal transduction, and the immune response were strongly expressed in our EST library of rabbit cartilage. C-type lectin is cartilage specific and related to matrix organization (Neame et al., 1999). Osteoglycin is a small leucine-rich proteoglycan abundant in cartilage, bone matrix, and other connective tissues, and has osteoinductive activities (Kurita et al., 1996). Cytokine-like protein C17 has been found in proteome analysis of articular cartilage; however, its function is not known (Hermansson et al., 2004). Translationally controlled tumor protein-1 is also expressed in an EST library of human cartilage (Kumar et al., 2001). Ferritin, which is involved in metabolism, has an important role in juvenile rheumatoid arthritis and is abundant in an EST library of human fetal cartilage and a human chondrocyte cell line (Andreas et al., 2005; Kumar et al., 1999). Lectin, galactoside-binding, soluble, 3 binding protein, is reported to be involved in the attachment, invasion, and destruction of the bone joint (Janelle-Montcalm et al., 2007). This data also supports the cartilage specificity of these expression profiles. Ribosomal proteins and elongation factors are generally abundant housekeeping genes. However, the roles of cystatin C, clusterin, betahexosaminidase-beta-subunit, and dual-specificity phosphatase 1 in cartilage are unknown. Therefore, whether these proteins have specific functions in rabbit cartilage remains to be elucidated. Our results showed that there exist some inconsistencies between real-time PCR based expression data and EST frequency data. Realtime PCR based expression data showed that genes with high EST frequency such as prg4, dcn, and comp show higher expression than genes with low EST frequency such as col2a1 and col10a1. This shows that rough outlines of expression profiles are consistent between two methods. However, detailed comparisons of expression level among genes with high expression, that is, prg4, dcn, and comp or between genes with low expression, that is, col2a1 and col10a1 are not
152
H.J. Kwon et al. / Gene 424 (2008) 147–152
consistent between two methods. This indicates that EST frequencies in our EST data have a limit to reflect expression profiles in detail. It is speculated that this is because EST frequencies are calculated by random fluctuation from the limited number of analyzed ESTs. Despite this limitation of our EST data, the EST analysis shows entire snapshot of gene expression and specifics of transcript expressed in rabbit cartilage. Therefore, most genes with a high frequency of ESTs are important for cartilage formation or metabolism. Genes with an unexpectedly high frequency of ESTs may be components that play unknown but important roles in rabbit cartilage. Further study is needed to elucidate the functions of these genes. Although this is not a study to discover new genetic mechanism, this EST data is useful for future studies on identifying novel genes involved in cartilage formation or repair and making their mechanisms clear. The integration of in vivo and genetic studies in the rabbit model will contribute to elucidating the mechanisms involved in cartilage formation and in developing tissue engineering for cartilage regeneration. Acknowledgments This work was supported by grants from the Grant-in-Aid for Scientific Research (Nos.20240045), from the Ministry of Education, Science and Culture, Japan, and from Takeda Science Foundation, Japan. References Andreas, T., et al., 2005. Expression profiling of human fetal growth plate cartilage by EST sequencing. Matrix Biology 24, 530–538. Brittberg, M., Lindahl, A., Nilsson, A., Ohlsson, C., Isaksson, O., Peterson, L., 1994. Autologous chondrocyte transplantation. N. Engl. J. Med. 331, 889–895. Browne, J.E., et al., 2005. Clinical outcome of autologous chondrocyte implantation at 5 years in US subjects. Clin. Orthop. Relat. Res. 436, 237–245. Cheung, H.S., Cottrell, W.H., Stephenson, K., Nimni, M.E., 1978. In vitro collagen biosynthesis in healing and normal rabbit articular cartilage. J. Bone. Joint. Surg. 60A, 1076–1081. Cremer, M.A., Rosloniec, E.F., Kang, A.H., 1998. The cartilage collagens: a review of their structure, organization, and role in the pathogenesis of experimental arthritis in animals and in human rheumatic disease. J. Mol. Med. 76, 275–288. Demoor-Fossard, M., Galera, P., Santra, M., Iozzo, R.V., Pujol, J.P., Redini, F., 2001. A composite element binding the vitamin D receptor and the retinoic X receptor alpha mediates the transforming growth factor-beta inhibition of decorin gene expression in articular chondrocytes. J. Biol. Chem. 276, 36983–36992. DiCesare, P., Hauser, N., Lehman, D., Pasumarti, S., Paulsson, M., 1994. Cartilage oligomeric matrix protein (COMP) is an abundant component of tendon. FEBS Lett. 354, 237–240. Driesang, I.M., Hunziker, E.B., 2000. Delamination rates of tissue flaps used in articular cartilage repair. J. Orthop. Res. 18, 909–911. Feczko, P., et al., 2003. Experimental results of donor site filling for autologous osteochondral mosaicplasty. Arthroscopy 19, 755–761. Hangody, L., Fules, P., 2003. Autologous osteochondral mosaicplasty for the treatment of full-thickness defects of weight-bearing joints: ten years of experimental and clinical experience. J. Bone Jt. Surg. 85A, 25–32. Hardingham, T., Tew, S., Murdoch, A., 2002. Tissue engineering: chondrocytes and cartilage. Arthritis Res. 4 (suppl 3), S63–S68. Hedbom, E., et al., 1992. Cartilage matrix proteins. An acidic oligomeric protein (COMP) detected only in cartilage. J. Biol. Chem. 267, 6132–6136. Henderson, I., Francisco, R., Oakes, B., Cameron, J., 2005. Autologous chondrocyte implantation for treatment of focal chondral defects of the knee — a clinical, arthroscopic, MRI and histologic evaluation at 2 years. Knee 12, 209–216. Hermansson, M., et al., 2004. Proteomic analysis of articular cartilage shows increased type II collagen synthesis in osteoarthritis and expression of inhibinbA (activin A), a regulatory molecule for chondrocytes. J. Biol. Chem. 279, 43514–43521. Horas, U., Pelinkovic, D., Herr, G., Aigner, T., Schnettler, R., 2003. Autologous chondrocyte implantation and osteochondral cylinder transplantation in cartilage repair of the knee joint: a prospective, comparative trial. J. Bone Jt. Surg. 85A, 185–192.
Imoto, E., Kakuta, S., Hori, M., Yagami, K., Nagumo, M., 2002. Adhesion of a chondrocytic cell line (USAC) to fibronectin and its regulation by proteoglycan. J. Oral. Pathol. Med. 31, 35–44. Ivkovic, S., Yoon, B.S., Popoff, S.N., Safadi, F.F., Libuda, D.E., Stepheson, R.C., 2003. Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development. Development 130 (12), 2779–2791. Janelle-Montcalm, A., et al., 2007. Extracellular localization of galectin-3 has a deleterious role in joint tissues. Arthritis Res. Ther. 9 (1), R20. Jung, Y.K., et al., 2004. Gene expression profile of human chondrocyte HCS-2/8 cell line by EST sequencing analysis. Gene 330, 85–92. Kawamoto, S., et al., 2000. BodyMap: a collection of 3′ ESTs for analysis of human gene expression information. Genome Res. 10, 1817–1827. Knutsen, G., et al., 2004. Autologous chondrocyte implantation compared with microfracture in the knee. A randomized trial. J. Bone Jt. Surg. 86A, 455–464. Kou, I., Ikegawa, S., 2004. SOX9-dependent and -independent transcriptional regulation of human cartilage link protein. J. Biol. Chem. 279, 50942–50948. Kumar, S., et al., 2001. Identification and initial characterization of 5000 expressed sequenced tags (ESTs) each from adult human normal and osteoarthritic cartilage cDNA libaries. Osteoarthr. Cartil. 9, 641–653. Kurita, K., Shinomura, T., Ujita, M., 1996. Occurrence of PG-Lb, a leucine-rich small chondroitin/dermatan sulfate proteoglycan in mammalian epiphyseal cartilage: molecular cloning and sequence analysis of the mouse cDNA. Biochem. J. 318, 909–914. Luo, G., et al., 1997. Spontaneous calcification of arteries and cartilage in mice lacking matrix GLA protein. Nature 386, 78–81. Mendler, M., Eich-Bender, S.G., Vaughan, L., Winterhalter, K.H., Bruckner, P., 1989. Cartilage contains mixed fibrils of collagen types II, IX, and XI. J. Cell Biol. 108, 191–197. Micheli, L.J., et al., 2001. Autologous chondrocyte implantation of the knee: multicenter experience and minimum 3-year follow-up. Clin. J. Sport. Med. 11, 223–228. Neame, P.J., Tapp, H., Grimm, D.R., 1999. The cartilage-derived, C-type lectin (CLECSF1): structure of the gene and chromosomal location. BBA 1446, 193–202. Ochi, M., Adachi, A., Nobuto, H., Yanada, S., Ito, Y., Agung, M., 2004. Articular cartilage repair using tissue engineering technique—novel approach with minimally invasive procedure. Artif. Organs. 28, 28–32. Okihana, H., Yamada, K., 1999. Preparation of a cDNA library and preliminary assessment of 1400 genes from mouse growth cartilage. J. Bone Miner. Res. 14, 304–310. Pace, J.M., Corrado, M., Missero, C., Byers, P.H., 2003. Identification, characterization and expression analysis of a new fibrillar collagen gene, COL27A1. Matrix Biol. 22, 3–14. Peter, J., Sechrist, J., Luetolf, S., Loredo, G., Bronner-Fraser, M., 2002. Spatial expression of the alternatively spliced EIIIB and EIIIA segments of fibronectin in the early chicken embryo. Cell Commun. Adhes. 9, 221–238. Peterson, L., Minas, T., Rittberg, M., Lindahl, A., 2003. Treatment of osteochondritis dissecans of the knee with autologous chondrocyte transplantation: results at two to ten years. J. Bone. Jt. Surg. 85A, 17–24. Redman, S.N., Oldfield, S.F., Archer, C.W., 2005. Current strategies for articular cartilage repair. Eur. Cell Mater. 9, 23–32. Reinholz, G.G., Lu, L., Saris, D.B.F., Yaszemski, M.J., O'Driscoll, S.W., 2004. Animal models for cartilage reconstruction. Biomaterials 25, 1511–1521. Rosenberg, K., Olsson, H., Mörgelin, M., Heinegard, D., 1998. Cartilage oligomeric matrix protein shows high affinity zinc-dependent interaction with triple helical collagen. J. Biol. Chem. 273, 20397–20403. Schumacher, B.L., Block, J.A., Schmid, T.M., Aydelotte, M.B., Kuettner, K.E., 1994. A novel proteoglycan synthesized and secreted by chondrocytes of the superficial zone of articular cartilage. Arch. Biochem. Biophys. 311, 144–152. Seki, S., et al., 2005. A functional SNP in CILP, encoding cartilage intermediate layer protein, is associated with susceptibility to lumbar disc disease. Nat. genet. 37 (6), 607–612. Sekiya, I., Vuoristo, J.T., Larson, B.L., Prockop, D.J., 2002. In vitro cartilage formation by human adult stem cells from bone marrow stroma defines the sequence of cellular and molecular events during chondrogenesis. Proc. Natl. Acad. Sci. U. S. A. 99, 4397–4402. Smith, G.D., Knutsen, G., Richardson, J.B., 2005. A clinical review of cartilage repair techniques. J. Bone. Jt. Surg. 87B, 445–449. Smith, R.K., Zunino, L., Webbon, P., Heinegard, D., 1997. The distribution of cartilage oligomeric matrix protein (COMP) in tendon and its variation with tendon site, age and load. Matrix Biol. 16, 255–271. Ten Koppel, P.G.J., Van Osch, G.J.V.M., Verwoerd, C.D.A., Verwoerd-Verhoef, H.L., 2001. Development of alginate wound dressings linked with hybrid peptides derived from laminin and elastin. Biomaterials 22, 1407–1414. Ueblacker, P., et al., 2007. In vivo analysis of retroviral gene transfer to chondrocytes within collagen scaffolds for the treatment of osteochondral defects. Biomaterials 28 (30), 4480–4487.