Gene replacement without selection: regulated suppression of amber mutations in Escherichia coli

Gene 331 (2003) 153–163 www.elsevier.com/locate/gene

Gene replacement without selection: regulated suppression of amber mutations in Escherichia coli Christopher D. Herring, Jeremy D. Glasner, Frederick R. Blattner* Laboratory of Genetics, University of Wisconsin Madison, 445 Henry Mall, Madison, WI 53706, USA Received 18 November 2002; received in revised form 3 March 2003; accepted 1 April 2003 Received by B. Dujon

Abstract We have developed a method called ‘gene gorging’ to make precise mutations in the Escherichia coli genome at frequencies high enough (1 –15%) to allow direct identification of mutants by PCR or other screen rather than by selection. Gene gorging begins by establishing a donor plasmid carrying the desired mutation in the target cell. This plasmid is linearized by in vivo expression of the meganuclease I-Sce I, providing a DNA substrate for lambda Red mediated recombination. This results in efficient replacement of the wild type allele on the chromosome with the modified sequence. We demonstrate gene gorging by introducing amber stop codons into the genes xylA, melA, galK, fucI, citA, ybdO, and lacZ. To compliment this approach we developed an arabinose inducible amber suppressor tRNA. Controlled expression mediated by the suppressor was demonstrated for the lacZ and xylA amber mutants. q 2003 Elsevier Science B.V. All rights reserved. Keywords: Lambda red recombination; Mutagenesis; Homing endonuclease; I-Sce I; Suppressor tRNA; Markerless

1. Introduction Determination of the complete genome sequence of Escherichia coli has opened many new experimental avenues. The ability to make precise genetic modifications to the bacterial chromosome and then to study the resulting phenotypic behavior is very important for functional studies. Recent technical advances have produced several methods to introduce a mutant sequence synthesized in vitro into the E. coli chromosome without leaving behind any ‘scars’ or unwanted sequence changes from the insertion process. It is desirable to avoid scars such as introduced drug marker genes because they can have unanticipated effects on cell physiology and preclude the use of the same marker in further manipulations. The two main previously established methods are the ‘in-out’ method and the linear fragment method. In the ‘in-out’ method, (Hamilton et al., 1989; Blomfield et al., 1991; Link et al., 1997; Martinez-Morales et al., 1999; Abbreviations: RDM, rich defined medium; Cm, chloramphenicol; Km, kanamycin; Ap, ampicillin; Zeo, zeocin; wt, wild type. * Corresponding author. Tel.: þ 1-608-262-2534; fax: þ1-606-263-7459. E-mail address: [email protected] (F.R. Blattner).

Posfai et al., 1999) a mutant sequence is introduced into the cell on a multicopy circular plasmid. A Rec mediated single homologous crossover results in cointegration of the whole circle into the genome at the target site with the plasmid vector between a wild type and mutant copy of the target sequence (‘in’). The cointegrate is resolved by a second single crossover (‘out’). When in and out crossovers span the mutant site, the desired mutation is transferred to the genome. The linear fragment method (Murphy, 1998; Datsenko and Wanner, 2000; Murphy et al., 2000; Yu et al., 2000), utilizes the Red recombination system encoded by bacteriophage lambda genes gam, bet and exo which operates on linear DNA. Electroporation is used to introduce a linear DNA fragment carrying the synthesized mutation directly into the cell where Red favors double crossover events in the progeny since a single crossover would result in a chromosome break. Incorporation of the mutation into the chromosome occurs where the double crossover spans the mutant site. Both the ‘in-out’ and linear fragment methods include inefficient steps and require strong genetic selections to achieve useful frequencies. The ‘in-out’ method uses a positive selection such as a drug resistance marker to select

0378-1119/03/$ - see front matter q 2003 Elsevier Science B.V. All rights reserved. doi:10.1016/S0378-1119(03)00585-7

154

C.D. Herring et al. / Gene 331 (2003) 153–163

for the ‘in’ step and a negatively selectable marker such as sucrose resistance to drive the ‘out’ step. The linear fragment method is limited by the very low efficiency of electroporation. Even with high DNA concentrations and cells of the highest competency, it is impossible to introduce donor DNA into more than a tiny fraction of target cells. To overcome this limitation, a two step process may be used to first select for the insertion of a cassette with both negative and positive selectable markers at the chromosomal target site and then to perform a second (negative) selection to create the desired mutation. The second step can either employ a second electroporation with Red, site specific recombinases (in which a ‘scar’ is typically left behind) (Datsenko and Wanner, 2000) or Rec mediated reduction of the genetic intermediate with a duplication incorporated in the original fragment (Kolisnychenko et al., 2002). The latter is especially useful in the production of deletions. Here we present ‘gene gorging’, which greatly simplifies the process of mutagenesis by combining the efficient steps and eliminating the multiple selections needed for the earlier methods. As in the ‘in-out’ method, the mutant allele is introduced on a stable plasmid, and as in the linear fragment method, Red recombination is used to integrate the cloned allele into the genome. The key difference in gene gorging is the linearization of the plasmid in vivo. Since virtually every cell receives linear donor, and Red is extremely efficient, the yield of the mutant allele incorporated into the genome is at least 1%. Thus the desired alteration can be identified by individual examination of around one hundred colonies. The term ‘gene gorging’ comes from forcibly incorporating the desired allele into the genome by imposing copious quantities of it into the cell. In a similar vein, Poteete and Fenton (2000) used lambda phage as the vehicle to efficiently introduce recombinogenic fragments into E. coli for Red recombination. The Pae R7 class II restriction modification system based on a six base cut site was established in the recipient E. coli to cut the incoming unmethylated donor DNA creating linear substrate fragments for Red recombination. They reported conversion of 1.5% of cells to the introduced chloramphenicol resistant phenotype in wild type and 5.6% in a recG background. Ellis et al. (2001) have reported the introduction of unselected mutations in up to 7% of viable cells using electroporated single stranded DNA. Our approach results in generally higher levels of replacement for wild type cells and is greatly simplified by using plasmid rather than lambda techniques and meganuclease I-Sce I, which does not cut in the genome of E. coli or most other organisms. We illustrate the method by introducing amber stop codons into E. coli genes. The advantage of amber mutations in functional genomics studies is that their effects can be regulated by the expression of a suppressor tRNA. Controlled expression of suppressor tRNAs have been demonstrated using temperature sensitivity or the lac promoter in E. coli (Oeschger and Woods, 1976; Yarus

et al., 1980), and in other organisms (Dingermann et al., 1992a,b; Syroid et al., 1992; Grundy and Henkin, 1994; Ulmasov et al., 1997). Here, the tightly regulated arabinose promoter was used to express the Ala-2 suppressor tRNA (Kleina et al., 1990; Normanly et al., 1990), and thereby regulate amber mutations introduced by gene gorging.

2. Materials and methods

2.1. Strains and plasmids Wild type E. coli strain MG1655 (ATCC# 700926) was used in all experiments. All plasmids are listed in Table 1 and all primer sequences are listed in Table 2. Donor plasmids were generated by cloning PCR fragments containing mutations into either the Sma I site of pUC19, the Eco RV site of pACYC184 or pDHA30 (Phillips et al., 2000) or into pCR-BluntII-Topo (Invitrogen, Carlsbad, CA). Other plasmids were constructed as shown in Fig. 1. The gene encoding I-SceI was originally obtained from pSCM525 (Colleaux et al., 1986). This plasmid was amplified with OF113 and OF114 then digested with Xba I and self-ligated, resulting in pSCM/short. The I-Sce I gene was amplified from pSCM/short with primers OF131 and OF132, digested with Nhe I/Pst I and cloned into the Nhe I/ Pst I sites of pBAD18-Kan (Guzman et al., 1995), producing pBAD/Sce. The lambda Red genes were amplified from pKD46 (Datsenko and Wanner, 2000) using primers OF231 and OF233, then digested with Sph I and ligated into the Sph I site of pBAD/Sce, resulting in pBSR. pB_R was constructed by digesting pBSR with Nhe I/Aat II to eliminate I-Sce I, filling in with Klenow DNA polymerase and self-ligating. pACBSR was constructed by amplifying the chloramphenicol resistance gene and origin from pACYC184 with primers OF253 and OF254, digesting with Alw44I and then ligating to the 5.3 Kb Alw44I fragment from pBSR. pACRSR was constructed by replacing the arabinose promoter with the rhamnose promoter. The rhaBAD promoter and rhaSR genes were amplified from E. coli genomic DNA with primers OF274 and OF275, then digested with Nde I and NgoMIV, and ligated into pACBSR digested with Nde I and NgoMIV. The Ala-2 suppressor tRNA was obtained from pGFIB/Ala-2 (Kleina et al., 1990) by PCR amplification using primers Alaup and Alalo. It was digested with Sac I and Eco RI and cloned into the Eco RI/Sac I site of pBAD18-Kan (Guzman et al., 1995), resulting in pBAD/ sup1. The transcription start site was modified by amplifying pBAD/sup1 with primers OF180 and Alaup, then digesting with Eco RI and self-ligating, to give pBAD/sup2.

C.D. Herring et al. / Gene 331 (2003) 153–163

155

Table 1 Plasmids Plasmid

Drug resistance

Copy #

Description/Reference

pKD46 pSCM525 pSCM/short pBAD/Sce pBSR pB_R pACBSR pACRSR pGFIB/Ala-2 pBAD/sup1 pBAD/sup2 pDHA30 pDHA/xylA pTopo/lacZ-fwd-1 pTopo/lacZ-rev-2 pTopo/ybdO-5 pTopo/citA-8 pTopo/galK-fwd-5 pTopo/galK-rev-4 pTopo/galK-2Sce-16 pTopo/fucI-fwd-2 pTopo/fucI-rev-3 pTopo/fucI-2Sce-101 pTopo/xyla-(3 –19) pTopo/xyla-2Sce-13 pTopo/xylA-200 pTopo/xylA-300 pUC/xyla-7 pAXS pTopo/melA-fwd-7 pTopo/melA-rev-7(2– 28) pTopo/melA-2Sce-18

Ap Ap Ap Km Km Km Cm Cm Ap Km Km Ap Ap Km, Zeo Km, Zeo Km, Zeo Km, Zeo Km, Zeo Km, Zeo Km, Zeo Km, Zeo Km, Zeo Km, Zeo Km, Zeo Km, Zeo Km, Zeo Km, Zeo Ap Cm Km, Zeo Km, Zeo Km, Zeo

Low High High High High High Low Low High High High High High High High High High High High High High High High High High High High High Low High High High

(Datsenko and Wanner, 2000) (Colleaux et al., 1986) Tac promoter controlling I-Sce I Ara promoter controlling I-Sce I Ara promoter controlling I-Sce I & l Red Ara promoter controlling l Red Ara promoter controlling I-Sce I & l Red Rha promoter controlling I-Sce I & l Red (Kleina et al., 1990) Ara promoter controlling suppressor tRNA Ara promoter controlling suppressor tRNA (Phillips et al., 2000) xylA donor; pUC compatible ori lacZ donor lacZ donor ybdO donor citA donor galK donor galK donor galK donor fucI donor fucI donor fucI donor xylA donor xylA donor xylA donor xylA donor xylA donor xylA donor melA donor melA donor melA donor

2.2. Generation of amber alleles Megaprimer PCR (Barik, 1996) was used to change an alanine codon near the center of the gene to an amber stop codon. This uses three primers, two at either end of the amplified region and one in the middle to introduce the mutation (the mutagenic primer). An initial amplification is performed using the mutagenic primer and one of the endprimers. This product is then used as a ‘megaprimer’ in conjunction with the other end-primer to generate the full length product. In this case, the nucleotide immediately upstream of the amber was changed to a C without altering the upstream amino acid, so that the recognition sequence for the restriction enzyme Bfa I (CTAG) was introduced. Digestion with Bfa I then allows the differentiation of wild type and amber alleles. Templates for megaprimer PCR were wild-type PCR products amplified with Pfu polymerase using the amino and carboxyl terminal ORF primers (Richmond et al., 1999), each of which contains a 13-base sequence at its 50 end that is the same for all primers in the set. The outer primers in megaprimer PCR, A-reamp and C-reamp, anneal within these universal A- or C-terminal sequences.

Megaprimer PCR was performed as follows: first a ‘megaprimer’ was synthesized in 50 ml PCR reactions containing 33 ml water, 1.0 ml Pfu Turbo polymerase (Stratagene, La Jolla, CA), 5 ml provided 10 £ Pfu buffer, 5 ml dNTP mix (2.5 mM each), 2.5 ml phosphorylated 5 mM A-reamp primer, 2.5 ml non-phosphorylated 5 mM mutagenic primer (designated ‘-mut’ in Table 2), and 1.0 ml of wild-type PCR product diluted 1:100 in water. They were cycled 1 £ (948C 1 min), 3 £ (948C 30 s, 458C 30 s, 728C 3 min), 17 £ (948C 30 s, 608C 30 s, 728C 3 min). Forty-five ml reactions were then set up containing 22 ml water, 1.0 ml Pfu Turbo polymerase, 5 ml provided 10 £ Pfu buffer, 5 ml dNTP mix (2.5 mM each), 10 ml megaprimer reaction, and 2 ml undiluted wt PCR product. To extend the megaprimer these reactions were cycled 5 £ (948C 30 s, 728C 3 min). To generate the full-length product, 5 ml phosphorylated 5 mM C-reamp primer was added and they were cycled 1 £ (948C 1 min), 30 £ (948C 30 s, 608C 30 s, 728C 6 min). I-SceI sites flanking the megaprimer PCR products were introduced by amplification with universal primers OF125 and OF169 for all ORFs except lacZ, which used OF299 and OF300. Amber alleles with two I-Sce I sites were made by reamplifying with OF168 and OF169. Subfragments of the

156

C.D. Herring et al. / Gene 331 (2003) 153–163

Table 2 Primers Name

Sequence

Alaup Alalo A-reamp C-reamp OF113 OF114 OF125 OF131 OF132 OF168 OF169 OF180 OF231 OF233 OF253 OF254 OF274 OF275 OF281-lacZ-mut OF284-fucI-mut OF287-galK-mut OF290-melA-mut OF299 OF300 OF352 OF353 OF354 OF384-xylA-mut OF385-ybdO-mut OF386-citA-mut

taggcgaattcggggctatagctcagctggga tgaacgagctcaagcttaaaaaaaatccttagctttcg ggggcggccgcttgctcttccatg gggcgtctagattgctcttcgtta cctctagacggccaagcttactccccatcc cctctagacattaattgcgttgcgctcactgc agcttctagattgctcttccatg aaacgtgctagcaggagggtacctatatgcatatgaaaaacatcaaaaaaaacc tgcactgcagacgtcgggcccttatttcaggaaagtttcggaggag aggcgcgcctagggataacagggtaattgctcttccatg aggcgcgcctagggataacagggtaattgctcttcgtta gatcgaattcagcatggagaaacagtagagagttgcg aggagggcatgcattcttcgtctgtttctactggtat cgtgtggcatgctaaggaggttataaaaaatggatattaatactgaaac aggcgtgcacctgccattcatccgcttatt aggcgtgcaccgatgataagctgtcaaacatga gtgagtccatatgcataatgtgatcctgctgaatttcattac gagagagcatatgaagccggcacatcgtcggcatcggcatgg accatttcggcacctaggggaagggctg cccctggaagccctaggcgatggcgtt caatcgatcagcaactagtgatctttcttgcc cctgcttcataagcctagagcagttccgg tagggataacagggtaatacatccagaggcacttcacc ttgaaaatggtctgctgctg ccgaccaaacatcaatatgattacg cattaccctgttatccctaccagttgcgcatcgccacgg cattaccctgttatccctactttgacgacgtactttggcatc catagaccgtcgcctagtcgtaatcatattg accaacagttcttcctagttctctgctgaca cagaccgttaaagttctagaccacatcctga

xylA amber allele were amplified using OF352 and OF353 (221 bp) or OF352 and OF354 (345 bp). Cloned amber alleles were confirmed by I-Sce I and Bfa I digestion (New England Biolabs, Beverly, MA). 2.3. Gene gorging A donor plasmid and a mutagenesis plasmid were introduced into E. coli then selected on LB plates containing kanamycin (Km) and chloramphenicol (Cm). The two plasmids were electroporated together for convenience, but it is also possible to produce co-transformants by two successive transformations. A colony was picked into 1 ml of rich defined medium (RDM) (Neidhardt et al., 1974). Cells were routinely plated on Cm/Km and LB plates at this point to verify that all cells contained both plasmids. To the culture 10 ml of 20% L -arabinose (Sigma, St. Louis, MO) and either 1 ml 25 mg/ml Cm or 50 mg/ml Km were added (as appropriate to select for the mutagenesis plasmid). The culture was left at 378C in a shaking incubator for 7 –11 h. Cells were then plated on LB or LB þ Cm plates (citA and ybdO) or on MacConkey agar base plates (Difco Becton Dickinson, Sparks, MD) containing 1% of lactose, D -galactose, L -fucose, melibiose (Sigma) or D -xylose (Fisher, Pittsburgh, PA). Intermediate MacConkey phenotypes (ranging from

red colonies with light margins to white colonies with red centers) were sometimes encountered (most frequently with melA), correlating with the presence of the donor plasmid drug marker. Because these colonies regenerated a mixture of intermediate and pure red colonies when replated, they were counted as wild type. Gene gorging cultures were also routinely plated on Cm/Km plates to verify that the donor plasmid had been cut. Amber mutations in citA and ybdO were identified by colony PCR using primers outside of the cloned ORF followed by digestion with Bfa I. Gene gorging was also performed in the presence of the suppressor plasmid for the gene xylA. A pDHA30 donor plasmid and pACBSR were transformed into electrocompetent cells carrying pBAD/sup2, then grown on LB plates containing Km, Cm and Ap. A colony was picked into 1 ml RDM, then 10 ml 20% arabinose, 1 ml Km and 1 ml Cm were added. The culture was grown for 7.5 h at 378C and then dilutions were plated on MacConkey/xylose or RDM plates containing Km, Cm and arabinose. 2.4. Linear DNA electroporations E. coli MG1655 carrying the Red-expressing plasmid pKD46 (Datsenko and Wanner, 2000) was grown in LB þ Ap at 308C to OD600 ¼ 0.5. Arabinose was added

C.D. Herring et al. / Gene 331 (2003) 153–163

157

Fig. 1. Derivation of plasmids. Plasmids are not drawn to scale, and only the relevant details are shown. The approximate position and orientation of primers are indicated with small one-sided arrows. For simplicity, the lambda Red genes gam, beta and exo are indicated by ‘l Red’. See Section 2.1 for more details.

to a final concentration of 0.2% approximately 2 h before preparing electrocompetent cells by standard methods (Sambrook et al., 1989). A PCR product of the xylA gene containing an amber stop codon was amplified from the plasmid pAXS using primers OF168 and 169. One hundred and 200 ng of PCR product was electroporated directly into pKD46 competent cells and then plated on MacConkey agar/xylose plates after 1 h of outgrowth. In a separate experiment, EZ:TNkKan-2l (Epicentre, Madison, WI) was transposed according to the manufacturer’s protocol into a pOCUS-2 plasmid (Novagen, Madison, WI) carrying the wild type xylA gene. Colony PCR using primers flanking the cloning site (POCUSDOWN and T7 promoter primer, from Novagen) followed by restriction digestion with Pvu I allowed the identification of a clone with a transposition near the middle of xylA. Two hundred ng of this PCR product was electroporated into pKD46 competent cells which were then plated on LB and on kanamycin plates after 1 h of outgrowth.

2.5. b-galactosidase assay Strains containing pBAD/sup2 were grown overnight in A-medium plus kanamycin, glucose and IPTG, then diluted 1:50 in the same medium with glucose or L -arabinose and measured for b-galactosidase as per (Miller, 1972). Each measurement included two or three replicates.

3. Results 3.1. Strategy To introduce a desired mutation into the E. coli genome, gene gorging was carried out using a two-plasmid system shown in Fig. 2. A donor plasmid contains a PCR product of the mutation-containing fragment, cloned on a standard high copy vector and flanked on one end by the 18 bp restriction site for I-Sce I. A mutagenesis plasmid carries the I-Sce I endonuclease gene and the lambda Red genes under inducible control of the arabinose promoter on a compatible replicon. The donor plasmid is electroporated into E. coli along with the mutagenesis plasmid and plated to select for both plasmids. In this example the plates contain both chloramphenicol and kanamycin. Co-transformants are inoculated into liquid medium containing arabinose to induce expression of I-Sce I and Red. The I-Sce I meganuclease specifically cuts the donor plasmid, generating many copies of a linear fragment carrying the desired mutation in each cell. The Red gene products facilitate a double recombination at a position on the chromosome homologous to the donor sequence. Clones carrying the desired mutation are identified by screening colonies by PCR or detection of a growth phenotype where feasible. 3.2. Amber insertions in seven genes We used gene gorging to introduce amber mutations into seven different non-essential genes of E. coli (Table 3). An

158

C.D. Herring et al. / Gene 331 (2003) 153–163

Fig. 2. Gene gorging strategy. The desired genomic modification is produced as a PCR fragment with the recognition sequence for I-Sce I on one or both of the primers, then cloned into a standard cloning vector (donor plasmid). In this case, the genomic modification is the introduction of an amber stop codon, represented by a STOP sign, into xylA. After electroporation of both plasmids into E. coli the Red and I-Sce I genes are induced, leading to linearization of the donor plasmid and a double recombination with the chromosomal target.

amber mutation entails the introduction of a premature stop codon (UAG) into the coding region of a gene. This very general type of mutation can be used to create a truncation in virtually any protein encoding gene with the ability to reverse the phenotype through the action of an amber suppressor. Since the suppressor used here inserts an alanine residue, only alanine codons were changed to amber. An additional advantage of using amber mutations is that the amber triplet can be included within the target sequence for Bfa I restriction (CTAG), the rarest tetramer in the E. coli

genome. It is usually possible to design an amber mutation just downstream of a C nucleotide creating a new Bfa I cut site at the point of mutation. This enables screening by colony PCR and Bfa I digestion to easily identify mutants. Suppression efficiency may be optimized in the design of amber mutations by considering the two downstream nucleotides known to affect efficiency (Miller and Albertini, 1983). Donor fragments were generated from MG1655 template DNA by megaprimer PCR and then reamplified to add the

C.D. Herring et al. / Gene 331 (2003) 153–163

159

Table 3 Gene replacement data Genea

b#

Size (bp)

ORF directionb

Donor plasmid

Vector orientationc

I-Sce I sites

Total white to red coloniesd

Replicates

% Gene replacement

lacZ lacZ ybdO citA galK galK galK fucI fucI fucI xylA xylA xylA xylA xylA melA melA melA

b0344 b0344 b0603 b0619 b0757 b0757 b0757 b2802 b2802 b2802 b3565 b3565 b3565 b3565 b3565 b4119 b4119 b4119

1006e 1006e 959 1715 1205 1205 1205 1832 1832 1832 1379 1379 1379 221e 345e 1412 1412 1412

ˆ ˆ ˆ ! ˆ ˆ ˆ ! ! ! ˆ ˆ ˆ ˆ ˆ ! ! !

pTopo/lacZ-fwd-1 pTopo/lacZ-rev-2 pTopo/ybdO-5 pTopo/citA-8 pTopo/galK-fwd-5 pTopo/galK-rev-4 pTopo/galK-2Sce-16 pTopo/fucI-fwd-2 pTopo/fucI-rev-3 pTopo/fucI-2Sce-101 pTopo/xyla-(3–19) pTopo/xyla-2Sce-13 pUC/xyla-7 pTopo/xylA-200 pTopo/xylA-300 pTopo/melA-fwd-7 pTopo/melA-rev-7(2–28) pTopo/melA-2Sce-18

! ˆ ! ˆ ! ˆ

1 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 2

16:166 81: , 452 7:160 3:206 10:184 32:553 19:550 9: , 1034 22:617 11:625 91: , 1572 78: , 1157 173: , 2423 0: , 2019 0: , 632 11: , 1398f 4:492f 7:328f

1 1 6 3 1 3 1 1 3 2 4 1 5 2 2 4 2 1

8.79 15.2 4.19 1.44 5.15 5.47 3.34 0.86 3.44 1.73 5.47 6.32 6.66 0 0 0.78 0.81 2.09

! ˆ ˆ

! ˆ

a

Gene gorging was carried out with pACBSR in conjunction with the indicated donor plasmids. The direction of the open reading frame in the E. coli genome sequence. Those ORFs marked ‘ ! ’ read from start to stop codon in the forward direction, while those marked ‘ ˆ ’ are in the reverse orientation and are annotated ‘complement’ in GenBank. c Clones in which the gene of interest is cloned in the same orientation as the lacZ gene in the vector are indicated with ‘ ! ’, and those in the opposite orientation by ‘ ˆ ’. d The total number of white and red colonies were summed from all replicate experiments. For plates where the number of red colonies was between 350 and 1000, the number was estimated, indicated by ‘ , ’. e The PCR product cloned into the donor plasmid did not contain the entire ORF, but instead used a smaller region from the center of the gene. f Intermediate MacConkey phenotypes were common for melA. Pink and ‘egg’ colonies were counted as red. b

recognition sequence for I-Sce I to one or both ends. Donor plasmids were obtained by cloning the amber-containing PCR fragments into the cloning site in the lacZ gene fragment of a puc-based vector. Cloning into the lacZ gene was a matter of convenience rather than design; the cloned gene was fused out of frame and was not meant to be expressed. Gene gorging was carried out using the mutagenesis plasmid pACBSR, and the number of mutants relative to wild type was determined. Five of the targeted genes were screened on MacConkey plates with various carbon sources, with white colonies indicating a null mutation and red indicating wild type. White colonies were verified to contain amber mutations in xylA, lacZ, galK, and melA by PCR amplification using genomic primers adjacent to the targeted ORF, followed by digestion with Bfa I. Since the priming sites do not occur in the cloned ORF, only the chromosomal locus was amplified. Mutations in ybdO and citA were screened by PCR and Bfa I digestion only. The frequencies of mutants in the screened population ranged from 1 to 15% across this panel of genes. The effect of vector/insert orientation within the donor plasmid as well as the relative efficiency of gene gorging with one or two flanking I-Sce I sites was also investigated. In the case of fucI, the efficiency of replacement was higher when the target gene was cloned in reverse orientation relative to the vector-encoded lacZ gene fragment, but little

or no effect was noted in three other cases. The number of I-Sce I sites also had no clear effect, with increased efficiency for xylA and melA with two sites, but decreased efficiency for fucI and galK. Efficiency did not correlate to ORF size, but gene replacement was undetectable for small xylA subfragments of 221 and 345 bp. The results for these seven genes show that gene gorging is generally applicable and generates mutants at relatively high frequencies without direct selection. 3.3. Analysis of gene gorging Experiments were conducted that establish three major requirements for gene gorging. First, to show the importance of generating the donor fragment in vivo rather than supplying it exogenously, a PCR product of the xylA gene containing an amber stop codon was electroporated directly into cells expressing Red from plasmid pKD46 (Datsenko and Wanner, 2000), and then plated on MacConkey agar/ xylose plates. No xylose deficient colonies were detected out of approximately 3393 screened. Because the frequency was below detection by screening, the experiment was repeated using a PCR product of the xylA gene containing Tn5kKan-2l, and plated on LB and on kanamycin plates. Kanamycin resistant recombinants represented 3.5 £ 1026 of the survivors of electroporation. This stands in sharp

160

C.D. Herring et al. / Gene 331 (2003) 153–163

contrast to the 5% gene replacement obtained by generating the linear DNA in vivo. Because we suspected that donor fragment copy number is important for the efficiency of gene gorging, the effect of plasmid copy number was investigated. Experiments presented in Table 3 used a highcopy donor plasmid and low copy number mutagenesis plasmid (, 500 and , 10 copies/cell respectively). The reverse arrangement was obtained by cloning the xylA amber allele into pACYC184 as the donor (pAXS) and supplying mutagenesis functions on the pUC-based plasmid pBSR. Gene replacement occurred at 2% with the ‘high copy mutagenesis:low copy donor’ arrangement and at 6% with ‘low copy mutagenesis:high copy donor’, a difference that is statistically significant taking into consideration day to day variability. We conclude that the efficiency of gene gorging is achieved by establishing the linear donor fragment in greater numbers and in a higher proportion of cells than could be achieved by electroporation. Two other requirements for high efficiency gene replacement are digestion with I-Sce I and expression of Red. This was tested by gene gorging using low copy number xylA donor pAXS and variants of pBSR, one expressing just I-Sce I and the other expressing just Red. Xylose(2 ) mutants occurred in 0.2% of cells expressing just Red and in none of the cells expressing just I-Sce I (data not shown). We also found that an inadvertent point mutation in the I-Sce I site of one donor plasmid construct greatly reduced gene replacement frequencies. A time course of gene gorging is presented in Fig. 3. Plasmid-specific drug markers and the number of viable cells were monitored over a period of 11 h following arabinose induction (Fig. 3a). Kanamycin resistance (carried by the donor plasmid) was lost within the 1st h of induction indicating I-Sce I digestion of the donor plasmid in vivo. Total viable cells decreased and then recovered after slow loss of the mutagenesis plasmid (Cm), perhaps as a result of toxicity from Red. After 4 h of treatment, microscopy revealed that approximately 25% of the cells were filamentous. This is in contrast to experiments that showed toxicity from Red expression, but not filamentation (Sergueev et al., 2001). Production of mutants was followed on MacConkey agar/xylose plates (Fig. 3b). A few xylose(2 ) colonies were detected before induction, and increased in frequency to 6% of the total population by 11 h, though most of the increase occurred between 2 and 4 h. The plating efficiency on MacConkey plates was lower than on LB, possibly as a result of decreased resistance to bile salts. Wild type and xylose(2 ) strains under normal conditions display the same plating efficiency on MacConkey (71 and 72%, respectively). Heat stress has been shown to reduce the recovery of E. coli on MacConkey plates (Rocelle et al., 1995), and it is possible that the toxicity of Red expression has the same effect. The presence of mutants at T ¼ 0 indicates that the Red and I-Sce I gene products may have been expressed during the initial electroporation and plate selection steps.

Fig. 3. Time course of gene gorging. Gene gorging was carried out with xylA as described in materials and methods (donor: pTopo/xylA-(3 –19) and mutagenesis plasmid: pACBSR). Samples were taken before adding the arabinose (t ¼ 0) and at subsequent time points, plating on LB, LB-chloramphenicol (Cm), LB-kanamycin (Km), and MacConkey agar/ xylose (Mac) plates. (A) Shows the occurrence of drug resistant colonies; and (B) shows the number of white and red colonies on MacConkey plates. The gene replacement % was calculated from the number of white divided by the total of red þ white.

Consistent with this, leaky expression of I-Sce I in liquid LB cultures was indicated by a decreased abundance of the donor plasmid relative to the mutagenesis plasmid in DNA prepared from cells containing both plasmids, especially when the donor plasmid carried the ampicillin drug resistance gene. Mutants from T ¼ 0, obtained in an equivalent experiment with the same plasmids, were confirmed to carry the amber xylA on the chromosome by PCR and Bfa I digestion. In a separate experiment, xylose(2 ) colonies produced by gene gorging were examined for the presence of each drug marker. All 18 colonies tested had lost the drug resistance carried by the donor plasmid but retained that of the mutagenesis plasmid. This observation and confirmation of amber mutations using primers specific to the chromosomal region around the gene of interest indicate that the observed mutant phenotypes are not due to survival of the donor plasmid. Gene gorging in the supplemented MOPS-based medium of Neidhardt et al. (1974) (rich defined medium – RDM)

C.D. Herring et al. / Gene 331 (2003) 153–163

gave higher replacement frequencies than either LB or M9 minimal medium. Neither UV irradiation nor a recJ::TnKm mutation increased the efficiency of gene gorging (data not shown).

3.4. A regulatable amber suppressor In order to control the expression of introduced amber mutations at the translational level we constructed the plasmid pBAD/sup2 carrying the Ala-2 amber suppressor tRNA gene (Kleina et al., 1990; Normanly et al., 1990) in pBAD18 under control of the tightly regulated arabinose promoter (Guzman et al., 1995). This particular suppressor was chosen because of its high efficiency and fidelity of charging with alanine. PBAD/sup2 was transformed into cells containing the lacZ amber mutation constructed above. Beta-galactosidase assays (Miller, 1972) showed no expression in glucose and 46% of wild type activity in arabinose grown cells (Table 4). Using a luciferase based assay (Schultz and Yarus, 1990), the same suppressor plasmid showed 59% suppression efficiency. Gene gorging was conducted in the presence of the suppressor. Since pBAD/sup2 is a pUC-based replicon, a high-copy number vector from a third compatibility group, pDHA30 (Phillips et al., 2000), was used to construct a donor plasmid for xylA. Cells containing all three plasmids were established and inoculated into medium containing arabinose to induce both gene gorging and the suppressor tRNA. Mutants occurred at frequencies similar to other experiments (4.8%). Eighteen of these mutants were patched onto MacConkey agar plates containing 1% xylose and 0.1% arabinose. They displayed a wild type phenotype in the presence of arabinose but were colorless with just xylose. Control plates containing 1% xylose and 0.1% glucose showed some color, but distinctly less than the plate with arabinose. These results indicate that most mutants generated by gene gorging are suppressible and suggest that the procedure does not introduce a large number of unintended mutations. In order to control the suppressor and mutagenesis functions separately, the I-SceI and lambda Red genes were placed under control of the rhamnose promoter on plasmid pACRSR, resulting in 5.6% gene replacement for xylA.

Table 4 Regulatable suppression with pBAD/sup2 Genotype

Grown in

b-Gal (Miller Units)

Std. error

wt wt lacZam lacZam

Glucose þ IPTG Arabinose þ IPTG Glucose þ IPTG Arabinose þ IPTG

1731 7906 0 3657

51 530 295

161

4. Discussion Previous methods of directed mutagenesis in E. coli rely on the use of positive and negative selections for recombination intermediates because the desired events occur at very low frequency. Here we present gene gorging, a new method in which the efficiency of gene replacement is high enough to make selection of recombinants unnecessary. Replacement occurred in 1– 15% of the cell population, making it feasible to identify mutants by PCR of individual colonies or other means of direct screening. In this study, we changed alanine codons to amber stop codons, but virtually any mutation can be introduced in a straightforward way without complicated manipulations. The high efficiency of gene replacement, we believe, is achieved by liberating a recombinogenic linear DNA fragment in vivo in every starting cell. Expression of the Red system is not limiting since expressing it from a high copy number plasmid (with the target at low copy) led to a decrease in efficiency. In addition, the process was demonstrated to depend on two expressed functions, the Red recombination genes and the meganuclease I-Sce I. A time course study showed that I-Sce I cuts the donor plasmid within the 1st h, but the maximal rate of gene replacement occurs considerably later at 2– 4 h. The number of viable cells decreased for 7 h, and then recovered. For mutations that have a deleterious effect on growth, it may be advantageous to plate the culture at 7 h, before growth of wild type cells reduces the relative yield of mutants. For the seven genes tested here, the efficiency of gene replacement varied from 1 to 15%. Reasons for this variability are unknown; the efficiency does not correlate with ORF size, genome position or orientation relative to replication, and chi sites associated with recombination do not occur in any of the genes tested. The only correlation we observed is with the orientation of the ORF in the E. coli genome sequence, with those genes transcribed in the forward direction having lower efficiency than genes on the complementary strand (genes annotated ‘complement’ in GenBank). This is not to be confused with the correlation to direction relative to replication as observed by Ellis et al. (2001). We can suggest no plausible reason for the unlikely correlation we have observed but it is significant at the 0.06 level (t-test). Variation is also seen between donor plasmids carrying the same gene but with a different number of I-Sce I sites or opposite insert/vector orientation. Vector orientation could be important because the insert is positioned incidentally within the alpha subunit of the lacZ gene. Leaky transcription through the gene, or homologous recombination to the chromosomal lacZ gene may have an impact, especially on the high frequency observed for replacements in lacZ. The number of I-Sce I sites may be important because with one site, only one end of the linear fragment matches the gene of interest and the other is homologous to lacZ. With two I-Sce I sites, both ends of the fragment match the chromosomal gene. Alternately, the observed variation

162

C.D. Herring et al. / Gene 331 (2003) 153–163

may be due to small sequence differences resulting from independent construction of the donor plasmids. Amber mutations have been used for decades because of the ability to suppress the effects of the mutations with suppressor tRNAs. By adding or withdrawing the arabinose inducer, we have shown that the phenotypes of amber mutations can be switched on and off. In cases where pleiotropic effects complicate the study of some genes, being able to switch off a gene adds a new dimension to the possibilities of experimental design. Targeted gene replacement is a difficult process in many organisms, especially in plants and animals. The 18 bp restriction site for I-Sce I does not occur in any currently sequenced organism other than some metazoans and yeast (from which it was derived). The lambda Red recombination functions have been used to make mutations in Salmonella enterica and Klebsiella aerognes (Uzzau et al., 2001; R.A. Bender, personal communication). Since supercoiled plasmid DNA is much easier to transform than linear DNA, gene gorging may prove especially useful in poorly transformable enteric bacteria. A method using in vivo production of a recombinogenic linear DNA fragment has been used for directed mutation in Drosophila (Rong and Golic, 2000), and may prove useful in making directed mutations in other important organisms as well.

Acknowledgements The authors wish to thank Tim Durfee for valuable suggestions and critical review of this manuscript, and Yisheng Kang for the recJ::TnKm mutant. pDHA30 was kindly provided by Gregory Phillips, pSCM525 by Arnaud Perrin, and pKD46 by Barry Wanner. This work was supported by NIH GM35682 and CDH was supported in part by NIH 5 T32 GM08349.

References Barik, S., 1996. Site-directed mutagenesis in vitro by megaprimer PCR. Methods Mol. Biol. 57, 203–215. Blomfield, I.C., Vaughn, V., Rest, R.F., Eisenstein, B.I., 1991. Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC101 replicon. Mol. Microbiol. 5, 1447–1457. Colleaux, L., d’Auriol, L., Betermier, M., Cottarel, G., Jacquier, A., Galibert, F., Dujon, B., 1986. Universal code equivalent of a yeast mitochondrial intron reading frame is expressed into E. coli as a specific double strand endonuclease. Cell 44, 521–533. Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97, 6640– 6645. Dingermann, T., Frank-Stoll, U., Werner, H., Wissmann, A., Hillen, W., Jacquet, M., Marschalek, R., 1992a. RNA polymerase III catalysed transcription can be regulated in Saccharomyces cerevisiae by the bacterial tetracycline repressor-operator system. Embo J. 11, 1487–1492. Dingermann, T., Werner, H., Schutz, A., Zundorf, I., Nerke, K., Knecht, D., Marschalek, R., 1992b. Establishment of a system for conditional gene

expression using an inducible tRNA suppressor gene. Mol. Cell. Biol. 12, 4038–4045. Ellis, H.M., Yu, D., DiTizio, T., Court, D.L., 2001. High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc. Natl. Acad. Sci. USA 98, 6742–6746. Grundy, F.J., Henkin, T.M., 1994. Inducible amber suppressor for Bacillus subtilis. J. Bacteriol. 176, 2108–2110. Guzman, L.M., Belin, D., Carson, M.J., Beckwith, J., 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177, 4121–4130. Hamilton, C.M., Aldea, M., Washburn, B.K., Babitzke, P., Kushner, S.R., 1989. New method for generating deletions and gene replacements in Escherichia coli. J. Bacteriol. 171, 4617– 4622. Kleina, L.G., Masson, J.M., Normanly, J., Abelson, J., Miller, J.H., 1990. Construction of Escherichia coli amber suppressor tRNA genes. II. Synthesis of additional tRNA genes and improvement of suppressor efficiency. J. Mol. Biol. 213, 705 –717. Kolisnychenko, V., Plunkett, G. 3rd, Herring, C.D., Feher, T., Posfai, J., Blattner, F.R., Posfai, G., 2002. Engineering a reduced Escherichia coli genome. Genome Res. 12, 640– 647. Link, A.J., Phillips, D., Church, G.M., 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179, 6228–6237. Martinez-Morales, F., Borges, A.C., Martinez, A., Shanmugam, K.T., Ingram, L.O., 1999. Chromosomal integration of heterologous DNA in Escherichia coli with precise removal of markers and replicons used during construction. J. Bacteriol. 181, 7143–7148. Miller, J.H., 1972. Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Miller, J.H., Albertini, A.M., 1983. Effects of surrounding sequence on the suppression of nonsense codons. J. Mol. Biol. 164, 59–71. Murphy, K.C., 1998. Use of bacteriophage lambda recombination functions to promote gene replacement in Escherichia coli. J. Bacteriol. 180, 2063–2071. Murphy, K.C., Campellone, K.G., Poteete, A.R., 2000. PCR-mediated gene replacement in Escherichia coli. Gene 246, 321 –330. Neidhardt, F.C., Bloch, P.L., Smith, D.F., 1974. Culture medium for enterobacteria. J. Bacteriol. 119, 736 –747. Normanly, J., Kleina, L.G., Masson, J.M., Abelson, J., Miller, J.H., 1990. Construction of Escherichia coli amber suppressor tRNA genes. III. Determination of tRNA specificity. J. Mol. Biol. 213, 719– 726. Oeschger, M.P., Woods, S.L., 1976. A temperature-sensitive suppressor enabling the manipulation of the level of individual proteins in intact cells. Cell 7, 205–212. Phillips, G.J., Park, S.K., Huber, D., 2000. High copy number plasmids compatible with commonly used cloning vectors. Biotechniques 28, 400 –402.404, 406 passim. Posfai, G., Kolisnychenko, V., Bereczki, Z., Blattner, F.R., 1999. Markerless gene replacement in Escherichia coli stimulated by a double-strand break in the chromosome. Nucleic Acids Res. 27, 4409–4415. Poteete, A.R., Fenton, A.C., 2000. Genetic requirements of phage lambda red-mediated gene replacement in Escherichia coli K-12. J. Bacteriol. 182, 2336–2340. Richmond, C.S., Glasner, J.D., Mau, R., Jin, H., Blattner, F.R., 1999. Genome-wide expression profiling in Escherichia coli K-12. Nucleic Acids Res. 27, 3821–3835. Rocelle, M., Clavero, S., Beuchat, L.R., 1995. Suitability of selective plating media for recovering heat- or freeze-stressed Escherichia coli O157:H7 from tryptic soy broth and ground beef. Appl. Environ. Microbiol. 61, 3268–3273. Rong, Y.S., Golic, K.G., 2000. Gene targeting by homologous recombination in Drosophila. Science 288, 2013–2018. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: a

C.D. Herring et al. / Gene 331 (2003) 153–163 Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Schultz, D.W., Yarus, M., 1990. A simple and sensitive in vivo luciferase assay for tRNA-mediated nonsense suppression. J. Bacteriol. 172, 595–602. Sergueev, K., Yu, D., Austin, S., Court, D., 2001. Cell toxicity caused by products of the p(L) operon of bacteriophage lambda. Gene 272, 227–235. Syroid, D.E., Tapping, R.I., Capone, J.P., 1992. Regulated expression of a mammalian nonsense suppressor tRNA gene in vivo and in vitro using the lac operator/repressor system. Mol. Cell. Biol. 12, 4271–4278. Ulmasov, B., Capone, J., Folk, W., 1997. Regulated expression of plant

163

tRNA genes by the prokaryotic tet and lac repressors. Plant Mol. Biol. 35, 417–424. Uzzau, S., Figueroa-Bossi, N., Rubino, S., Bossi, L., 2001. Epitope tagging of chromosomal genes in Salmonella. Proc. Natl. Acad. Sci. USA 98, 15264–15269. Yarus, M., McMillan, C. 3rd, Cline, S., Bradley, D., Snyder, M., 1980. Construction of a composite tRNA gene by anticodon loop transplant. Proc. Natl. Acad. Sci. USA 77, 5092–5096. Yu, D., Ellis, H.M., Lee, E.C., Jenkins, N.A., Copeland, N.G., Court, D.L., 2000. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. USA 97, 5978–5983.