- Email: [email protected]
Gene expression profiles of dynamically compressed single chondrocytes and chondrons
Biochemical and Biophysical Research Communications 379 (2009) 738–742
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Gene expression profiles of dynamically compressed single chondrocytes and chondrons Qi Guang Wang a, Julia L. Magnay a, Bac Nguyen b, Colin R. Thomas b, Zhibing Zhang b, Alicia J. El Haj a,*, Nicola J. Kuiper a a b
Guy Hilton Research Centre, Institute for Science & Technology in Medicine, University of Keele, Thornburrow Drive, Hartshill, Stoke-on-Trent ST4 7QB, UK School of Chemical Engineering, University of Birmingham, Edgbaston, Birmingham, UK
a r t i c l e
i n f o
Article history: Received 17 December 2008 Available online 30 December 2008
Keywords: Tissue engineering Cartilage Chondrons Pericellular matrix Chondrocytes Single cell quantitative PCR Biomechanical properties Micromanipulation Cyclic loading Dynamic compression
a b s t r a c t A chondrocyte produces a hydrated pericellular matrix (PCM); together they form a chondron. Previous work has shown that the presence of the PCM influences the biological response of chondrocytes to loading. The objective of this study was to determine the gene expression profiles of enzymatically isolated single chondrocytes and chondrons in response to dynamic compression. Cartilage specific extracellular matrix components and transcription factors were examined. Following dynamic compression, chondrocytes and chondrons showed variations in gene expression profiles. Aggrecan, Type II collagen and osteopontin gene expression were significantly increased in chondrons. Lubricin gene expression decreased in both chondrons and chondrocytes. Dynamic compression had no effect on SOX9 gene expression. Our results demonstrate a clear role for the PCM in interfacing the mechanical signalling in chondrocytes in response to dynamic compression. Further investigation of single chondrocytes and chondrons from different zones within articular cartilage may further our understanding of cartilage mechanobiology. Ó 2009 Published by Elsevier Inc.
Current efforts to induce healing and regeneration of damaged adult cartilage are being directed towards improving existing cell therapies and developing new tissue engineering strategies. Several tissue engineering strategies have been developed but they fall short of achieving the characteristics of native cartilage. In part, this is due to the anisotropic nature of cartilage. It is widely accepted that chondrocytes regulate the composition of their surrounding extracellular matrix in response to load [18]. Many studies have been performed in which chondrocytes have been exposed to a variety of physical stimuli and then examined for changes in gene expression [7,13]. However it is still not clear how load directly influences the behaviour of the chondrocyte. Therefore a better understanding of chondrocyte mechanotransduction is needed to tailor more successful strategies for cartilage tissue engineering. The chondrocyte produces a hydrated pericellular matrix (PCM) which is rich in glycosaminoglycans, proteoglycan and distinct collagens; together they form a ‘chondron’ [19,23]. Although much is known about cartilage as a whole, there is a paucity of information about the biomechanical properties of the chondron and the * Corresponding author. E-mail address: [email protected] (A.J. El Haj). 0006-291X/$ - see front matter Ó 2009 Published by Elsevier Inc. doi:10.1016/j.bbrc.2008.12.111
precise function of its PCM. The presence of the PCM affects every interaction around the cell [5] since soluble and insoluble components such as signalling molecules, proteolytic enzymes, metabolites, nutrients all need to penetrate this matrix to reach the cell membrane. Experimentally, chondrocytes can be isolated with or without a PCM. In the latter case, a newly formed PCM appears within several hours. Previous studies using chondrocytes embedded in agarose [9] or histologically fixed chondrocytes [3] have shown that the newly formed PCM alters the response of chondrocytes to load and deformation. Micropipette aspiration [6], atomic force microscopy [2,15] and cytoindentation [10,12] have been used to further investigate the response of chondrocytes to deformation. Although these methods have provided useful data they have all focussed on local deformation rather than whole cell deformation. Zhang et al. [27] developed an alternative method for monitoring whole single cell deformation and applied it to single biological and non-biological particles ranging from approximately 1 to 100 lm. This technique has been modified to test dynamic compression (cyclic loading) of whole single cells between two parallel surfaces, using a range of compression deformations at a specific frequency [22]. In this study, we investigate how the PCM influences the response of chondrocytes to loading. We combine a single cell PCR
Q.G. Wang et al. / Biochemical and Biophysical Research Communications 379 (2009) 738–742
approach with different levels of dynamic compressive loading to assess the effects on a range of matrix and transcription genes in fully characterised enzymatically isolated chondrons and chondrocytes. Materials and methods Chondrocyte and chondron isolation. Full depth articular cartilage was dissected from the articulating surface of the trochleal humerus of 18-month-old cows. Four separate isolations were performed, each using one humerus. Enzymatic chondrocyte and chondron isolations were performed using our previously published methodology [25]. For chondrocytes, diced cartilage was sequentially digested with 700 U/ml Pronase ETM for 1 h, then 200 U/ml collagenase XI and 0.1 mg/ml DNase 1 for 16 h. For chondrons, diced cartilage was digested with 3.3 U/ml dispase and 560 U/ml collagenase type XI in DMEM for 5 h. Chondrocytes or chondrons were filtered through a 70 lm cell sieve and washed three times in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal calf serum (FCS). These conditions achieved optimal cell viability and cell yield [25]. Single cell handling. Single chondrons or chondrocytes were aspirated into glass micropipettes (1 mm diameter, 25–40 lm at the tip) using a CellTram Oil hydraulic microaspirator (Brinkmann, Westbury, NY). Single cell compression. Twelve single cells were selected and compressed between two parallel surfaces; the flat end of a force probe made of glass fibre and the flat bottom surface of the glass chamber in a micromanipulation compression tester (Fig. 1). Details of this technique are described elsewhere [14,24,27]. The glass probe is connected to a force transducer (406A, Aurora Scientific, Inc.) which has a response of ±500 lN full scale at a resolution of 0.01 lN. The response time is 5 ms. The probe is driven downwards by a vertical stepping motor (Micro Instruments, Oxford, UK), compressing the cell in liquid medium in the glass chamber. During their compression, single cells can be observed microscopically and images can be collected using a high-speed
739
camera (MEMRECAM ci/RX-2, NAC Image Technology, Inc., Japan). Dynamic compression consisted of cyclic loading at cell deformation at or near 20% and 40% (later referred to as ‘‘20%” and ‘‘40%” deformation, respectively) applied at a frequency at or near 0.3 Hz for 10 min. The two levels of deformations represented medium and high mechanical compression levels [16]. After dynamic compression, the cell was collected with the CellTram microaspirator and transferred to a thin-walled PCR tube. Individual cells were either lysed immediately or incubated at 37 °C for 18 h in serum-free DMEM and then lysed, as described below. Cell lysis and reverse transcription (RT). The protocols described below for single cell lysis, reverse-transcription and real-time PCR used an integrated system of reagents supplied by Applied Biosystems/Ambion (Warrington, UK). Each cell was collected in 1 ll serum-free media using the microaspirator, and transferred to a thin-walled RNase-free 0.5 ml PCR tube containing 9 ll ice-cold cDNA II cell lysis buffer (AM8723). Two negative controls were also processed: a media blank control comprising 1 ll DMEM + 9 ll lysis buffer, and a lysis blank control, containing 10 ll lysis buffer. To rupture the cell, the mixture was incubated at 75 °C for 10 min and then placed on ice. To degrade genomic DNA, the lysate was then treated with 0.2 ll RNase-free DNase I (AM2222) at 37 °C for 15 min, followed by 75 °C for 5 min. The RNA was reverse-transcribed in situ using the High Capacity cDNA RT Kit (4374966). In brief, the following kit reagents were added to the entire volume of treated cell lysate (including the negative controls): 2 ll 10 reverse-transcription buffer, 0.8 ll 25 dNTPs, 2 ll 10 random primers, 1 ll MultiScribeTM reverse transcriptase (50 U/ll), 1 ll RNase inhibitor, and 3.2 ll nuclease-free water. The mixture was incubated at 25 °C for 10 min, followed by 37 °C for 120 min. The reaction was terminated at 85 °C for 5 s. A reverse-transcriptase blank control was included, which contained kit reagents only. cDNA pre-amplification and real-time qPCR. All bovine MGB primer/probe mixtures were designed using File Builder 3.1 software and were manufactured by Applied Biosystems. Each MGB primer/ probe mixture was supplied as a 20 concentrate. In total, nine
Fig. 1. (A) Schematic diagram of the micromanipulation compression tester. (B) Side views of a single chondrocyte (a) before compression (b) during compression and (c) after compression (deformation 40%).
740
Q.G. Wang et al. / Biochemical and Biophysical Research Communications 379 (2009) 738–742
genes of interest were studied (Table 1). Six extracellular matrix components were examined; Type II collagen, Type X collagen, aggrecan, hyaluronan, lubricin and osteopontin. Three transcription factors were examined; SOX9, CBFA1 and NF KappaB. Gene expression was normalised to the housekeeping gene 18s rRNA. To multiply gene copy numbers to detectable levels, cDNA was first pre-amplified using TaqManÒ PreAmp Master Mix (4391128). In brief, all stock MGB primer/probe mixes (except 18s rRNA) were pre-diluted together in Tris–EDTA buffer, pH 8.0 (AM9849), to give 0.2 concentration. The pre-amplification reagent comprised 12.5 ll 2 TaqManÒ PreAmp Master Mix and 6.25 ll pooled 0.2 primer/probe mixture per sample. After adding 6.25 ll cDNA (or blank control), the tubes were placed in a PCR thermal cycler and incubated at 95 °C for 10 min. Samples were pre-amplified for 14 cycles (denaturation at 95 °C followed by annealing and extension at 60 °C). The pre-amplified samples were diluted 1:20 with Tris– EDTA buffer. Gene expression was individually quantified for all genes of interest using the Applied Biosytems 7300 Real-Time PCR system. In brief, 12.5 ll TaqMan Universal PCR Master Mix (4304437), 1.25 ll 20 stock MGB primer/probe mix, and 18.75 ll nuclease-free H2O (AM9937) were added to each 6.25 ll pre-amplified, diluted cDNA sample or blank control. Each gene was analysed in parallel with cDNA standards (serially diluted cDNA prepared from bovine chondrocytes). The 18s rRNA content of each sample was determined using 6.25 ll cDNA which had not been pre-amplified. Relative abundance and statistical analysis. A relative abundance value was calculated for each gene measured in each cell [17]. Briefly, the abundance, A, was calculated using the equation:
A ¼ ð1 þ EÞCT
ð1Þ
where E is the calculated amplification efficiency of the target gene and CT is the threshold cycle for that gene. PCR efficiency was Table 1 List of oligonucleotides used for real-time PCR. All oligonucleotides were designed using bovine-specific sequences. Target gene GenBank number Amplicon size
Forward primer sequence Reverse primer sequence Probe sequence
COL2A1 X02420 73 bp
TTGACATTGCACCCATGGACATA CAAGAAGCAGACAGGCCCTAT CACACCGAATTCCTG
AGC1 U76615 73 bp
GGTCACGCTGCCCAACTA GTCATTGGAGCGCATGTTCTG ACGCCACCCTGGAAAT
SOX9 AF278703 76 bp
CCGGTGCGCGTCAAC GCGCCCACACCATGAAG ACGTGCGGCTTGTTCT
Lubricin AF056218 88 bp
ACCTCCACCTCGGAGAMTACT AGTTTTTCCTTCACAGTTGCATCTAGT AATGCCCCAAACTTC
NF KappaB/REKA BC133594 88 bp
GAGCATCATGAAAAAGAGCCCTTTC GGCTGAGCCGCGGTTA CCGGCCTCCAACCC
Osteopontin AF492837 67 bp
GCTTACGGACTGAAGTCAAGATCTA CTGTGGCATCTGGACTCTGAA TTCCGCCGATCTAACG
CBFA1/RUNX2 AF001447 80 bp
GCGCATTCCTCATCCCAGTAT AAGGACTTGGTGCAGAGTTCAG CCGCCTCAGAACCCA
COL10A1 X53556 76 bp
CCATGCTTGGGTAGGTCTGTATAAG CAGGTAGCCCTTGATGTACTCAT ACGGCACCCCTGTAATG
Has2 AB017804 73 bp
ACTGGGTTCTTCCCTTTCTTTCTC GGATGTTCCAAATTTTACCCCTGTAGA ATTGCCACGGTAATCC
calculated by running a standard curve for serially diluted cDNA prepared from bovine chondrocytes. The relative abundance of each gene of interest was calculated using a method adapted from Pfaffl [17]. Statistical analysis. All results are presented as a mean ± standard error of the mean (SEM). Two-factor analysis of variance (ANOVA) was performed to determine whether differences existed between treatment groups. Statistical significance was defined as p < 0.05. Results Biomechanical behaviour Details of the biomechanical behaviour of single chondrocytes and chondrons subject to single compression have been reported elsewhere [16]. Chondrons had larger diameters than chondrocytes, were stiffer and had higher deformation at rupture and higher rupture forces. The PCM appeared to strengthen the chondrons and in general made them stiffer than chondrocytes. ECM gene expression Measurable levels of at least one ECM gene were detected in 96/ 96 cells tested (100%). Of these, 100% expressed 18s, 100% expressed COL2, 93.8% expressed aggrecan, 91.7% expressed lubricin, and 88.5% expressed osteopontin. Fig. 2 shows the four matrix gene expression in chondrocytes and chondrons after dynamic compression of either 20% or 40% cell deformation at 0.3 Hz for 10 min. At both mechanical forces, chondron deformation resulted in a significantly higher level of aggrecan gene expression. Gene expression of both Type II collagen (p = 0.0464) and osteopontin (p = 0.0093) was also significantly increased at 20% and 40% chondron deformation. For 20% chondron deformation, the increase in Type II collagen expression (p = 0.0451) was significantly higher than the control level. By contrast chondrocytes did not show a significant increase in expression of matrix genes in response to either levels of mechanical load imposed. Although osteopontin levels were highly elevated at 40% dynamic compression in chondrocytes, this was not significant. In both chondrocytes and chondrons, cell deformation appeared to decrease lubricin gene expression. Transcription factor gene expression Measurable levels of at least one transcription factor gene were detected in 96/96 cells tested (100%). Of these, 77.1% expressed SOX9, 33.3% expressed CFBA1, 32.3% expressed NF KappaB, 20.1% expressed Has2, and 10.0% expressed COL10. Fig. 3 shows the three transcription factor gene expression in chondrocytes and chondrons after dynamic compression of either 20% or 40% cell deformation. The Has2 and COL10 data were not presented since they were below the level of detection. Mechanical compression appeared to have no significant effect on Sox9 gene expression. Although there was an increasing trend in NF KappaB and CBFA1 expression in chondrocytes at 20% and chondrons at 40%, these levels were not significant. This was potentially due to only one third of samples expressing NF KappaB and CBFA-1. Discussion In this study we have investigated a range of genes before and after mechanical compression by first pre-amplifying cDNA information from single cells and then using PCR-based specific profiling. Our data demonstrate how we can successfully compress
Q.G. Wang et al. / Biochemical and Biophysical Research Communications 379 (2009) 738–742
741
Fig. 2. Gene expression of (A) Type II collagen, (B) aggrecan, (C) lubricin and (D) osteopontin of chondrocytes (white) and chondrons (black) after dynamic compression of either 20% or 40% cell deformation at 0.3 Hz for 10 min. Single cells were either lysed immediately (control) or incubated at 37 °C for 18 h and then lysed. The data were normalised to 18s rRNA and represent mean ± SEM (n = 12). * represents p < 0.05 and ** represents p < 0.01.
single cells using a micromanipulation compression tester and show a positive impact of the native PCM in influencing up regulation of matrix formation in response to mechanical compression.
Chondrocytes from the middle and deep zones produce large amounts of Type II collagen and aggrecan [1]. The ratio of Type II collagen to aggrecan gene expression is reported to be about 13–30 [26]. Using full depth cartilage, we found the ratio of Type
Fig. 3. Gene expression of (A) SOX9, (B) NF KappaB and (C) CBFA1 of chondrocytes (white) and chondrons (black) after dynamic compression of either 20% or 40% cell deformation at 0.3 Hz for 10 min. Single cells were either lysed immediately (control) or incubated at 37 °C and then lysed after 18 h. The data were normalised to 18s rRNA and represent mean ± SEM (n = 12).
742
Q.G. Wang et al. / Biochemical and Biophysical Research Communications 379 (2009) 738–742
II collagen to aggrecan gene expression to be 19 on average. Both genes were more up-regulated in single chondrons than in single chondrocytes. At the higher deformation (40%), the average expression of Type II collagen in chondrons was three-fold higher than chondrocytes. Taken together, these data illustrate that the PCM positively influences expression of these key extracellular matrix genes. Lubricin is a mucinous glycoprotein which is located in the superficial zone where it is responsible for boundary lubrication of articular cartilage [11]. Previous studies have shown that stretch forces up-regulate lubricin gene expression in primary chondrocytes [4]. In our study, we found that dynamic compression decreased lubricin gene expression. This result suggests that compression and strain force may regulate lubricin expression in different ways. Osteopontin is a sulfated phosphoprotein with cell binding and matrix binding properties [20]. It is expressed in a variety of tissues including cartilage and bone. Osteopontin has been demonstrated to be load responsive in skeletal tissues as potentially an early response in the mechanotransduction pathway [8,21]. In our experiments we observed an increase in osteopontin expression in both chondrocytes and chondrons exposed to 40% strain but this was not significant. We did detect a significant increase in osteopontin gene expression in chondrons exposed to 20% strain. These data potentially indicate activation of a generic load signal with and without the PCM. For transcription factor genes, SOX9 gene expression remained constant in both chondrocytes and chondrons during the entire experiment suggesting that there was no change in phenotype. This result agreed with a previous paper which also reported that SOX9 gene expression did not correlate with Type II collagen [1]. Since NF KappaB and CBFA1 gene expression were detected in one third of samples no clear conclusion could be drawn. In conclusion, we have demonstrated that we can isolate, compress and assess gene expression of single cells with and without the PCM. In this study, we have investigated single cells isolated from a homogenous cell population prepared from full depth cartilage. We appreciate that there are inherent limitations to this study such as the fundamental differences amongst individual cells. Therefore in the next series of experiments, we plan further investigation of single chondrocytes and chondrons from different zones within articular cartilage. This will further our understanding of cartilage mechanobiology at the single cell level. Acknowledgment This work was supported by the EPSRC EP/C511727/1. References [1] T. Aigner, P.M. Gebhard, E. Schmid, B. Bau, V. Harley, E. Poschl, SOX9 expression does not correlate with type II collagen expression in adult articular chondrocytes, Matrix Biol. 22 (2003) 363–372. [2] D.M. Allen, J.J. Mao, Heterogeneous nanostructural and nanoelastic properties of pericellular and interterritorial matrices of chondrocytes by atomic force microscopy, J. Struct. Biol. 145 (2004) 196–204. [3] M.D. Buschmann, Y.A. Gluzband, A.J. Grodzinsky, E.B. Hunziker, Mechanical compression modulates matrix biosynthesis in chondrocyte/agarose culture, J. Cell Sci. 108 (Pt. 4) (1995) 1497–1508.
[4] R.H. Das, H. Jahr, J.A. Verhaar, J.C. van der Linden, G.J. van Osch, H. Weinans, In vitro expansion affects the response of chondrocytes to mechanical stimulation, Osteoarthritis Cartilage 16 (2008) 385–391. [5] F. Guilak, L.G. Alexopoulos, M.L. Upton, I. Youn, J.B. Choi, L. Cao, L.A. Setton, M.A. Haider, The pericellular matrix as a transducer of biomechanical and biochemical signals in articular cartilage, Ann. N. Y. Acad. Sci. 1068 (2006) 498–512. [6] F. Guilak, G.R. Erickson, H.P. Ting-Beall, The effects of osmotic stress on the viscoelastic and physical properties of articular chondrocytes, Biophys. J. 82 (2002) 720–727. [7] C.J. Hunter, S.M. Imler, P. Malaviya, R.M. Nerem, M.E. Levenston, Mechanical compression alters gene expression and extracellular matrix synthesis by chondrocytes cultured in collagen I gels, Biomaterials 23 (2002) 1249– 1259. [8] M. Ishijima, Y. Ezura, K. Tsuji, S.R. Rittling, H. Kurosawa, D.T. Denhardt, M. Emi, A. Nifuji, M. Noda, Osteopontin is associated with nuclear factor kappaB gene expression during tail-suspension-induced bone loss, Exp. Cell Res. 312 (2006) 3075–3083. [9] M.M. Knight, J.M. Ross, A.F. Sherwin, D.A. Lee, D.L. Bader, C.A. Poole, Chondrocyte deformation within mechanically and enzymatically extracted chondrons compressed in agarose, Biochim. Biophys. Acta 1526 (2001) 141– 146. [10] E.J. Koay, A.C. Shieh, K.A. Athanasiou, Creep indentation of single cells, J. Biomech. Eng. 125 (2003) 334–341. [11] S.Y. Lee, T. Niikura, A.H. Reddi, Superficial zone protein (lubricin) in the different tissue compartments of the knee joint: modulation by transforming growth factor beta 1 and interleukin-1 beta, Tissue Eng. A 14 (2008) 1799– 1808. [12] N.D. Leipzig, K.A. Athanasiou, Unconfined creep compression of chondrocytes, J. Biomech. 38 (2005) 77–85. [13] S. Maeda, M. Yoshida, H. Hirano, S. Horiuchi, Effects of mechanical stimulation on gene expression of articular chondrocytes in polylayer culture, Tohoku J. Exp. Med. 193 (2001) 301–310. [14] H. Mashmoushy, Z. Zhang, C.R. Thomas, Micromanipulation measurement of the mechanical properties of Baker’s yeast cells, Biotechnol. Tech. 12 (1998) 925–929. [15] L. Ng, H.H. Hung, A. Sprunt, S. Chubinskaya, C. Ortiz, A. Grodzinsky, Nanomechanical properties of individual chondrocytes and their developing growth factor-stimulated pericellular matrix, J. Biomech. 40 (2007) 1011– 1023. [16] V.B. Nguyen, Q.G. Wang, N.J. Kuiper, A.C. El Haj, C.R. Thomas, Z. Zhang, Straindependent viscoelastic behaviour and rupture force of single chondrocytes and chondrons under compression, Biotechnol. Lett., submitted for publication. [17] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [18] C.A. Poole, Articular cartilage chondrons: form, function and failure, J. Anat. 191 (Pt. 1) (1997) 1–13. [19] C.A. Poole, T.T. Glant, J.R. Schofield, Chondrons from articular cartilage. IV: Immunolocalization of proteoglycan epitopes in isolated canine tibial chondrons, J. Histochem. Cytochem. 39 (1991) 1175–1187. [20] O. Pullig, G. Weseloh, S. Gauer, B. Swoboda, Osteopontin is expressed by adult human osteoarthritic chondrocytes: protein and mRNA analysis of normal and osteoarthritic cartilage, Matrix Biol. 19 (2000) 245–255. [21] A. Reich, N. Jaffe, A. Tong, I. Lavelin, O. Genina, M. Pines, D. Sklan, A. Nussinovitch, E. Monsonego-Ornan, Weight loading young chicks inhibits bone elongation and promotes growth plate ossification and vascularization, J. Appl. Physiol. 98 (2005) 2381–2389. [22] R.L. Sah, Y.J. Kim, J.Y. Doong, A.J. Grodzinsky, A.H. Plaas, J.D. Sandy, Biosynthetic response of cartilage explants to dynamic compression, J. Orthop. Res. 7 (1989) 619–636. [23] J. Smirzai, The Concept of the Chondron as a Biomechanical Unit. Biopolymer und Biomechanik von Bindegewebssystemen, Academic Press, New York, 1974. pp. 87–91. [24] C.X. Wang, C. Cowen, Z. Zhang, C.R. Thomas, High-speed compression of single alginate microspheres, Chem. Eng. Sci. 60 (2005) 6649–6657. [25] Q.G. Wang, A.J. El Haj, N.J. Kuiper, Glycosaminoglycans in the pericellular matrix of chondrons and chondrocytes, J. Anat. 213 (2008) 266–273. [26] M. Wong, M. Siegrist, K. Goodwin, Cyclic tensile strain and cyclic hydrostatic pressure differentially regulate expression of hypertrophic markers in primary chondrocytes, Bone 33 (2003) 685–693. [27] Z. Zhang, M.A. Ferenczi, A.C. Lush, C.R. Thomas, A novel micromanipulation technique for measuring the bursting strength of single mammalian cells, Appl. Microbiol. Biotechnol. 36 (1991) 208–210.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Gene expression profiles of dynamically compressed single chondrocytes and chondrons Qi Guang Wang a, Julia L. Magnay a, Bac Nguyen b, Colin R. Thomas b, Zhibing Zhang b, Alicia J. El Haj a,*, Nicola J. Kuiper a a b
Guy Hilton Research Centre, Institute for Science & Technology in Medicine, University of Keele, Thornburrow Drive, Hartshill, Stoke-on-Trent ST4 7QB, UK School of Chemical Engineering, University of Birmingham, Edgbaston, Birmingham, UK
a r t i c l e
i n f o
Article history: Received 17 December 2008 Available online 30 December 2008
Keywords: Tissue engineering Cartilage Chondrons Pericellular matrix Chondrocytes Single cell quantitative PCR Biomechanical properties Micromanipulation Cyclic loading Dynamic compression
a b s t r a c t A chondrocyte produces a hydrated pericellular matrix (PCM); together they form a chondron. Previous work has shown that the presence of the PCM influences the biological response of chondrocytes to loading. The objective of this study was to determine the gene expression profiles of enzymatically isolated single chondrocytes and chondrons in response to dynamic compression. Cartilage specific extracellular matrix components and transcription factors were examined. Following dynamic compression, chondrocytes and chondrons showed variations in gene expression profiles. Aggrecan, Type II collagen and osteopontin gene expression were significantly increased in chondrons. Lubricin gene expression decreased in both chondrons and chondrocytes. Dynamic compression had no effect on SOX9 gene expression. Our results demonstrate a clear role for the PCM in interfacing the mechanical signalling in chondrocytes in response to dynamic compression. Further investigation of single chondrocytes and chondrons from different zones within articular cartilage may further our understanding of cartilage mechanobiology. Ó 2009 Published by Elsevier Inc.
Current efforts to induce healing and regeneration of damaged adult cartilage are being directed towards improving existing cell therapies and developing new tissue engineering strategies. Several tissue engineering strategies have been developed but they fall short of achieving the characteristics of native cartilage. In part, this is due to the anisotropic nature of cartilage. It is widely accepted that chondrocytes regulate the composition of their surrounding extracellular matrix in response to load [18]. Many studies have been performed in which chondrocytes have been exposed to a variety of physical stimuli and then examined for changes in gene expression [7,13]. However it is still not clear how load directly influences the behaviour of the chondrocyte. Therefore a better understanding of chondrocyte mechanotransduction is needed to tailor more successful strategies for cartilage tissue engineering. The chondrocyte produces a hydrated pericellular matrix (PCM) which is rich in glycosaminoglycans, proteoglycan and distinct collagens; together they form a ‘chondron’ [19,23]. Although much is known about cartilage as a whole, there is a paucity of information about the biomechanical properties of the chondron and the * Corresponding author. E-mail address: [email protected] (A.J. El Haj). 0006-291X/$ - see front matter Ó 2009 Published by Elsevier Inc. doi:10.1016/j.bbrc.2008.12.111
precise function of its PCM. The presence of the PCM affects every interaction around the cell [5] since soluble and insoluble components such as signalling molecules, proteolytic enzymes, metabolites, nutrients all need to penetrate this matrix to reach the cell membrane. Experimentally, chondrocytes can be isolated with or without a PCM. In the latter case, a newly formed PCM appears within several hours. Previous studies using chondrocytes embedded in agarose [9] or histologically fixed chondrocytes [3] have shown that the newly formed PCM alters the response of chondrocytes to load and deformation. Micropipette aspiration [6], atomic force microscopy [2,15] and cytoindentation [10,12] have been used to further investigate the response of chondrocytes to deformation. Although these methods have provided useful data they have all focussed on local deformation rather than whole cell deformation. Zhang et al. [27] developed an alternative method for monitoring whole single cell deformation and applied it to single biological and non-biological particles ranging from approximately 1 to 100 lm. This technique has been modified to test dynamic compression (cyclic loading) of whole single cells between two parallel surfaces, using a range of compression deformations at a specific frequency [22]. In this study, we investigate how the PCM influences the response of chondrocytes to loading. We combine a single cell PCR
Q.G. Wang et al. / Biochemical and Biophysical Research Communications 379 (2009) 738–742
approach with different levels of dynamic compressive loading to assess the effects on a range of matrix and transcription genes in fully characterised enzymatically isolated chondrons and chondrocytes. Materials and methods Chondrocyte and chondron isolation. Full depth articular cartilage was dissected from the articulating surface of the trochleal humerus of 18-month-old cows. Four separate isolations were performed, each using one humerus. Enzymatic chondrocyte and chondron isolations were performed using our previously published methodology [25]. For chondrocytes, diced cartilage was sequentially digested with 700 U/ml Pronase ETM for 1 h, then 200 U/ml collagenase XI and 0.1 mg/ml DNase 1 for 16 h. For chondrons, diced cartilage was digested with 3.3 U/ml dispase and 560 U/ml collagenase type XI in DMEM for 5 h. Chondrocytes or chondrons were filtered through a 70 lm cell sieve and washed three times in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal calf serum (FCS). These conditions achieved optimal cell viability and cell yield [25]. Single cell handling. Single chondrons or chondrocytes were aspirated into glass micropipettes (1 mm diameter, 25–40 lm at the tip) using a CellTram Oil hydraulic microaspirator (Brinkmann, Westbury, NY). Single cell compression. Twelve single cells were selected and compressed between two parallel surfaces; the flat end of a force probe made of glass fibre and the flat bottom surface of the glass chamber in a micromanipulation compression tester (Fig. 1). Details of this technique are described elsewhere [14,24,27]. The glass probe is connected to a force transducer (406A, Aurora Scientific, Inc.) which has a response of ±500 lN full scale at a resolution of 0.01 lN. The response time is 5 ms. The probe is driven downwards by a vertical stepping motor (Micro Instruments, Oxford, UK), compressing the cell in liquid medium in the glass chamber. During their compression, single cells can be observed microscopically and images can be collected using a high-speed
739
camera (MEMRECAM ci/RX-2, NAC Image Technology, Inc., Japan). Dynamic compression consisted of cyclic loading at cell deformation at or near 20% and 40% (later referred to as ‘‘20%” and ‘‘40%” deformation, respectively) applied at a frequency at or near 0.3 Hz for 10 min. The two levels of deformations represented medium and high mechanical compression levels [16]. After dynamic compression, the cell was collected with the CellTram microaspirator and transferred to a thin-walled PCR tube. Individual cells were either lysed immediately or incubated at 37 °C for 18 h in serum-free DMEM and then lysed, as described below. Cell lysis and reverse transcription (RT). The protocols described below for single cell lysis, reverse-transcription and real-time PCR used an integrated system of reagents supplied by Applied Biosystems/Ambion (Warrington, UK). Each cell was collected in 1 ll serum-free media using the microaspirator, and transferred to a thin-walled RNase-free 0.5 ml PCR tube containing 9 ll ice-cold cDNA II cell lysis buffer (AM8723). Two negative controls were also processed: a media blank control comprising 1 ll DMEM + 9 ll lysis buffer, and a lysis blank control, containing 10 ll lysis buffer. To rupture the cell, the mixture was incubated at 75 °C for 10 min and then placed on ice. To degrade genomic DNA, the lysate was then treated with 0.2 ll RNase-free DNase I (AM2222) at 37 °C for 15 min, followed by 75 °C for 5 min. The RNA was reverse-transcribed in situ using the High Capacity cDNA RT Kit (4374966). In brief, the following kit reagents were added to the entire volume of treated cell lysate (including the negative controls): 2 ll 10 reverse-transcription buffer, 0.8 ll 25 dNTPs, 2 ll 10 random primers, 1 ll MultiScribeTM reverse transcriptase (50 U/ll), 1 ll RNase inhibitor, and 3.2 ll nuclease-free water. The mixture was incubated at 25 °C for 10 min, followed by 37 °C for 120 min. The reaction was terminated at 85 °C for 5 s. A reverse-transcriptase blank control was included, which contained kit reagents only. cDNA pre-amplification and real-time qPCR. All bovine MGB primer/probe mixtures were designed using File Builder 3.1 software and were manufactured by Applied Biosystems. Each MGB primer/ probe mixture was supplied as a 20 concentrate. In total, nine
Fig. 1. (A) Schematic diagram of the micromanipulation compression tester. (B) Side views of a single chondrocyte (a) before compression (b) during compression and (c) after compression (deformation 40%).
740
Q.G. Wang et al. / Biochemical and Biophysical Research Communications 379 (2009) 738–742
genes of interest were studied (Table 1). Six extracellular matrix components were examined; Type II collagen, Type X collagen, aggrecan, hyaluronan, lubricin and osteopontin. Three transcription factors were examined; SOX9, CBFA1 and NF KappaB. Gene expression was normalised to the housekeeping gene 18s rRNA. To multiply gene copy numbers to detectable levels, cDNA was first pre-amplified using TaqManÒ PreAmp Master Mix (4391128). In brief, all stock MGB primer/probe mixes (except 18s rRNA) were pre-diluted together in Tris–EDTA buffer, pH 8.0 (AM9849), to give 0.2 concentration. The pre-amplification reagent comprised 12.5 ll 2 TaqManÒ PreAmp Master Mix and 6.25 ll pooled 0.2 primer/probe mixture per sample. After adding 6.25 ll cDNA (or blank control), the tubes were placed in a PCR thermal cycler and incubated at 95 °C for 10 min. Samples were pre-amplified for 14 cycles (denaturation at 95 °C followed by annealing and extension at 60 °C). The pre-amplified samples were diluted 1:20 with Tris– EDTA buffer. Gene expression was individually quantified for all genes of interest using the Applied Biosytems 7300 Real-Time PCR system. In brief, 12.5 ll TaqMan Universal PCR Master Mix (4304437), 1.25 ll 20 stock MGB primer/probe mix, and 18.75 ll nuclease-free H2O (AM9937) were added to each 6.25 ll pre-amplified, diluted cDNA sample or blank control. Each gene was analysed in parallel with cDNA standards (serially diluted cDNA prepared from bovine chondrocytes). The 18s rRNA content of each sample was determined using 6.25 ll cDNA which had not been pre-amplified. Relative abundance and statistical analysis. A relative abundance value was calculated for each gene measured in each cell [17]. Briefly, the abundance, A, was calculated using the equation:
A ¼ ð1 þ EÞCT
ð1Þ
where E is the calculated amplification efficiency of the target gene and CT is the threshold cycle for that gene. PCR efficiency was Table 1 List of oligonucleotides used for real-time PCR. All oligonucleotides were designed using bovine-specific sequences. Target gene GenBank number Amplicon size
Forward primer sequence Reverse primer sequence Probe sequence
COL2A1 X02420 73 bp
TTGACATTGCACCCATGGACATA CAAGAAGCAGACAGGCCCTAT CACACCGAATTCCTG
AGC1 U76615 73 bp
GGTCACGCTGCCCAACTA GTCATTGGAGCGCATGTTCTG ACGCCACCCTGGAAAT
SOX9 AF278703 76 bp
CCGGTGCGCGTCAAC GCGCCCACACCATGAAG ACGTGCGGCTTGTTCT
Lubricin AF056218 88 bp
ACCTCCACCTCGGAGAMTACT AGTTTTTCCTTCACAGTTGCATCTAGT AATGCCCCAAACTTC
NF KappaB/REKA BC133594 88 bp
GAGCATCATGAAAAAGAGCCCTTTC GGCTGAGCCGCGGTTA CCGGCCTCCAACCC
Osteopontin AF492837 67 bp
GCTTACGGACTGAAGTCAAGATCTA CTGTGGCATCTGGACTCTGAA TTCCGCCGATCTAACG
CBFA1/RUNX2 AF001447 80 bp
GCGCATTCCTCATCCCAGTAT AAGGACTTGGTGCAGAGTTCAG CCGCCTCAGAACCCA
COL10A1 X53556 76 bp
CCATGCTTGGGTAGGTCTGTATAAG CAGGTAGCCCTTGATGTACTCAT ACGGCACCCCTGTAATG
Has2 AB017804 73 bp
ACTGGGTTCTTCCCTTTCTTTCTC GGATGTTCCAAATTTTACCCCTGTAGA ATTGCCACGGTAATCC
calculated by running a standard curve for serially diluted cDNA prepared from bovine chondrocytes. The relative abundance of each gene of interest was calculated using a method adapted from Pfaffl [17]. Statistical analysis. All results are presented as a mean ± standard error of the mean (SEM). Two-factor analysis of variance (ANOVA) was performed to determine whether differences existed between treatment groups. Statistical significance was defined as p < 0.05. Results Biomechanical behaviour Details of the biomechanical behaviour of single chondrocytes and chondrons subject to single compression have been reported elsewhere [16]. Chondrons had larger diameters than chondrocytes, were stiffer and had higher deformation at rupture and higher rupture forces. The PCM appeared to strengthen the chondrons and in general made them stiffer than chondrocytes. ECM gene expression Measurable levels of at least one ECM gene were detected in 96/ 96 cells tested (100%). Of these, 100% expressed 18s, 100% expressed COL2, 93.8% expressed aggrecan, 91.7% expressed lubricin, and 88.5% expressed osteopontin. Fig. 2 shows the four matrix gene expression in chondrocytes and chondrons after dynamic compression of either 20% or 40% cell deformation at 0.3 Hz for 10 min. At both mechanical forces, chondron deformation resulted in a significantly higher level of aggrecan gene expression. Gene expression of both Type II collagen (p = 0.0464) and osteopontin (p = 0.0093) was also significantly increased at 20% and 40% chondron deformation. For 20% chondron deformation, the increase in Type II collagen expression (p = 0.0451) was significantly higher than the control level. By contrast chondrocytes did not show a significant increase in expression of matrix genes in response to either levels of mechanical load imposed. Although osteopontin levels were highly elevated at 40% dynamic compression in chondrocytes, this was not significant. In both chondrocytes and chondrons, cell deformation appeared to decrease lubricin gene expression. Transcription factor gene expression Measurable levels of at least one transcription factor gene were detected in 96/96 cells tested (100%). Of these, 77.1% expressed SOX9, 33.3% expressed CFBA1, 32.3% expressed NF KappaB, 20.1% expressed Has2, and 10.0% expressed COL10. Fig. 3 shows the three transcription factor gene expression in chondrocytes and chondrons after dynamic compression of either 20% or 40% cell deformation. The Has2 and COL10 data were not presented since they were below the level of detection. Mechanical compression appeared to have no significant effect on Sox9 gene expression. Although there was an increasing trend in NF KappaB and CBFA1 expression in chondrocytes at 20% and chondrons at 40%, these levels were not significant. This was potentially due to only one third of samples expressing NF KappaB and CBFA-1. Discussion In this study we have investigated a range of genes before and after mechanical compression by first pre-amplifying cDNA information from single cells and then using PCR-based specific profiling. Our data demonstrate how we can successfully compress
Q.G. Wang et al. / Biochemical and Biophysical Research Communications 379 (2009) 738–742
741
Fig. 2. Gene expression of (A) Type II collagen, (B) aggrecan, (C) lubricin and (D) osteopontin of chondrocytes (white) and chondrons (black) after dynamic compression of either 20% or 40% cell deformation at 0.3 Hz for 10 min. Single cells were either lysed immediately (control) or incubated at 37 °C for 18 h and then lysed. The data were normalised to 18s rRNA and represent mean ± SEM (n = 12). * represents p < 0.05 and ** represents p < 0.01.
single cells using a micromanipulation compression tester and show a positive impact of the native PCM in influencing up regulation of matrix formation in response to mechanical compression.
Chondrocytes from the middle and deep zones produce large amounts of Type II collagen and aggrecan [1]. The ratio of Type II collagen to aggrecan gene expression is reported to be about 13–30 [26]. Using full depth cartilage, we found the ratio of Type
Fig. 3. Gene expression of (A) SOX9, (B) NF KappaB and (C) CBFA1 of chondrocytes (white) and chondrons (black) after dynamic compression of either 20% or 40% cell deformation at 0.3 Hz for 10 min. Single cells were either lysed immediately (control) or incubated at 37 °C and then lysed after 18 h. The data were normalised to 18s rRNA and represent mean ± SEM (n = 12).
742
Q.G. Wang et al. / Biochemical and Biophysical Research Communications 379 (2009) 738–742
II collagen to aggrecan gene expression to be 19 on average. Both genes were more up-regulated in single chondrons than in single chondrocytes. At the higher deformation (40%), the average expression of Type II collagen in chondrons was three-fold higher than chondrocytes. Taken together, these data illustrate that the PCM positively influences expression of these key extracellular matrix genes. Lubricin is a mucinous glycoprotein which is located in the superficial zone where it is responsible for boundary lubrication of articular cartilage [11]. Previous studies have shown that stretch forces up-regulate lubricin gene expression in primary chondrocytes [4]. In our study, we found that dynamic compression decreased lubricin gene expression. This result suggests that compression and strain force may regulate lubricin expression in different ways. Osteopontin is a sulfated phosphoprotein with cell binding and matrix binding properties [20]. It is expressed in a variety of tissues including cartilage and bone. Osteopontin has been demonstrated to be load responsive in skeletal tissues as potentially an early response in the mechanotransduction pathway [8,21]. In our experiments we observed an increase in osteopontin expression in both chondrocytes and chondrons exposed to 40% strain but this was not significant. We did detect a significant increase in osteopontin gene expression in chondrons exposed to 20% strain. These data potentially indicate activation of a generic load signal with and without the PCM. For transcription factor genes, SOX9 gene expression remained constant in both chondrocytes and chondrons during the entire experiment suggesting that there was no change in phenotype. This result agreed with a previous paper which also reported that SOX9 gene expression did not correlate with Type II collagen [1]. Since NF KappaB and CBFA1 gene expression were detected in one third of samples no clear conclusion could be drawn. In conclusion, we have demonstrated that we can isolate, compress and assess gene expression of single cells with and without the PCM. In this study, we have investigated single cells isolated from a homogenous cell population prepared from full depth cartilage. We appreciate that there are inherent limitations to this study such as the fundamental differences amongst individual cells. Therefore in the next series of experiments, we plan further investigation of single chondrocytes and chondrons from different zones within articular cartilage. This will further our understanding of cartilage mechanobiology at the single cell level. Acknowledgment This work was supported by the EPSRC EP/C511727/1. References [1] T. Aigner, P.M. Gebhard, E. Schmid, B. Bau, V. Harley, E. Poschl, SOX9 expression does not correlate with type II collagen expression in adult articular chondrocytes, Matrix Biol. 22 (2003) 363–372. [2] D.M. Allen, J.J. Mao, Heterogeneous nanostructural and nanoelastic properties of pericellular and interterritorial matrices of chondrocytes by atomic force microscopy, J. Struct. Biol. 145 (2004) 196–204. [3] M.D. Buschmann, Y.A. Gluzband, A.J. Grodzinsky, E.B. Hunziker, Mechanical compression modulates matrix biosynthesis in chondrocyte/agarose culture, J. Cell Sci. 108 (Pt. 4) (1995) 1497–1508.
[4] R.H. Das, H. Jahr, J.A. Verhaar, J.C. van der Linden, G.J. van Osch, H. Weinans, In vitro expansion affects the response of chondrocytes to mechanical stimulation, Osteoarthritis Cartilage 16 (2008) 385–391. [5] F. Guilak, L.G. Alexopoulos, M.L. Upton, I. Youn, J.B. Choi, L. Cao, L.A. Setton, M.A. Haider, The pericellular matrix as a transducer of biomechanical and biochemical signals in articular cartilage, Ann. N. Y. Acad. Sci. 1068 (2006) 498–512. [6] F. Guilak, G.R. Erickson, H.P. Ting-Beall, The effects of osmotic stress on the viscoelastic and physical properties of articular chondrocytes, Biophys. J. 82 (2002) 720–727. [7] C.J. Hunter, S.M. Imler, P. Malaviya, R.M. Nerem, M.E. Levenston, Mechanical compression alters gene expression and extracellular matrix synthesis by chondrocytes cultured in collagen I gels, Biomaterials 23 (2002) 1249– 1259. [8] M. Ishijima, Y. Ezura, K. Tsuji, S.R. Rittling, H. Kurosawa, D.T. Denhardt, M. Emi, A. Nifuji, M. Noda, Osteopontin is associated with nuclear factor kappaB gene expression during tail-suspension-induced bone loss, Exp. Cell Res. 312 (2006) 3075–3083. [9] M.M. Knight, J.M. Ross, A.F. Sherwin, D.A. Lee, D.L. Bader, C.A. Poole, Chondrocyte deformation within mechanically and enzymatically extracted chondrons compressed in agarose, Biochim. Biophys. Acta 1526 (2001) 141– 146. [10] E.J. Koay, A.C. Shieh, K.A. Athanasiou, Creep indentation of single cells, J. Biomech. Eng. 125 (2003) 334–341. [11] S.Y. Lee, T. Niikura, A.H. Reddi, Superficial zone protein (lubricin) in the different tissue compartments of the knee joint: modulation by transforming growth factor beta 1 and interleukin-1 beta, Tissue Eng. A 14 (2008) 1799– 1808. [12] N.D. Leipzig, K.A. Athanasiou, Unconfined creep compression of chondrocytes, J. Biomech. 38 (2005) 77–85. [13] S. Maeda, M. Yoshida, H. Hirano, S. Horiuchi, Effects of mechanical stimulation on gene expression of articular chondrocytes in polylayer culture, Tohoku J. Exp. Med. 193 (2001) 301–310. [14] H. Mashmoushy, Z. Zhang, C.R. Thomas, Micromanipulation measurement of the mechanical properties of Baker’s yeast cells, Biotechnol. Tech. 12 (1998) 925–929. [15] L. Ng, H.H. Hung, A. Sprunt, S. Chubinskaya, C. Ortiz, A. Grodzinsky, Nanomechanical properties of individual chondrocytes and their developing growth factor-stimulated pericellular matrix, J. Biomech. 40 (2007) 1011– 1023. [16] V.B. Nguyen, Q.G. Wang, N.J. Kuiper, A.C. El Haj, C.R. Thomas, Z. Zhang, Straindependent viscoelastic behaviour and rupture force of single chondrocytes and chondrons under compression, Biotechnol. Lett., submitted for publication. [17] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [18] C.A. Poole, Articular cartilage chondrons: form, function and failure, J. Anat. 191 (Pt. 1) (1997) 1–13. [19] C.A. Poole, T.T. Glant, J.R. Schofield, Chondrons from articular cartilage. IV: Immunolocalization of proteoglycan epitopes in isolated canine tibial chondrons, J. Histochem. Cytochem. 39 (1991) 1175–1187. [20] O. Pullig, G. Weseloh, S. Gauer, B. Swoboda, Osteopontin is expressed by adult human osteoarthritic chondrocytes: protein and mRNA analysis of normal and osteoarthritic cartilage, Matrix Biol. 19 (2000) 245–255. [21] A. Reich, N. Jaffe, A. Tong, I. Lavelin, O. Genina, M. Pines, D. Sklan, A. Nussinovitch, E. Monsonego-Ornan, Weight loading young chicks inhibits bone elongation and promotes growth plate ossification and vascularization, J. Appl. Physiol. 98 (2005) 2381–2389. [22] R.L. Sah, Y.J. Kim, J.Y. Doong, A.J. Grodzinsky, A.H. Plaas, J.D. Sandy, Biosynthetic response of cartilage explants to dynamic compression, J. Orthop. Res. 7 (1989) 619–636. [23] J. Smirzai, The Concept of the Chondron as a Biomechanical Unit. Biopolymer und Biomechanik von Bindegewebssystemen, Academic Press, New York, 1974. pp. 87–91. [24] C.X. Wang, C. Cowen, Z. Zhang, C.R. Thomas, High-speed compression of single alginate microspheres, Chem. Eng. Sci. 60 (2005) 6649–6657. [25] Q.G. Wang, A.J. El Haj, N.J. Kuiper, Glycosaminoglycans in the pericellular matrix of chondrons and chondrocytes, J. Anat. 213 (2008) 266–273. [26] M. Wong, M. Siegrist, K. Goodwin, Cyclic tensile strain and cyclic hydrostatic pressure differentially regulate expression of hypertrophic markers in primary chondrocytes, Bone 33 (2003) 685–693. [27] Z. Zhang, M.A. Ferenczi, A.C. Lush, C.R. Thomas, A novel micromanipulation technique for measuring the bursting strength of single mammalian cells, Appl. Microbiol. Biotechnol. 36 (1991) 208–210.