Gene expressions of c-met and hepatocyte growth factor in chronic liver disease and hepatocellular carcinoma

Journal ofHepatology 1996; 24: 286-292 Printed

in Denmark

Munksgaard

All rights

Copyright 0 European Association for the Study of the Liver 1996

reserved

Copenhagen

Journal of Hepatology ISSN 0168.8278

Gene expressions of c-met and hepatocyte growth factor in chronic liver disease and hepatocellular carcinoma Osamu Noguchi’, Nobuyuki Enomoto’, ‘Second Department

Takaaki Ikeda3, Fumie Kobayashi3, Fumiaki Marumo’ and Chifumi Sato’,2

of Internal Medicine and 2Division of Health Science, Faculty of Medicine, Tokyo Medical and Dental University, Bunkyo-ku, Tokyo and ‘Department of internal Medicine, Yokosuka Kyosai Hospital, Yokosuka-shi, Kanagawa, Japan

Background/Aims: The roles of c-met proto-oncogene and hepatocyte growth factor in human livers have not been shown. Methods: Gene expressions of both c-met and hepatocyte growth factor were quantified in livers with chronic active hepatitis and in cirrhotic livers with hepatocellular carcinoma as well as in normal controls, using competitive reverse transcription polymerase chain reaction. Results: C-met expression was significantly increased in chronic active hepatitis compared with control livers, and c-met expression in chronic active hepatitis correlated with serum alanine aminotransferase levels. Hepatocyte growth factor expression was increased in some patients with chronic active hepatitis compared with controls, and there was a significant correlation between cmet expression and hepatocyte growth factor ex-

H

growth factor (HGF) is a potent mitogen for hepatocytes (1). It increases in plasma after partial hepatectomy in mice (2) or experimental liver injury in rats (3). In humans, serum levels of HGF markedly increase in fulminant hepatitis (4,5) and after surgical hepatectomy (6). The HGF is suggested to be derived from non-parenchymal cells, which is still controversial. In primary culture of rat hepatocytes, HGF stimuEPATOCYTE

Received 16 March; revised 4 July; accepted I6 August 1995

Correspondence: Chifumi Sato, M.D., Second Department of Internal Medicine, Faculty of Medicine, Tokyo Medical and Dental University, l-5-45 Yushima, Bunkyo-ku, Tokyo I1 3, Japan.

286

pression. On the other hand, in hepatocellular carcinoma tissues, c-met expression was increased in some cases, while that in the surrounding non-carcinomatous tissues was similar to normal controls. Hepatocyte growth factor expression was not detected in the hepatocellular carcinoma tissues and was low in the surrounding non-carcinomatous tissues. Conclusions: These findings suggest that hepatocyte growth factor may be involved in the regeneration of hepatocytes via paracrine mechanism in chronic active hepatitis, while the regulation of cmet expression in hepatocellular carcinoma tissues may be independent of hepatocyte growth factor stimulation. Key words: Carcinogenesis; Competitive ase chain reaction: Liver regeneration.

polymer-

lates DNA synthesis and induces hepatocyte proliferation (7). HGF has also been shown to contribute to a variety of cell functions, including cell motility (8,9) and cell growth (10). On the other hand, HGF has been shown to suppress the proliferation of neoplastic cell lines such as Hep G2 cells (11). These reports suggest that different cells respond differently to HGF, and analysis of HGF receptors and post-receptor signaling is important. Specific binding of HGF to rat hepatocytes has been observed (12). Recently, receptors for HGF have been identified as the product of c-met protooncogene (13) that was first cloned from GTL-16 gastric tumor cell line (14). C-met is expressed in hepatocytes, and a sequence analysis of c-met cDNA has shown structural features characteristic of the

Gene expressions of c-met and HGF

growth factor receptor tyrosine kinase family associated with phosphatidylinositol 3-kinase (15). Recently, two studies evaluated c-met expression in human hepatocellular carcinoma (HCC) tissues using Northern blot analysis (16,17). In one of these studies, HGF expression was also reported (16). The results of these studies, however, are controversial; Boix et al. (17) reported over-expression of c-met transcripts, whereas Selden et al. (16) reported both over- and under-expression in HCC compared to the non-cancerous part. Furthermore, c-met expression in normal livers and in livers with chronic hepatitis has not previously been described, and the relationship between HGF expression and c-met expression in human liver tissues remains to be elucidated. In the present study, we quantified in vivo expressions of HGF mRNA and c-met mRNA in normal livers and in livers with chronic active hepatitis (CAH) and HCC, as well as surrounding non-carcinomatous tissues, by reverse transcription competitive polymerase chain reaction (RT-cPCR) (18-20) using RNA competitors.

Materials and Methods Patients Liver tissues were obtained by bedside needle biopsy for diagnostic purposes from 14 patients with CAH. Both carcinomatous tissues and non-carcinomatous tissues were obtained by surgical resection from 11 patients with cirrhosis and HCC. All the patients were seropositive for hepatitis C virus antibodies as assessed by the second-generation assay kit. Normal control liver tissues were obtained from four patients who underwent abdominal surgery for suspected malignant diseases, such as gallbladder carcinoma and insulinoma. Tissue samples and sera taken from patients within a week prior to biopsy were stored at -80°C until analysis. Informed consent was obtained from each patient, and the present study conformed to the ethical guidelines of the 1975 Declaration of Helsinki. RNA extraction Total cytoplasmic RNA was isolated from each liver tissue by the acid-guanidinium-phenol-chloroform method (21) and diluted to a final concentration of 1 pg@l* Preparation of RNA competitors Primer sets for internal RNA standards (competitors) for c-met mRNA and HGF mRNA were designed as described by Celi et al. (22). In brief, in addition to the conventional PCR primer sets (HGF-S’/I-IGF-3’)

that were 24 nucleotides in length and corresponded to the target sequences, primers of 42 nucleotides were synthesized, in which 21 nucleotides at the 5’end corresponded to the 3’-end of the HGF-5’ (HGFC), and 21 nucleotides at the 3’-end corresponded to the target sequence 40 nucleotides downstream from the HGF-5’ primer. When reverse transcribed cDNA was amplified using these two sets of primers, HGF5’/ HGF-3’ and HGF-C/I-IGF-3’; for example, PCR products were different in sizes; a 444 bp product (wild type cDNA) was amplified with HGF-S’/I-IGF3’, and a 404 bp product (DNA competitor) was amplified with HGF-C/I-IGF-3’. These two products have identical 5’- and 3’-terminal sequences. Only the 404 bp product lacks a 40 nucleotide segment 24 bp downstream from its 5’-terminal. Primers for the wild cDNA template (cmet-5’/c-met-3’) and for the DNA competitor (c-met-C/c-met-3’) for c-met determination were synthesized with the same primer design. These primers are listed in Table 1. The c-met and HGF wild type cDNAs and the DNA competitors were cloned into plasmids and transcribed using pGEM-T vector system I kit (Promega, Madison, USA). These products were ligated by T4 DNA ligase to pGEM-T plasmid vector that contained a T7 RNA polymerase promoter site, transfected to E. coli (XL-l), and then cultured at 37°C overnight. After harvesting positive colonies, plasmid DNA was purified using the Qiagen plasmid mini-kit (Qiagen Inc., USA) The purified plasmid DNA was linearized by a restriction enzyme Sal 1 (BRL Life Tech. Inc., Gaithersburg, USA), transcribed to RNA fragments using Transcription In Vitro System (Promega), and purified by spin filtration columns (Quick Spin Columns Sephadex G-25, Boehringer Mannheim Biochemica, Germany); Finally, RNA fragments were quantified using conventional methods, and diluted to desired concentrations. Competitive RT-PCR One microgram of total RNA from each sample and 100 fg of either c-met mRNA or HGF mRNA competitor were reverse-transcribed in 5 yl of a mixture that contained 50 pg of the downstream primer, 10 U of a RNase inhibitor (Promega), 50 U of Moloney murine leukemia virus reverse transcriptase (BRL Life Tech. Inc.), 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl,, and 10 mM dithiothreitol. Samples were incubated for 45 min at 37’C, heated up to 94°C for 5 min, and cooled down to 4°C The sequences of the primers are shown in Table 1. These reverse-transcribed products were amplified by PCR 287

0. Noguchi et al. TABLE 1 Primer sequences for c-met and HGF reverse transcription competitive polymerase chain reaction Primer

Base pairs

Oligonucleotide primer sequence

Size of PCR product (bp)

c-met PCR 5’ c-met PCR competitor c-met PCR 3’ c-met RT primer HGF PCR 5’ HGF PCR competitor HGF PCR 3’ HGF RT mimer

1921-1945 1924-1945, 1986-2006 2376-2400 2390-2400 991 -1014 991 -1014, 1055-1075 1411-1434 1425-1434

S’>TCAAATGGCCACGGGACAACACAA<3’ 5’>AATGGCCACGGGACAACACAAACTTT’ACTTACTTTAACTGG~3‘ 5’>TGCl-l-CATGCACATTTATGACCAT<3’ S’>TTATGACCAT<3’ S’>CATGACATGACTCCTGAAAATITC<3 S’>CATGACATGACTCCTGAAAATTTCTCTGAATCACCCTGGTG’MTT<3 S>GACTATTGTAGGTGTGGTATCACC>3’ S’>TGGTATCACC<3’

480 437

(23) in 25 pl of a PCR mixture containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM M&l,, 200 pM of each dNTP, 0.5 U of Taq DNA polymerase (AmpliTaq, Cetus Corp., Emeryville, USA), 400 nM of each primer set for either HGF or c-met. Amplification was performed in an automated thermal cycler (Perkin Elmer, USA) for 45 cycles. Each cycle was composed of denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and polymerization at 72°C for 2 min. Five microliters of PCR products and molecular weight markers were subjected to electrophoresis on 2% agarose gels and visualized by means of ethidium bromide (1 pg/ml) staining. When target cDNA fragments were detected together with their competitors at the predicted position on agarose gels, 0.1 l.tl of. 32P-a-dCTP (DuPont/NEN Research Products, USA) together with 0.5 U of Taq DNA polymerase, and the same PCR buffer was added to each tube and 5 cycles of amplification were performed again. At the end of the reaction, samples were heated up to 94°C for 10 min. PCR products were subjected to 5% polyacrylan-tide gel electrophoresis and radioisotope activities were measured with an image analyzer (BAS 2000; Hitachi, Japan). The ratio of radioactivity for the amplified target cDNA fragment and the DNA competitor was calculated, and the original concentration of the sample mRNA was estimated by the calibration curve described below.

QuantiJication of PCR products Methods for the quantification of c-met and HGF mRNA were based on the idea described by Zachar et al. (24). Fig. 1 shows the results of cPCR for c-met and HGF when 100 fg of RNA competitors were coamplified with a series of 10 fg to 10 pg of wild RNA templates. Standard curves were drawn as plots of the log of ratios of PCR products amplified from 288

444 404

the wild type and the competitor (an internal standard) template (ordinate) against the log of known amounts of the wild type template standard (abscissa) (Fig. 2). Correlation coefficients (adjusted r squared) were 0.963 and 0.981 for c-met and HGF, respectively, and the linearity for quantification was highly confirmed. Final concentrations of each mRNA were expressed in pg per 1 pg of total sample RNA. Since the ratio of products (the wild type/the competitor) during any cycles of amplification depends solely on the ratio of the initial templates, direct comparison of mass ratios of the products in unknown samples with corresponding ratios determined from known standard samples can be accurately performed, and the quantity of the wild type template originally present in any samples can be estimated from each calibration curve. Statistics All data were analyzed using the statistical programs Stat View 4.0 (Abacus Concepts, Inc., Berkeley,

Hepatocyte Growth Factor

c-met

Fig. 1. Competitive polymerase chain reaction for c-met mRNA and HGF mRNA. One hundred fg (1~log) of the RNA competitor for c-met was coamplijed with a series of IO fg to IO pg (Irag to IO-“g) of the wild type c-met cDNA.

Gene expressions of c-met and HGF

When HGF expression was plotted against c-met expression, they were well correlated to each other in CAH (?=0.73: Fig. 4A), whereas c-met and HGF expressions in HCC were unproportional (Fig. 4B).

log(tild

template f&l)

logWild

remplalc f&l)

Fig. 2. Standard curves for wild type cDNA for c-met (A) and HGF mRNA (B) in liver tissues. Log plotting of wild type cDNA ranging from IO fg/@ to IO pg/cLl against radioactivity ratio of amplified wild type cDNA and competitor

Fig. 3. Expression of c-met mRNA (A) and HGF mRNA (B) in various liver diseases. *p
USA), and the analysis of variance

was employed

to

Serum ALT levels and expressions of c-met and HGF in CAH It has been suggested that expressions of c-met and HGF may be triggered by necro-inflammatory activity in the surrounding liver tissues. Therefore, we compared expressions of these factors to serum ALT levels in CAH (Fig. 5). There was a mild correlation between serum ALT levels and c-met expression (?=0.368; Fig. 5A), while there were no apparent correlations between serum ALT levels and HGF expression (?=O. 132; Fig. 5B).

Fig. 4. Relation between c-met mRNA and HGF mRNA in chronic active hepatitis (A) and in hepatocellular carcinomas (HCC) (cancerous portions and non-cancerous portions) (B). Correlation coefiency in chronic active hepatitis is r2=0.733.

assess statistical significances.

Results c-met, and HGF expressions in CAH and HCC tis-

sues C-met expression in CAH was significantly higher than that in normal liver tissues (0.84kO.12 vs 0.26fo.15 pg/pg total RNA, ~~0.05; Fig. 3A). Although some of the CAH samples showed higher HGF expression than the normal samples, there was no statistical significance between these two groups (0.4OkO.13 vs 0.16kO.12 pg&g total RNA; Fig. 3B). C-met expression in the carcinomatous portions of HCC samples was higher than that in the surrounding non-cancerous tissues (0.41kO.20 vs 0.08kO.02 pg@g total RNA; Fig. 3A), while HGF expression in the carcinomatous tissues was below the detection limit (co.01 pg/ug total RNA; Fig. 3B).

0

0.5

I c-met (p&g

15

2

tolal mRNA)

2.5

0

0.5 HGF (p&g

I

I5

2

total mRNA)

Fig. 5. Relation between serum alanine aminotransferase (ALT) levels and c-met mRNA in live tissues (A) or HGF mRNA in liver tissues (B). There is a mild correlation between serum ALT levels and c-met expression (?=0.368), while there are no apparent correlations between serum ALT levels and HGF expression (3=0. 132).

289

0. Noguchi

et al.

Discussion The receptor for HGF has recently been characterized as the product of a protooncogene, c-met, which is expressed in hepatocytes (13). Since then, gene expression of c-met after partial hepatectomy or Ccl,-induced hepatic necrosis (25,26) and its influence on hepatic differentiation (27) have been studied in rats. Gene expression of c-met in human livers, however, has not been well documented. In the present study, c-met expression was observed in normal livers. It was increased in CAH compared with normal livers and correlated with serum ALT levels that are a clinical indicator for the necroinflammatory activity in the liver. These findings have not previously been reported. HGF expression was increased in some cases of CAH. Furthermore, HGF expression correlated with c-met expression in CAH. Tsubouchi et al. have reported that serum HGF levels in CAH are slightly higher than in normal controls (28). Elevated serum HGF levels in CAH may be the consequence of increased synthesis under continuous hepatocyte damage. Unlike fulminant hepatic failure, in which massive hepatocyte damage takes place and serum HGF levels are markedly increased (29) hepatocyte damage through hepatitis activity is relatively mild in CAH. Since HGF producing cells are suggested to be non-parenchymal cells (30), HGF expression in nonparenchymal cells including Kupffer cells may be triggered and HGF protein synthesis provoked based on the degree of hepatocyte necro-inflammatory activity. Consequently, newly synthesized HGF is released in the surrounding area as a paracrine messenger for hepatocyte proliferation. When c-met in hepatocytes within active hepatitis lobules is stimulated, hepatocyte proliferation may take place. Although mechanisms or factors inducing HGF and c-met still remain to be investigated, our findings suggest that there are continuous stimuli for hepatocyte regeneration via HGF/c-met interaction in CAH tissues. In a recent in vitro study, HGF has been shown to up-regulate c-met expression (31). Recently, two studies evaluated c-met expression in HCC tissues using Northern blot analysis (16,17). Boix et al. reported that c-met mRNA was overexpressed in eight out of 18 HCC tissues compared with the surrounding liver tissues (16). On the other hand, Selden et al. showed both over- and underexpressions of c-met in HCC tissues compared with non-carcinomatous tissues, studying only three cases of HCC (17). In their studies, normal control livers were not examined. In the present study, we have demonstrated that c-met expression in HCC tissues is 290

increased in some cases, while that in the surrounding non-carcinomatous tissues is similar to normal controls. In HCC, we have observed an interesting phenomenon. In the surrounding non-carcinomatous tissues, expressions of both c-met and HGF were observed, although levels of the expression were relatively lower. However, in the carcinomatous portion of HCC, expressions of these two factors were unproportional. There was no detectable expression of HGF, whereas in some cases, c-met expression was high. Several reports have shown that there is an over-expression of c-met in some malignant tissues, such as gastric tumors (32) thyroid tumors (33,34), and several cell lines derived from different types of Hodgkin’s disease (35). There seems to be more than one cause for over-expression of c-met in malignant tissues. In gastric tumors, gene amplification was observed by Southern blotting (32), although in thyroid tumors, there was no gene amplification nor rearrangement (33). The mechanism of this over-expression of c-met in HCC tissue has not yet been investigated. HGF-producing cells are suggested to be nonparenchymal cells. In Hep G2 cells, which are derived from human hepatoblastoma cells, overexpression of c-met and almost no expression of HGF were observed (unpublished observations). Non-parenchymal cells are scarcely detected within HCC nodules, and neoplastic hepatocytes do not produce HGF. This may lead us to assume that autocrine mechanisms of HGF/c-met interactions are unlikely to be the major stimulus for neoplastic cell growth in HCC and that the regulation of c-met expression in HCC is enhanced independently of HGF stimulation. In neoplastic cell lines such as Hep G2 cells, however, HGF has been shown to suppress their proliferation (11). Post-receptor signaling in these cells has been reported to be different from cultured normal hepatocytes (36). Therefore, characteristics of receptors and post-receptor signaling remain to be studied to further clarify the response of HCC cells to HGF. We have employed the RT-competitive PCR method because this technique is highly sensitive in detecting very small amounts (pg to fg) of RNA transcripts. This is comparable to the Northern blotting technique, yet it is more accurate in quantitative analysis (24). Once RNA competitor templates are synthesized, only a simple routine procedure is required to quantify a number of samples with satisfactory quality. In the present study, the RT-PCR method included 45 cycles. It is known that non-specific reactions sometimes occur when cycle numbers are

Gene e.rpressions

increased in PCR. When initial DNA concentrations are low, however, these non-specific reactions could be avoided. As shown in Fig. 1, there are no non-specific reactions under the present experimental conditions. The standard curves in Fig. 2 show that the reaction is linear in DNA concentrations utilized in the present study. In the present study, liver samples obtained by needle biopsy were analyzed. Since HGF is suggested to be produced by non-parenchymal cells and c-met is expressed in hepatocytes, the ratio of parenchymal/non-parenchymal cells might affect the present findings. In conclusion, HGF may be involved in the regeneration of hepatocytes via paracrine mechanism in CAH, while in HCC tissues, the regulation of c-met expression may be enhanced independently of HGF stimulation.

Acknowledgement Part of this study was supported by a Grant-in-Aid (05454243) from the Ministry of Education, Science, Sports, and Culture of Japan.

References 1. Nakamura T, Nishizawa T, Hagiya M, Seki T, Shimonishi M, Sugimura A, Tashiro K, Shimizu S. Molecular cloning and expression of human hepatocyte growth factor. Nature 1989; 342: 440-3. 2. Gohda E, Hayashi Y, Kawaida A, Tsubouchi H, Yamamoto I. Hepatotrophic growth factor in blood of mice treated with carbon tetrachloride. Life Sci 1990; 46: 1801-g. of ‘hepa3. Selden C, Hodgson HJ. Further characterization totropin’, a high molecular weight hepatotrophic factor in rat serum. J Hepatol 1989; 9: 167-76. 4. Tsubouchi H, Hirono S, Gohda E, Nakayama H, Takahashi K, Sakiyama 0, Miyazaki H, Sugihara J, Tomita E, Muto Y, Daikuhara Y, Hashimoto S. Clinical significance of human hepatocyte growth factor in blood from patients with fulminant hepatic failure [see comments]. Hepatology 1989; 9: 875-81. 5. Hughes RD, Gove CD, Williams R. Hepatocyte growth factor in fulminant hepatic failure [letter; comment]. Hepatology 1990; 11: 332-3. 6. Tomiya T, Tani M, Yamada S, Hayashi S, Umeda N, Fujiwara K. Serum hepatocyte growth factor levels in hepatectomized and nonhepatectomized surgical patients. Gastroenterology 1992; 103: 16214. 7. Zarnegar R, Michaelopoulos G. Purification and biological characterization of human hepatopoietin A, a polypeptide growth factor for hepatocytes. Cancer Res 1989; 49: 331420. 8. Stoker M. Effect of scatter factor on motility of epithelial cells and fibroblasts. J Cell Physiol 1989; 139: 565-9. 9. Rosen EM, Carley W, Goldberg ID. Scatter factor regulates vascular endothelial cell motility. Cancer Invest 1990; 8: 647-50.

of c-met and HGF

10. Stem CD, Ireland GW, Henick SE, Gherardi E, Gray J, Perryman M, Stoker H. Epithelial scatter factor and development of the chick embryonic axis. Development 1990; 110: 1271-84. 11. Tajima H, Matsumoto K, Nakamura T. Hepatocyte growth factor has potent anti-proliferative activity in various tumor cell lines. FEBS Lett 1991; 291: 229-32. 12. Arakaki N, Hirono S, Ishii T, Kimoto M, Kawakami S, Nakayama H, Tsubouchi H, Hishida T, Daikuhara Y. Identification and partial characterization of two classes of receptors for human hepatocyte growth factor on adult rat hepatocytes in primary culture. J Biol Chem 1992; 267: 7101-7. 13. Bottaro DP, Rubin JS, Faletto DL, Chan AM, Kmiecik TE, Vande Woude GF, Aaronson SA. Identification of the hepatocyte growth factor receptor as the c-met protooncogene product. Science 1991; 25 1: 8024. 14. Giordano S, DiRenzo M, Narsimhan RP, Cooper CS, Rosa C, Comoglio PM Biosynthesis of the protein encoded by the cmet proto-oncogene. Oncogene 1989; 4: 1383-8. 15. Graziani A, Gramaglia D, Cantley LC, Comoglio PM. The tyrosine-phosphorylated hepatocyte growth factor/scatter factor receptor associates with phosphatidylinositol3kinase. J Biol Chem 1991; 266: 22087-90. 16. Selden C, Famaud S, Ding SF, Habib N, Foster C, Hodgson HJF. Expression of hepatocyte growth factor mRNA, and cmet mRNA (hepatocyte growth factor receptor) in human liver tumours. J Hepatol 1994; 21: 227-37. 17. Boix L, Rosa JL, Ventura F, Castells A, Bruix J, Rodes J, Bartrons R. C-met mRNA overexpression in human hepatocellular carcinoma. Hepatology 1994; 19: 88-9 1. 18. Dukas K, Sarfati P, Vaysse N, Pradayrol L. Quantitation of changes in the expression of multiple genes by simultaneous polymerase chain reaction. Anal Biochem 1993; 215: 66-72. A, Bachmann E, 19. Knecht H, Joske DJ, Emery-Goodman Bachmann F, Odermatt BE Expression of human recombination activating genes (RAG- 1 and RAG-2) in Hodgkin’s disease. Blood 1992; 80: 2867-72. 20. Peten EP, Striker LJ, Carome MA, Elliott SJ, Yang CW, Striker GE. The contribution of increased collagen synthesis to h,uman glomerulosclerosis: a quantitative analysis of alpha 21V collagen mRNA expression by competitive polymerase chain reaction. J Exp Med 1992; 176: 1571-6. 21. Chomczynski P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform ex. traction. Anal Biochem 1987; 62: 156-9. 22. Celi FS, Zenilman ME, Shuldiner AR. A rapid and versatile method to synthesize internal standards for competitive PCR. Nucleic Acids Research 1993; 21: 1047. 23. Saiki RK, Gelfaud DH, Steffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988; 239: 487-91. 24. Zachar V, Thomas RA, Goustin AS. Absolute quantification of target DNA: a simple competitive PCR for efficient analysis of multiple samples. Nucleic Acids Research 1993; 21: 2017-g. 25. Hoshino Y, Enomoto N, Sakamoto N, Kurosaki M, Ikeda T, Marumo F, Sato C. Expression of the hepatocyte growth factor receptor in the regenerating rat liver. Cancer Lett 1993; 71: 119-23. 26. Ito T, Hayashi N, Horimoto M, Sasaki Y, Tanaka Y, Kaneko A, Fusamoto H, Kamada T. Expression of the c-metmepato-

291

0. Noguchi et al.

27.

28.

29.

30.

292

cyte growth factor receptor genes during rat liver regeneration induced by carbon tetrachloride. Biochem Biophys Res Commun 1993; 190: 870-4. Hu Z, Evarts RP, Fuji0 K, Marsden ER, Thorgeirsson SS. Expression of hepatocyte growth factor and c-met genes during hepatic differentiation and liver development in the rat. Am J Path01 1993; 142: 1823-30. Tsubouchi H, Niitani Y, Hirono S, Nakayama H, Gohda E, Arakaki N, Sakiyama 0, Takahashi K, Kimoto M, Kawakami S, Setoguchi M, Tachikawa T, Shin S, Arima T, Daikuhara Y. Levels of the human hepatocyte growth factor in serum of patients with various liver diseases determined by an enzyme-linked immunosorbent assay. Hepatology 1991; 13: 1-5. Tsubouchi H, Hirono S, Gohda E, Nakayama H, Takahashi K, Sakiyama 0, Kimoto M, Kawakami S, Miyoshi H, Kubozono 0, Kawarada Y, Mizumoto R, Arakaki N, Daikuhara Y, Hashinoto S. Human hepatocyte growth factor in blood of patients with fulminant hepatic failure. I. Clinical aspects. Dig Dis Sci 1991; 36: 780-4. Noji S, Tashiro K, Koyama E, Nohno T, Ohyama K, Taniguchi S, Nakamura T. Expression of hepatocyte growth factor gene in endothelial and Kupffer cells of damaged rat livers, as revealed by in situ hybridization. Biochem Biophys Res Commun 1990: 173: 42-7.

31. de Juar C, Sanchez A, Nakamura T. Hepatocyte growth factor up-regulates met expression in rat fetal hepatocytes in primary culture. Biochem Biophys Res Commun 1994; 204: 1364-70. 32. Houldsworth J, Cordon CC, Ladanyi M, Kelsen DP, Chaganti RS. Gene amplification in gastric and esophageal adenocarcinomas. Cancer Res 1990; 50: 6417-22. 33. Di Renzo MF, Oliver0 M, Ferro S, Prat M, Bongarzone I, Pilotti S, Belfiore A, Costantino A, Vigneri R, Rierott MA. Overexpression of the c-Met/HGF receptor gene in human thyroid carcinomas. Oncogene 1992; 7: 2549-53. 34. Di Renzo MF, Narsimhan RP, Oliver0 M, Bretti S, Giordano S, Medico E,Caglia P, Zara P, Comoglio PM. Expression of the MeUI-IGF receptor in normal and neoplastic human tissues. Oncogene 199 1; 6: 1997-2003. 35. Jucker M, Schaadt M, Diehl V, Poppema S, Jones D, Tesch H. Heterogeneous expression of proto-oncogenes in Hodgkin’s disease derived cell lines. Hematol Oncol 1990; 8: 191204. 36. Okano Y, Mizuno K, Osada S, Makamura T, Nozawa Y. Qrosine phosphorylation of phospholipase Cy in c-met/I-IGF receptor-stimulated hepatocytes: comparison with Hep G2 hepatocarcinoma cells. Biochem Biophys Res Comrnun 1993: 190: 842-8.