- Email: [email protected]
Gene structure and expression of leptin in Chinese perch
General and Comparative Endocrinology 194 (2013) 183–188
Contents lists available at ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Gene structure and expression of leptin in Chinese perch Shan He a, Xu-Fang Liang a,⇑, Ling Li a, Wei Huang a, Dan Shen a, Ya-Xiong Tao b a b
Key Laboratory of Freshwater Animal Breeding, Ministry of Agriculture, College of Fisheries, Huazhong Agricultural University, 430070 Wuhan, PR China Department of Anatomy, Physiology, and Pharmacology, College of Veterinary Medicine, Auburn University, Auburn, AL 36849-5519, United States
a r t i c l e
i n f o
Article history: Received 23 April 2013 Revised 14 September 2013 Accepted 16 September 2013 Available online 26 September 2013 Keywords: Leptin gene Gene structure Tissue expression Single nucleotide polymorphism Chinese perch (Siniperca chuatsi)
a b s t r a c t Leptin is an important hormone involved in regulation of food intake, energy expenditure and reproduction in mammals, but its role in acanthomorph fishes remains scant. In the present study, we characterized leptin gene structure and its tissue expression in Chinese perch (Siniperca chuatsi). In contrast to typical leptin gene organization of 3 exons and 2 introns in other vertebrates, Chinese perch leptin gene consisted of 2 exons and 1 intron. This is the first leptin gene characterized in Perciformes, and is also the first leptin gene lacking an intron reported in Perciformes. The unique gene structure, the conservation of both cysteines that form the single disulfide bridge in leptin, and stable clustering in phylogenetic analyses substantiate the unambiguous orthology of mammalian and fish leptins, despite low amino acid identity. Polymorphism of leptin gene was examined in wild and cultivated populations of Chinese perch by direct sequencing of 120 fish. No SNP was found in leptin gene. Leptin mRNA of Chinese perch was highly expressed in liver, and expressed at low levels in brain, visceral adipose tissue, intestine, spleen and muscle. Ó 2013 Elsevier Inc. All rights reserved.
1. Introduction The first obese gene cloned in mouse by Zhang et al. (1994) is identified as the factor responsible for profound obesity and type II diabetic phenotype of the obese mouse mutant. The hormonal product of obese gene, leptin, is a member of the class-1 alpha helical cytokines that is produced primarily by adipose tissue in mammals. It has been shown to play a key role in regulation of food intake and energy expenditure (Klok et al., 2007; Margetic et al., 2002; Schwartz et al., 2000), and acute or chronic leptin treatment (intracerebroventricular injection, intraperitoneal injection or osmotic pump infusion) reduces food intake and body weight in mammals (Sahu, 2004, 1998; Seeley et al., 1996; Wetzler et al., 2004). Since the discovery of leptin in mouse, extensive studies have been done on leptin orthologues and their biological roles in non-mammalian species (Boswell et al., 2006; Crespi and Denver, 2006). Although a leptin homologue has been isolated from chicken (Taouis et al., 1998) and injection of recombinant chicken leptin reduces food intake (Dridi et al., 2000), there is some doubt concerning this discovery (Boswell et al., 2006; Friedman-Einat et al., 1999). The first sequence of a leptin-like molecule in fish has been reported in pufferfish by Kurokawa et al. (2005). Taking ⇑ Corresponding author. Fax: +86 27 8728 2114. E-mail addresses: [email protected] (S. He), [email protected] (X.-F. Liang), [email protected] (L. Li), [email protected] (W. Huang), [email protected] (D. Shen), [email protected] (Y.-X. Tao). 0016-6480/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ygcen.2013.09.008
into account the very low similarity of leptin sequences among different fish groups, e.g. salmonid fish (Kurokawa et al., 2005; Angotzi et al., 2013), cyprinid fish (Huising et al., 2006), pufferfish (Kurokawa et al., 2005), and striped bass (Won et al., 2012), the physiological roles and signaling pathways of fish leptins might be group-specific, and are still obscure. Several studies sought to investigate leptin effects in fish using mammalian leptins. Results from these attempts are controversial, as some researchers observed no conclusive effects (Baker et al., 2000; Londraville and Duvall, 2002; Silverstein and Plisetskaya, 2000), whereas others reported that mammalian leptin affected expression and release of pituitary hormones in European sea bass, bighead carp, rainbow trout and common carp (Chowdhury et al., 2004; Gorissen et al., 2012; Peyon et al., 2001; Volkoff et al., 2003; Weil et al., 2003), and reduced food intake in goldfish (de Pedro et al., 2006). Recently, several studies have employed species-specific leptin for exploring its biological functions in fish (grass carp, Li et al., 2010; Atlantic salmon, Murashita et al., 2011; rainbow trout, Murashita et al., 2008; pufferfish, Yacobovitz et al., 2008). Huising et al. (2006) reported the presence of duplicate obese genes in common carp. However, the whole gene structure (including 50 -flanking region, the first exon and the first intron) of obese gene in common carp is still unknown. In this study, leptin gene structure and its tissue expression were characterized in Chinese perch (Siniperca chuatsi), which would shed new light on leptin evolutionary diversification and physiological function of vertebrate leptin gene.
184
S. He et al. / General and Comparative Endocrinology 194 (2013) 183–188
2. Materials and methods 2.1. Materials All primers were synthesized by Sangon (Shanghai, China). 2.2. Fish sampling Chinese perch S. chuatsi (50–70 g) were obtained from Guangdong Freshwater Fish Farm (Panyu, Guangdong, China), and kept in 96 L of fresh water with continuous system of water filtration and aeration at constant temperature (25 ± 1 °C). Fish were fed once each day to satiation with live India mrigal Cirrhina mrigola. Fish were anesthetized and sacrificed by decapitation. Brain, liver, intestine, muscle, spleen and adipose tissues were dissected immediately for total RNA isolation. The animal protocol was approved by Huazhong Agricultural University (Wuhan, Hubei, China). 2.3. RNA isolation and reverse transcription Total RNA was isolated from different tissues with SV Total RNA Isolation System (Promega, Madison, WI, USA) combined with DNase digestion to eliminate DNA contamination according to the manufacturer’s instructions. The extracted RNA was resuspended in 50 ll RNase-free water and quantified using Eppendorf Biophotometer (Hamburg, Germany). Reverse transcription was performed with oligo(dT)18 primer using First Strand cDNA Synthesis Kit (ToYoBo, Tokyo, Japan). 2.4. Cloning and sequencing of full-length leptin cDNA of Chinese perch Four degenerate primers (LEP01F, LEP02F, LEP03R and LEP04R) were designed to clone partial leptin cDNA sequence of Chinese perch (Table 1). Gene specific primers were designed in the cloned PCR fragment of leptin cDNA of Chinese perch for 50 -RACE and 30 RACE (Table 1). 30 -RACE was performed using a 30 -Full RACE Core Set (TaKaRa, Tokyo, Japan). Total liver RNA was reverse transcribed to cDNA in the presence of oligo(dT)-3 site adaptor primer (provided in the kit). The prepared cDNA was first amplified by PCR with 0.2 lM primer LEP30 01F and 0.2 lM 3 site adaptor primer (provided in the kit). The second PCR was performed using primer
Table 1 Primer sequences for PCR. Primers
Sequence (50 –30 )
Primers for partial fragment LEP01F LEP02R
CCGGTGGAAGTCGTGRARATGAARWS ACTGAGGAATCCCGTCAGCGANGADATNTC
Primers for 50 RACE PCR LEP50 01R LEP50 02R
GCAGGTGGACTGAGAGTCA CCTAACCACCAGCTGTTC
Primers for 30 RACE PCR LEP 30 01F LEP 30 02F
TGACTCTCAGTCCACCTGC ACAGCCTGATCTCTGACAC
Primers for 50 -flanking region frLEP01R frLEP02R
ACACAGTGGTGGTGGGTTCAGGGTCA AAGTTCTCTGGATGTCGGTCGAC
Primers for intron i1LEP01F i2LEP01F i2LEP02R
GTCTTCATGACACAGTGGT GAACAGCTGGTGGTTAGG GCAGGTGGACTGAGAGTCA
Primers for real-time PCR D-LEP01F D-LEP02R D-ACT01F D-ACT02R
CCTCTGCCAGTGGAAGTA GTGTCAGAGATCAGGCTGT CGTGACATCAAGGAGAAG GTAGGTGGTCTCGTGGAT
LEP30 02F and 3 site adaptor primer. 50 -RACE was performed using SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, USA). One lg total liver RNA was reverse transcribed with 50 -RACE CDS Primer and SMART II A Oligonucleotide (provided in the kit). In the first PCR, cDNA was amplified with two primer sets, LEP5’01R and Universal Primer A Mix (UPM, provided in the kit). Primer sets (LEP50 02R and Nested Universal Primer A (NUP, provided in the kit)) were used in the second PCR. The final PCR products were analyzed with agarose gel electrophoresis, cloned into pGEM-T Easy vector (Promega) and sequenced. Phylogenetic comparison of protein sequences was carried out by Mega 3.0 software. 2.5. Cloning of intronic DNA and 50 -flanking region of leptin gene Genomic DNA of Chinese perch was isolated using Blood & Cell Culture DNA Kit (QIAGEN, Hilden, Germany) according to the manufacture’s recommendations. Primers for PCR amplification of intron and 50 -flanking region of leptin gene are listed in Table 1. Universal Genome Walker Kit (Clontech) was used for cloning 50 flanking region of leptin gene. The final PCR products were analyzed with agarose gel electrophoresis, cloned into pGEM-T Easy vector (Promega) and sequenced. Putative transcription regulatory regions were predicted with TFBIND (http://tfbind.ims.u-tokyo.ac.jp/). 2.6. SNP screening of leptin gene in Chinese perch Polymorphism of leptin gene was examined in wild (Hubei and Hunan section of the Yangtze River, China) and cultivated (Guangdong Chinese Perch Farm, China) populations of Chinese perch (60 individuals for each population) by direct sequencing of each individual (n = 120). SNP screening of leptin gene was conducted by two overlapped fragments (513 and 1202 bp) using two pairs of leptin SNP primers (Table 1). 2.7. Tissue expression of leptin gene in Chinese perch One microgram of total RNA from different tissues was used for reverse transcription with ReverTra Ace qPCR RT Kit (ToYoBo) according to the manufacturer’s recommendations. Beta-actin was amplified as an internal control, which we have shown not to change with treatments (Li et al., 2010; Liang et al., 2007). Gene specific primers were designed with Primer PREMIER Software 5.0, based on cDNA sequence in GenBank (Act: AY885683) (Table 1). The SYBR@ Premix Ex TaqTM Kit (TaKaRa) was used for real-time PCR on a Chromo 4 Real-Time Detection System (MJ Research, Hercules, CA, USA) according to the manufacturer’s instructions. Each PCR reaction consisted of 10 ll 2 SYBR Mix, 0.4 lM forward primer, 0.4 lM reverse primer and 1 ll cDNA as template. Double distilled water was used to adjust the total volume of each reaction to 20 ll. Melting curve analysis of PCR products was performed at the end of each PCR reaction to confirm the specificity. Sterile double distilled water was used as no template control for real-time PCR, and no product was synthesized in the no template control. Reactions were based on a three-step method, 95 °C for 3 min initially, followed by 45 cycles, and each cycle was performed with the temperatures of 95 °C for 20 s, 57 °C for 20 s and 72 °C for 35 s, respectively. Pooled cDNA samples of each tissue were used to generate the calibration curves. The amplification efficiencies of control and target genes were approximately equal and ranged from 93.6% to 101.9%. Gene expression levels were quantified relative to the expression of beta-actin using the optimized comparative Ct (2DDCt) value method (Livak and Schmittgen, 2001). All amplifications were performed in triplicate for each RNA sample. Data are presented as mean ± standard error (n = 5).
S. He et al. / General and Comparative Endocrinology 194 (2013) 183–188
2.8. Statistical analysis Statistical analysis was performed with SPSS13.0 software. Significant differences were found using one-way analysis of variance (ANOVA), followed by the post hoc test (least significant difference test and Duncan’s multiple range test), after confirming for data normality and homogeneity of variances. Differences were considered to be significant if P < 0.05. 3. Results 3.1. Cloning and sequence analysis of Chinese perch leptin cDNA The full-length leptin cDNA of Chinese perch was 1338 bp, containing a 171 bp 50 -untranslated region (50 UTR), a 681 bp 30 untranslated region (30 UTR) and a 486 bp open reading frame (ORF) which encoded 161 amino acids (Fig. 1). A consensus polyadenylation signal (AATAAA) was located at 15 bp upstream from the poly(A). Multiple alignment was carried out based on amino acid sequences of leptin from Chinese perch, other fish species, frog, mouse and human. Chinese perch leptin showed 47.2% and 39.1% amino acid identity with pufferfish leptin and medaka leptin-A, whereas only 15.0–24.0% amino acid identity with zebrafish leptin-A, common carp leptin-I, common carp leptin-II, goldfish leptin-I, channel catfish leptin, rainbow trout leptin-A1, African clawed frog, mouse and human leptins (Fig. 2a). As shown in Fig. 2a and Fig. 2b, the predicted leptin of Chinese perch contained four a-helix domains, a 20-residue putative signal peptide and 141-residue putative mature peptide. Conserved cysteine residues involved in formation of disulfide bridges were found in the
185
predicted leptin of Chinese perch. The predicted tertiary structure (modeled by the ProModII program at the SWISS-MODEL automated protein modeling server, based upon human leptin Protein Data Bank structure file 1AX8.pdb) of Chinese perch leptin was highly conserved with pufferfish, silver carp and human leptins (Fig. 2b), in spite of considerable divergence in primary structures (Fig. 2a). The phylogenetic analysis showed that all vertebrate leptins clustered together. Mammalian leptins clustered with cypriniformes leptins. Chinese perch leptin and the leptin-A of other acanthomorph fishes (grouper-A, pufferfish and medaka-A) were grouped in the same cluster, suggesting that the cloned Chinese perch leptin belong to leptin-A (Fig. 3). 3.2. Characterization of gene organization of Chinese perch leptin Unlike leptin genes of mammals and other fishes with three exons and two introns, Chinese perch leptin gene consisted of two exons and one intron (Fig. 4). The total size of Chinese perch leptin gene was 1398 bp, the sizes of Exon 1 and 2 were 321 and 980 bp, respectively, and the only intron was 97 bp (Fig. 1). The intron of Chinese perch leptin started as GT and ended as AG, and appeared at similar positions as the second intron of pufferfish, silver carp and human mammalian leptin genes (Fig. 4). The size of leptin intron in Chinese perch was similar to those of the second intron in pufferfish (100 bp) and silver carp (111 bp) leptins. 3.3. Characterization of 5’-flanking region of Chinese perch leptin gene Analysis of a 357 bp promoter region of Chinese perch leptin gene revealed typical TATA box and motifs for Sp1, CAP, GATA,
Fig. 1. Nucleotide sequence and deduced amino acid sequence of Chinese perch leptin gene. The intron sequence is shown in lowercase and exon sequence in uppercase. The sense strand is displayed from the 50 to 30 . The start codon is marked in bold letters. Three asterisks represent a termination codon. Putative regulatory elements identified in the sequence are underlined. The GenBank accession number is KC778775.
186
S. He et al. / General and Comparative Endocrinology 194 (2013) 183–188
Fig. 2. (A) Alignment of amino acid sequences of Chinese perch leptin and those of other vertebrates. Dashes indicate insertions/deletions. Putative signal peptide cleavage sites are indicated by vertical line. The cysteine residues involved in disulfide bridge formation are shaded, and the a-helices, inferred from human leptin, are boxed. GenBank accession numbers for leptin gene: silver carp (FJ373294), zebrafish (BC064296), carp leptin-I (AJ830745), carp leptin-II (AJ830744), pufferfish (AB193547), mouse (P41160), human (P41159). (B) The predicted tertiary structures of Chinese perch leptin.
HSF2 and CdxA (Fig. 1). Many potential regulatory elements were found, including CCAAT/enhancer-binding protein binding sites (C/EBP), binding sites for hepatocyte-enriched nuclear transcription factor 3 (HNF3B), and sex-determining region Y gene product (SRY) (Fig. 1). 3.4. SNP screening and tissue mRNA expression of leptin gene in Chinese perch The leptin mRNA was expressed abundantly in liver, and low-level expression was detected in brain, intestine, mesenteric adipose tissue, spleen and muscle (Fig. 5). Polymorphism of leptin gene (1398 bp) was examined in wild and cultivated populations of Chinese perch by direct sequencing of each individual (n = 120). No SNP was found in leptin gene, although our sample size was relatively small. 4. Discussion Leptin is a hormone critically involved in food intake and body weight regulation in vertebrates, but the relationship between energy status and leptin has not been clearly established in fish. This study is the first to report a leptin gene missing one intron in Perciformes, and the complete DNA sequence of leptin gene characterized in Perciformes, the largest and most diverse order of teleosts (9300 extant species) (Helfman et al., 1997). In contrast to leptin gene organization of 3 exons and 2 introns in other
vertebrates, leptin gene structure of Chinese perch was encoded by two exons, separated by a short intron with consensus 50 donor (GT) and 30 acceptor (AG) splice sites. Both exons of Chinese perch leptin gene were very similar in length to the corresponding exons of human and pufferfish leptin genes. Importantly, the exon structure of Chinese perch and human leptins offers strong support to the orthology of Chinese perch and mammalian leptins. Chinese perch leptin shared a relatively low amino acid similarity of less than 50% with pufferfish leptin and medaka leptin-A, and the amino acid identity to zebrafish leptin-A, common carp leptinI, common carp leptin-II, goldfish leptin-I, channel catfish leptin, rainbow trout leptin-A1, African clawed frog, mouse and human leptins were only 15.0–24.0%. Despite the poor identity of primary sequences between vertebrate leptins, the predicted tertiary structure of Chinese perch leptin was highly conserved with pufferfish, silver carp and human leptins. This was consistent with the results observed in other species (Crespi and Denver, 2006; Huising et al., 2006; Kurokawa et al., 2005; Murashita et al., 2008). The predicted leptin of Chinese perch contained four a-helix domains, a 20-residue putative signal peptide and 141-residue putative mature peptide. Conserved cysteine residues involved in formation of disulfide bridges connecting the carboxy-terminal ends of-helices C and D were found in the predicted leptin of Chinese perch. The results further support unambiguously the orthology of fish and mammalian leptins. Consistent with its function as an endocrine indicator of adipose energy reserves, leptin is produced predominantly by fat in mammals (Hedges, 2002; Roy et al., 2003). In contrast to
S. He et al. / General and Comparative Endocrinology 194 (2013) 183–188
187
Fig. 5. Relative mRNA abundance of leptin gene in different tissues of Chinese perch (means ± SE, n = 5). Data are presented as mean ± standard error (n = 5). ⁄ indicates significant differences between groups based on one-way analysis of variance (ANOVA) followed by the post hoc test (P < 0.05).
Fig. 3. Phylogenetic tree of leptins. The tree was constructed by NJ method with the Mega 3.1 software. Selected bootstrap values from 100 tranditional trees are shown in each internal branch of the phylogenetic tree nodes. Chinese perch leptin gene cloned in this study is indicated by N. GenBank accession numbers for leptins: pufferfish (AB193547), medaka-A (AB193548), medaka-B (AB457589), Atlantic salmon-A1 (FJ830677), Atlantic salmon-A2 (GU584004), Atlantic salmon-B1 (JX131301), Atlantic salmon-B2 (JX131302), rainbow trout-A1 (AB354909), zebrafish-A (BN000830), zebrafish-B (AM901009), carp leptin-I (AJ830745), carp leptin-II (AJ830744), goldfish-I (FJ534535), goldfish-II (FJ854572), grass carp-A (EU719623), grass carp-B (JQ080548), grouper-A (JX406147), grouper-B (JX406148), xenopus (AY884210), mouse (NM008493), human (NM000230). GenBank accession numbers for growth hormone (GH): common carp (M27000), mouse (NM_008117), human (NM_000515). GenBank accession numbers for ciliary neurotrophic factor (CNTF): mouse (NM_170786), human (NM_000614).
mammals, leptin was primarily expressed in liver of Chinese perch, which was in agreement with previous reports that liver appeared to be a major site for leptin production in fish (zebrafish (Danio rerio), Gorissen et al., 2009; common carp (Cyprinus carpio),
Huising et al., 2006; Japanese medaka (Oryzias latipes), Kurokawa and Murashita, 2009; pufferfish (Takifugu rubripes), Kurokawa et al., 2005; rainbow trout (Oncorhynchus mykiss), Murashita et al., 2008; the striped bass (Morone saxatilis), Won et al., 2012). Like adipose tissue, liver also represents a major lipid storage site in fish (Won et al., 2012). In addition to liver, leptin gene expressions were also observed in brain, intestine, mesenteric adipose tissue, spleen and muscle of Chinese perch at low levels. Several potential regulatory elements were identified in the 50 flanking region of leptin gene in Chinese perch. These included domains for C/EBP (Hwang et al. 1996; Miller et al. 1996; Taniguchi et al. 2002), TATA box, and Sp1 (Fukuda and Iritani, 1999). Mason et al. (1998) reported that mutations in the C/EBP, TATA motif or Sp1 caused an approximately 2.5 or 10-fold decrease in promoter activity. We hypothesize that these motifs that contribute to leptin promoter function might be involved in the hormonal and metabolic transcriptional regulation of leptin gene in Chinese perch. Additional studies are needed to eluciate the regulation of leptin gene expression in Chinese perch. In summary, we reported the identification of leptin gene in Chinese perch. The high level expression in liver, and the lack of the first intron and polymorphism in the population shed new light on leptin evolutionary diversification and physiological function of vertebrate leptin gene. Competing interests The authors declare that they have no competing interests.
Fig. 4. Leptin gene structures of Chinese perch, silver carp, pufferfish and human. Exons are shown as boxes (open boxes are untranslated regions), and introns are shown in lines.
188
S. He et al. / General and Comparative Endocrinology 194 (2013) 183–188
Acknowledgments This work was financially supported by the Key Projects in the National Science & Technology Pillar Program during the Twelfth Five-year Plan Period (2012BAD25B04), the National Natural Science Foundation of China (31272641, 31172420), the National Basic Research Program of China (2009CB118702) and the Fundamental Research Funds for the Central Universities (2010PY010, 2011PY030).
References Angotzi, A.R., Stefansson, S.O., Nilsen, T.O., Rathore, R.M., Rønnestad, I., 2013. Molecular cloning and genomic characterization of novel leptin-like genes in salmonids provide new insight into the evolution of the leptin gene family. Gen. Comp. Endocrinol. 187, 48–59. Baker, D.M., Larsen, D.A., Swanson, P., Dickhoff, W.W., 2000. Long-term peripheral treatment of immature coho salmon (Oncorhynchus kisutch) with human leptin has no clear physiologic effect. Gen. Comp. Endocrinol. 118, 134–138. Boswell, T., Dunn, I.C., Wilson, P.W., Joseph, N., Burt, D.W., Sharp, P.J., 2006. Identification of a non-mammalian leptin-like gene: characterization and expression in the tiger salamander (Ambystoma tigrinum). Gen. Comp. Endocrinol. 146, 157–166. Chowdhury, I., Chien, J.T., Chatterjee, A., Yu, J.Y., 2004. In vitro effects of mammalian leptin, neuropeptide-Y, beta-endorphin and galanin on transcript levels of thyrotropin beta and common alpha subunit mRNAs in the pituitary of bighead carp (Aristichthys nobilis). Comp. Biochem. Physiol. B. 139, 87–98. Crespi, E.J., Denver, R.J., 2006. Leptin (ob gene) of the South African clawed frog Xenopus laevis. Proc. Natl. Acad. Sci. USA 103, 10092–10097. de Pedro, N., Martinez-Alvarez, R., Delgado, M.J., 2006. Acute and chronic leptin reduces food intake and body weight in goldfish (Carassius auratus). J. Endocrinol. 188, 513–520. Dridi, S., Williams, J., Bruggeman, V., Onagbesan, M., Raver, N., Decuypere, E., Djiane, J., Gertler, A., Taouis, M., 2000. A chicken leptin-specific radioimmunoassay. Domest. Anim. Endocrinol. 18, 325–335. Friedman-Einat, M., Boswell, T., Horev, G., Girishvarma, G., Dunn, I.C., Talbot, R.T., Sharp, P.J., 1999. The chicken leptin gene: has it been cloned? Gen. Comp. Endocrinol. 115, 354–363. Fukuda, H., Iritani, N., 1999. Transcriptional regulation of leptin gene promoter in rat. FEBS Lett. 455, 165–169. Gorissen, M., Bernier, N.J., Nabuurs, S.B., Flik, G., Huising, M.O., 2009. Two divergent leptin paralogues in zebrafish (Danio rerio) that originate early in teleostean evolution. J. Endocrinol. 201, 329–339. Gorissen, M., Bernier, N.J., Manuel, R., de Gelder, S., Metz, J.R., Huising, M.O., Flik, G., 2012. Recombinant human leptin attenuates stress axis activity in common carp (Cyprinus carpio L.). Gen. Comp. Endocrinol. 178, 75–81. Hedges, S.B., 2002. The origin and evolution of model organisms. Nat. Rev. Genet. 3, 838–849. Helfman, G.S., Collette, B.B., Facey, D.E., 1997. The Diversity of Fishes. Blackwell Science, Malden, MA. Huising, M.O., Geven, E.J., Kruiswijk, C.P., Nabuurs, S.B., Stolte, E.H., Spanings, F.A., Verburg-van Kemenade, B.M., Flik, G., 2006. Increased leptin expression in common carp (Cyprinus carpio) after food intake but not after fasting or feeding to satiation. Endocrinology 147, 5786–5797. Hwang, C.S., Mandrup, S., MacDougald, O.A., Geiman, D.E., Lane, M.D., 1996. Transcriptional activation of the mouse obese (ob) gene by CCAAT/enhancer binding protein alpha. Proc. Natl. Acad. Sci. USA 93, 873–877. Klok, M.D., Jakobsdottir, S., Drent, M.L., 2007. The role of leptin and ghrelin in the regulation of food intake and body weight in humans: a review. Obes. Rev. 8, 21–34. Kurokawa, T., Murashita, K., 2009. Genomic characterization of multiple leptin genes and a leptin receptor gene in the Japanese medaka, Oryzias latipes. Gen. Comp. Endocrinol. 161, 229–237. Kurokawa, T., Uji, S., Suzuki, T., 2005. Identification of cDNA coding for a homologue to mammalian leptin from pufferfish, Takifugu rubripes. Peptides 26, 745–750.
Li, G.G., Liang, X.F., Xie, Q., Li, G., Yu, Y., Lai, K., 2010. Gene structure, recombinant expression and functional characterization of grass carp leptin. Gen. Comp. Endocrinol. 166, 117–127. Liang, X.F., Li, G.Z., Yao, W., Cheong, L.W., Liao, W.Q., 2007. Molecular characterization of neuropeptide Y gene in Chinese perch, an acanthomorph fish. Comp. Biochem. Physiol. B. 148, 55–64. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25, 402–408. Londraville, R.L., Duvall, C.S., 2002. Murine leptin injections increase intracellular fatty acid-binding protein in green sunfish (Lepomis cyanellus). Gen. Comp. Endocrinol. 129, 56–62. Margetic, S., Gazzola, C., Pegg, G.G., Hill, R.A., 2002. Leptin: a review of its peripheral actions and interactions. Int. J. Obes. 26, 1407–1433. Mason, M.M., He, Y., Chen, H., Quon, M.J., Reitman, M., 1998. Regulation of leptin promoter function by SP1, C/EBP, and a novel factor. J. Endocrinol. 139, 1013– 1022. Miller, S.G., De Vos, P., Guerre-Millo, M., Wong, K., Hermann, T., Staels, B., Briggs, M.R., Auwerx, J., 1996. The adipocyte specific transcription factor C/EBPalpha modulates human ob gene expression. Proc. Natl. Acad. Sci. USA 9, 5507–5511. Murashita, K., Uji, S., Yamamoto, T., Ronnestad, I., Kurokawa, T., 2008. Production of recombinant leptin and its effects on food intake in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B. 150, 377–384. Murashita, K., Jordal, A.-E.O., Nilsen, T.O., Stefansson, S.O., Kurokawa, T., Björnsson, B.T., Moen, A.-G.G., Ronnestad, I., 2011. Leptin reduces Atlantic salmon growth through the central pro-opiomelanocortin pathway. Comp. Biochem. Physiol. A. 158, 79–86. Peyon, P., Zanuy, S., Carrillo, M., 2001. Action of leptin on in vitro luteinizing hormone release in the European sea bass (Dicentrarchus labrax). Biol. Reprod. 65, 1573–1578. Roy, S.S., Mukherjee, M., Bhattacharya, S., Mandal, C.N., Kumar, L.R., Dasgupta, S., Bandyopadhyay, I., Wakabayashi, K., 2003. A new cell secreting insulin. Endocrinology 144, 1585–1593. Sahu, A., 1998. Leptin decreases food intake induced by melanin-concentrating hormone (MCH), galanin (GAL) and neuropeptide Y (NPY) in the rat. Endocrinology 139, 4739–4742. Sahu, A., 2004. Minireview: a hypothalamic role in energy balance with special emphasis on leptin. Endocrinology 145, 2613–2620. Schwartz, M.W., Woods, S.C., Porte, D., Seeley, R.J., Baskin, D.G., 2000. Central nervous system control of food intake. Nature 404, 661–671. Seeley, R.J., van Dijk, G., Campfield, L.A., Smith, F.J., Burn, P., Nelligan, J.A., Bell, S.M., Baskin, D.G., Woods, S.C., Schwartz, M.W., 1996. Intraventricular leptin reduces food intake and body weight of lean rats but not obese Zucker rats. Horm. Metab. Res. 28, 664–668. Silverstein, J.T., Plisetskaya, E.M., 2000. The effects of NPY and insulin on food intake regulation in fish. Am. Zool. 40, 296–308. Taniguchi, Y., Itoh, T., Yamada, T., Sasaki, Y., 2002. Genomic structure and promoter analysis of the bovine leptin gene. IUBMB Life 53, 131–135. Taouis, M., Chen, J.W., Daviaud, C., Dupont, J., Derouet, M., Simon, J., 1998. Cloning the chicken leptin gene. Gene 208, 239–242. Volkoff, H., Eykelbosh, A.J., Peter, R.E., 2003. Role of leptin in the control of feeding of goldfish Carassius auratus: interactions with cholecystokinin, neuropeptide Y and orexin A, and modulation by fasting. Brain Res. 972, 90–109. Weil, C., Le Bail, P.Y., Sabin, N., Le Gac, F., 2003. In vitro action of leptin on FSH and LH production in rainbow trout (Onchorynchus mykiss) at different stages of the sexual cycle. Gen. Comp. Endocrinol. 130, 2–12. Wetzler, S., Dumaz, V., Goubern, M., Tome, D., Larue-Achagiotis, C., 2004. Intraperitoneal leptin modifies macronutrient choice in self-selecting rats. Physiol. Behav. 83, 65–72. Won, E.T., Baltzegar, D.A., Picha, M.E., Borski, R.J., 2012. Cloning and characterization of leptin in a Perciform fish, the striped bass (Morone saxatilis): control of feeding and regulation by nutritional state. Gen. Comp. Endocrinol. 178, 98– 107. Yacobovitz, M., Solomon, G., Gusakovsky, E.E., Levavi-Sivan, B., Gertler, A., 2008. Purification and characterization of recombinant pufferfish (Takifugu rubripes) leptin. Gen. Comp. Endocrinol. 156, 83–90. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J.M., 1994. Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425–432.
Contents lists available at ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Gene structure and expression of leptin in Chinese perch Shan He a, Xu-Fang Liang a,⇑, Ling Li a, Wei Huang a, Dan Shen a, Ya-Xiong Tao b a b
Key Laboratory of Freshwater Animal Breeding, Ministry of Agriculture, College of Fisheries, Huazhong Agricultural University, 430070 Wuhan, PR China Department of Anatomy, Physiology, and Pharmacology, College of Veterinary Medicine, Auburn University, Auburn, AL 36849-5519, United States
a r t i c l e
i n f o
Article history: Received 23 April 2013 Revised 14 September 2013 Accepted 16 September 2013 Available online 26 September 2013 Keywords: Leptin gene Gene structure Tissue expression Single nucleotide polymorphism Chinese perch (Siniperca chuatsi)
a b s t r a c t Leptin is an important hormone involved in regulation of food intake, energy expenditure and reproduction in mammals, but its role in acanthomorph fishes remains scant. In the present study, we characterized leptin gene structure and its tissue expression in Chinese perch (Siniperca chuatsi). In contrast to typical leptin gene organization of 3 exons and 2 introns in other vertebrates, Chinese perch leptin gene consisted of 2 exons and 1 intron. This is the first leptin gene characterized in Perciformes, and is also the first leptin gene lacking an intron reported in Perciformes. The unique gene structure, the conservation of both cysteines that form the single disulfide bridge in leptin, and stable clustering in phylogenetic analyses substantiate the unambiguous orthology of mammalian and fish leptins, despite low amino acid identity. Polymorphism of leptin gene was examined in wild and cultivated populations of Chinese perch by direct sequencing of 120 fish. No SNP was found in leptin gene. Leptin mRNA of Chinese perch was highly expressed in liver, and expressed at low levels in brain, visceral adipose tissue, intestine, spleen and muscle. Ó 2013 Elsevier Inc. All rights reserved.
1. Introduction The first obese gene cloned in mouse by Zhang et al. (1994) is identified as the factor responsible for profound obesity and type II diabetic phenotype of the obese mouse mutant. The hormonal product of obese gene, leptin, is a member of the class-1 alpha helical cytokines that is produced primarily by adipose tissue in mammals. It has been shown to play a key role in regulation of food intake and energy expenditure (Klok et al., 2007; Margetic et al., 2002; Schwartz et al., 2000), and acute or chronic leptin treatment (intracerebroventricular injection, intraperitoneal injection or osmotic pump infusion) reduces food intake and body weight in mammals (Sahu, 2004, 1998; Seeley et al., 1996; Wetzler et al., 2004). Since the discovery of leptin in mouse, extensive studies have been done on leptin orthologues and their biological roles in non-mammalian species (Boswell et al., 2006; Crespi and Denver, 2006). Although a leptin homologue has been isolated from chicken (Taouis et al., 1998) and injection of recombinant chicken leptin reduces food intake (Dridi et al., 2000), there is some doubt concerning this discovery (Boswell et al., 2006; Friedman-Einat et al., 1999). The first sequence of a leptin-like molecule in fish has been reported in pufferfish by Kurokawa et al. (2005). Taking ⇑ Corresponding author. Fax: +86 27 8728 2114. E-mail addresses: [email protected] (S. He), [email protected] (X.-F. Liang), [email protected] (L. Li), [email protected] (W. Huang), [email protected] (D. Shen), [email protected] (Y.-X. Tao). 0016-6480/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ygcen.2013.09.008
into account the very low similarity of leptin sequences among different fish groups, e.g. salmonid fish (Kurokawa et al., 2005; Angotzi et al., 2013), cyprinid fish (Huising et al., 2006), pufferfish (Kurokawa et al., 2005), and striped bass (Won et al., 2012), the physiological roles and signaling pathways of fish leptins might be group-specific, and are still obscure. Several studies sought to investigate leptin effects in fish using mammalian leptins. Results from these attempts are controversial, as some researchers observed no conclusive effects (Baker et al., 2000; Londraville and Duvall, 2002; Silverstein and Plisetskaya, 2000), whereas others reported that mammalian leptin affected expression and release of pituitary hormones in European sea bass, bighead carp, rainbow trout and common carp (Chowdhury et al., 2004; Gorissen et al., 2012; Peyon et al., 2001; Volkoff et al., 2003; Weil et al., 2003), and reduced food intake in goldfish (de Pedro et al., 2006). Recently, several studies have employed species-specific leptin for exploring its biological functions in fish (grass carp, Li et al., 2010; Atlantic salmon, Murashita et al., 2011; rainbow trout, Murashita et al., 2008; pufferfish, Yacobovitz et al., 2008). Huising et al. (2006) reported the presence of duplicate obese genes in common carp. However, the whole gene structure (including 50 -flanking region, the first exon and the first intron) of obese gene in common carp is still unknown. In this study, leptin gene structure and its tissue expression were characterized in Chinese perch (Siniperca chuatsi), which would shed new light on leptin evolutionary diversification and physiological function of vertebrate leptin gene.
184
S. He et al. / General and Comparative Endocrinology 194 (2013) 183–188
2. Materials and methods 2.1. Materials All primers were synthesized by Sangon (Shanghai, China). 2.2. Fish sampling Chinese perch S. chuatsi (50–70 g) were obtained from Guangdong Freshwater Fish Farm (Panyu, Guangdong, China), and kept in 96 L of fresh water with continuous system of water filtration and aeration at constant temperature (25 ± 1 °C). Fish were fed once each day to satiation with live India mrigal Cirrhina mrigola. Fish were anesthetized and sacrificed by decapitation. Brain, liver, intestine, muscle, spleen and adipose tissues were dissected immediately for total RNA isolation. The animal protocol was approved by Huazhong Agricultural University (Wuhan, Hubei, China). 2.3. RNA isolation and reverse transcription Total RNA was isolated from different tissues with SV Total RNA Isolation System (Promega, Madison, WI, USA) combined with DNase digestion to eliminate DNA contamination according to the manufacturer’s instructions. The extracted RNA was resuspended in 50 ll RNase-free water and quantified using Eppendorf Biophotometer (Hamburg, Germany). Reverse transcription was performed with oligo(dT)18 primer using First Strand cDNA Synthesis Kit (ToYoBo, Tokyo, Japan). 2.4. Cloning and sequencing of full-length leptin cDNA of Chinese perch Four degenerate primers (LEP01F, LEP02F, LEP03R and LEP04R) were designed to clone partial leptin cDNA sequence of Chinese perch (Table 1). Gene specific primers were designed in the cloned PCR fragment of leptin cDNA of Chinese perch for 50 -RACE and 30 RACE (Table 1). 30 -RACE was performed using a 30 -Full RACE Core Set (TaKaRa, Tokyo, Japan). Total liver RNA was reverse transcribed to cDNA in the presence of oligo(dT)-3 site adaptor primer (provided in the kit). The prepared cDNA was first amplified by PCR with 0.2 lM primer LEP30 01F and 0.2 lM 3 site adaptor primer (provided in the kit). The second PCR was performed using primer
Table 1 Primer sequences for PCR. Primers
Sequence (50 –30 )
Primers for partial fragment LEP01F LEP02R
CCGGTGGAAGTCGTGRARATGAARWS ACTGAGGAATCCCGTCAGCGANGADATNTC
Primers for 50 RACE PCR LEP50 01R LEP50 02R
GCAGGTGGACTGAGAGTCA CCTAACCACCAGCTGTTC
Primers for 30 RACE PCR LEP 30 01F LEP 30 02F
TGACTCTCAGTCCACCTGC ACAGCCTGATCTCTGACAC
Primers for 50 -flanking region frLEP01R frLEP02R
ACACAGTGGTGGTGGGTTCAGGGTCA AAGTTCTCTGGATGTCGGTCGAC
Primers for intron i1LEP01F i2LEP01F i2LEP02R
GTCTTCATGACACAGTGGT GAACAGCTGGTGGTTAGG GCAGGTGGACTGAGAGTCA
Primers for real-time PCR D-LEP01F D-LEP02R D-ACT01F D-ACT02R
CCTCTGCCAGTGGAAGTA GTGTCAGAGATCAGGCTGT CGTGACATCAAGGAGAAG GTAGGTGGTCTCGTGGAT
LEP30 02F and 3 site adaptor primer. 50 -RACE was performed using SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, USA). One lg total liver RNA was reverse transcribed with 50 -RACE CDS Primer and SMART II A Oligonucleotide (provided in the kit). In the first PCR, cDNA was amplified with two primer sets, LEP5’01R and Universal Primer A Mix (UPM, provided in the kit). Primer sets (LEP50 02R and Nested Universal Primer A (NUP, provided in the kit)) were used in the second PCR. The final PCR products were analyzed with agarose gel electrophoresis, cloned into pGEM-T Easy vector (Promega) and sequenced. Phylogenetic comparison of protein sequences was carried out by Mega 3.0 software. 2.5. Cloning of intronic DNA and 50 -flanking region of leptin gene Genomic DNA of Chinese perch was isolated using Blood & Cell Culture DNA Kit (QIAGEN, Hilden, Germany) according to the manufacture’s recommendations. Primers for PCR amplification of intron and 50 -flanking region of leptin gene are listed in Table 1. Universal Genome Walker Kit (Clontech) was used for cloning 50 flanking region of leptin gene. The final PCR products were analyzed with agarose gel electrophoresis, cloned into pGEM-T Easy vector (Promega) and sequenced. Putative transcription regulatory regions were predicted with TFBIND (http://tfbind.ims.u-tokyo.ac.jp/). 2.6. SNP screening of leptin gene in Chinese perch Polymorphism of leptin gene was examined in wild (Hubei and Hunan section of the Yangtze River, China) and cultivated (Guangdong Chinese Perch Farm, China) populations of Chinese perch (60 individuals for each population) by direct sequencing of each individual (n = 120). SNP screening of leptin gene was conducted by two overlapped fragments (513 and 1202 bp) using two pairs of leptin SNP primers (Table 1). 2.7. Tissue expression of leptin gene in Chinese perch One microgram of total RNA from different tissues was used for reverse transcription with ReverTra Ace qPCR RT Kit (ToYoBo) according to the manufacturer’s recommendations. Beta-actin was amplified as an internal control, which we have shown not to change with treatments (Li et al., 2010; Liang et al., 2007). Gene specific primers were designed with Primer PREMIER Software 5.0, based on cDNA sequence in GenBank (Act: AY885683) (Table 1). The SYBR@ Premix Ex TaqTM Kit (TaKaRa) was used for real-time PCR on a Chromo 4 Real-Time Detection System (MJ Research, Hercules, CA, USA) according to the manufacturer’s instructions. Each PCR reaction consisted of 10 ll 2 SYBR Mix, 0.4 lM forward primer, 0.4 lM reverse primer and 1 ll cDNA as template. Double distilled water was used to adjust the total volume of each reaction to 20 ll. Melting curve analysis of PCR products was performed at the end of each PCR reaction to confirm the specificity. Sterile double distilled water was used as no template control for real-time PCR, and no product was synthesized in the no template control. Reactions were based on a three-step method, 95 °C for 3 min initially, followed by 45 cycles, and each cycle was performed with the temperatures of 95 °C for 20 s, 57 °C for 20 s and 72 °C for 35 s, respectively. Pooled cDNA samples of each tissue were used to generate the calibration curves. The amplification efficiencies of control and target genes were approximately equal and ranged from 93.6% to 101.9%. Gene expression levels were quantified relative to the expression of beta-actin using the optimized comparative Ct (2DDCt) value method (Livak and Schmittgen, 2001). All amplifications were performed in triplicate for each RNA sample. Data are presented as mean ± standard error (n = 5).
S. He et al. / General and Comparative Endocrinology 194 (2013) 183–188
2.8. Statistical analysis Statistical analysis was performed with SPSS13.0 software. Significant differences were found using one-way analysis of variance (ANOVA), followed by the post hoc test (least significant difference test and Duncan’s multiple range test), after confirming for data normality and homogeneity of variances. Differences were considered to be significant if P < 0.05. 3. Results 3.1. Cloning and sequence analysis of Chinese perch leptin cDNA The full-length leptin cDNA of Chinese perch was 1338 bp, containing a 171 bp 50 -untranslated region (50 UTR), a 681 bp 30 untranslated region (30 UTR) and a 486 bp open reading frame (ORF) which encoded 161 amino acids (Fig. 1). A consensus polyadenylation signal (AATAAA) was located at 15 bp upstream from the poly(A). Multiple alignment was carried out based on amino acid sequences of leptin from Chinese perch, other fish species, frog, mouse and human. Chinese perch leptin showed 47.2% and 39.1% amino acid identity with pufferfish leptin and medaka leptin-A, whereas only 15.0–24.0% amino acid identity with zebrafish leptin-A, common carp leptin-I, common carp leptin-II, goldfish leptin-I, channel catfish leptin, rainbow trout leptin-A1, African clawed frog, mouse and human leptins (Fig. 2a). As shown in Fig. 2a and Fig. 2b, the predicted leptin of Chinese perch contained four a-helix domains, a 20-residue putative signal peptide and 141-residue putative mature peptide. Conserved cysteine residues involved in formation of disulfide bridges were found in the
185
predicted leptin of Chinese perch. The predicted tertiary structure (modeled by the ProModII program at the SWISS-MODEL automated protein modeling server, based upon human leptin Protein Data Bank structure file 1AX8.pdb) of Chinese perch leptin was highly conserved with pufferfish, silver carp and human leptins (Fig. 2b), in spite of considerable divergence in primary structures (Fig. 2a). The phylogenetic analysis showed that all vertebrate leptins clustered together. Mammalian leptins clustered with cypriniformes leptins. Chinese perch leptin and the leptin-A of other acanthomorph fishes (grouper-A, pufferfish and medaka-A) were grouped in the same cluster, suggesting that the cloned Chinese perch leptin belong to leptin-A (Fig. 3). 3.2. Characterization of gene organization of Chinese perch leptin Unlike leptin genes of mammals and other fishes with three exons and two introns, Chinese perch leptin gene consisted of two exons and one intron (Fig. 4). The total size of Chinese perch leptin gene was 1398 bp, the sizes of Exon 1 and 2 were 321 and 980 bp, respectively, and the only intron was 97 bp (Fig. 1). The intron of Chinese perch leptin started as GT and ended as AG, and appeared at similar positions as the second intron of pufferfish, silver carp and human mammalian leptin genes (Fig. 4). The size of leptin intron in Chinese perch was similar to those of the second intron in pufferfish (100 bp) and silver carp (111 bp) leptins. 3.3. Characterization of 5’-flanking region of Chinese perch leptin gene Analysis of a 357 bp promoter region of Chinese perch leptin gene revealed typical TATA box and motifs for Sp1, CAP, GATA,
Fig. 1. Nucleotide sequence and deduced amino acid sequence of Chinese perch leptin gene. The intron sequence is shown in lowercase and exon sequence in uppercase. The sense strand is displayed from the 50 to 30 . The start codon is marked in bold letters. Three asterisks represent a termination codon. Putative regulatory elements identified in the sequence are underlined. The GenBank accession number is KC778775.
186
S. He et al. / General and Comparative Endocrinology 194 (2013) 183–188
Fig. 2. (A) Alignment of amino acid sequences of Chinese perch leptin and those of other vertebrates. Dashes indicate insertions/deletions. Putative signal peptide cleavage sites are indicated by vertical line. The cysteine residues involved in disulfide bridge formation are shaded, and the a-helices, inferred from human leptin, are boxed. GenBank accession numbers for leptin gene: silver carp (FJ373294), zebrafish (BC064296), carp leptin-I (AJ830745), carp leptin-II (AJ830744), pufferfish (AB193547), mouse (P41160), human (P41159). (B) The predicted tertiary structures of Chinese perch leptin.
HSF2 and CdxA (Fig. 1). Many potential regulatory elements were found, including CCAAT/enhancer-binding protein binding sites (C/EBP), binding sites for hepatocyte-enriched nuclear transcription factor 3 (HNF3B), and sex-determining region Y gene product (SRY) (Fig. 1). 3.4. SNP screening and tissue mRNA expression of leptin gene in Chinese perch The leptin mRNA was expressed abundantly in liver, and low-level expression was detected in brain, intestine, mesenteric adipose tissue, spleen and muscle (Fig. 5). Polymorphism of leptin gene (1398 bp) was examined in wild and cultivated populations of Chinese perch by direct sequencing of each individual (n = 120). No SNP was found in leptin gene, although our sample size was relatively small. 4. Discussion Leptin is a hormone critically involved in food intake and body weight regulation in vertebrates, but the relationship between energy status and leptin has not been clearly established in fish. This study is the first to report a leptin gene missing one intron in Perciformes, and the complete DNA sequence of leptin gene characterized in Perciformes, the largest and most diverse order of teleosts (9300 extant species) (Helfman et al., 1997). In contrast to leptin gene organization of 3 exons and 2 introns in other
vertebrates, leptin gene structure of Chinese perch was encoded by two exons, separated by a short intron with consensus 50 donor (GT) and 30 acceptor (AG) splice sites. Both exons of Chinese perch leptin gene were very similar in length to the corresponding exons of human and pufferfish leptin genes. Importantly, the exon structure of Chinese perch and human leptins offers strong support to the orthology of Chinese perch and mammalian leptins. Chinese perch leptin shared a relatively low amino acid similarity of less than 50% with pufferfish leptin and medaka leptin-A, and the amino acid identity to zebrafish leptin-A, common carp leptinI, common carp leptin-II, goldfish leptin-I, channel catfish leptin, rainbow trout leptin-A1, African clawed frog, mouse and human leptins were only 15.0–24.0%. Despite the poor identity of primary sequences between vertebrate leptins, the predicted tertiary structure of Chinese perch leptin was highly conserved with pufferfish, silver carp and human leptins. This was consistent with the results observed in other species (Crespi and Denver, 2006; Huising et al., 2006; Kurokawa et al., 2005; Murashita et al., 2008). The predicted leptin of Chinese perch contained four a-helix domains, a 20-residue putative signal peptide and 141-residue putative mature peptide. Conserved cysteine residues involved in formation of disulfide bridges connecting the carboxy-terminal ends of-helices C and D were found in the predicted leptin of Chinese perch. The results further support unambiguously the orthology of fish and mammalian leptins. Consistent with its function as an endocrine indicator of adipose energy reserves, leptin is produced predominantly by fat in mammals (Hedges, 2002; Roy et al., 2003). In contrast to
S. He et al. / General and Comparative Endocrinology 194 (2013) 183–188
187
Fig. 5. Relative mRNA abundance of leptin gene in different tissues of Chinese perch (means ± SE, n = 5). Data are presented as mean ± standard error (n = 5). ⁄ indicates significant differences between groups based on one-way analysis of variance (ANOVA) followed by the post hoc test (P < 0.05).
Fig. 3. Phylogenetic tree of leptins. The tree was constructed by NJ method with the Mega 3.1 software. Selected bootstrap values from 100 tranditional trees are shown in each internal branch of the phylogenetic tree nodes. Chinese perch leptin gene cloned in this study is indicated by N. GenBank accession numbers for leptins: pufferfish (AB193547), medaka-A (AB193548), medaka-B (AB457589), Atlantic salmon-A1 (FJ830677), Atlantic salmon-A2 (GU584004), Atlantic salmon-B1 (JX131301), Atlantic salmon-B2 (JX131302), rainbow trout-A1 (AB354909), zebrafish-A (BN000830), zebrafish-B (AM901009), carp leptin-I (AJ830745), carp leptin-II (AJ830744), goldfish-I (FJ534535), goldfish-II (FJ854572), grass carp-A (EU719623), grass carp-B (JQ080548), grouper-A (JX406147), grouper-B (JX406148), xenopus (AY884210), mouse (NM008493), human (NM000230). GenBank accession numbers for growth hormone (GH): common carp (M27000), mouse (NM_008117), human (NM_000515). GenBank accession numbers for ciliary neurotrophic factor (CNTF): mouse (NM_170786), human (NM_000614).
mammals, leptin was primarily expressed in liver of Chinese perch, which was in agreement with previous reports that liver appeared to be a major site for leptin production in fish (zebrafish (Danio rerio), Gorissen et al., 2009; common carp (Cyprinus carpio),
Huising et al., 2006; Japanese medaka (Oryzias latipes), Kurokawa and Murashita, 2009; pufferfish (Takifugu rubripes), Kurokawa et al., 2005; rainbow trout (Oncorhynchus mykiss), Murashita et al., 2008; the striped bass (Morone saxatilis), Won et al., 2012). Like adipose tissue, liver also represents a major lipid storage site in fish (Won et al., 2012). In addition to liver, leptin gene expressions were also observed in brain, intestine, mesenteric adipose tissue, spleen and muscle of Chinese perch at low levels. Several potential regulatory elements were identified in the 50 flanking region of leptin gene in Chinese perch. These included domains for C/EBP (Hwang et al. 1996; Miller et al. 1996; Taniguchi et al. 2002), TATA box, and Sp1 (Fukuda and Iritani, 1999). Mason et al. (1998) reported that mutations in the C/EBP, TATA motif or Sp1 caused an approximately 2.5 or 10-fold decrease in promoter activity. We hypothesize that these motifs that contribute to leptin promoter function might be involved in the hormonal and metabolic transcriptional regulation of leptin gene in Chinese perch. Additional studies are needed to eluciate the regulation of leptin gene expression in Chinese perch. In summary, we reported the identification of leptin gene in Chinese perch. The high level expression in liver, and the lack of the first intron and polymorphism in the population shed new light on leptin evolutionary diversification and physiological function of vertebrate leptin gene. Competing interests The authors declare that they have no competing interests.
Fig. 4. Leptin gene structures of Chinese perch, silver carp, pufferfish and human. Exons are shown as boxes (open boxes are untranslated regions), and introns are shown in lines.
188
S. He et al. / General and Comparative Endocrinology 194 (2013) 183–188
Acknowledgments This work was financially supported by the Key Projects in the National Science & Technology Pillar Program during the Twelfth Five-year Plan Period (2012BAD25B04), the National Natural Science Foundation of China (31272641, 31172420), the National Basic Research Program of China (2009CB118702) and the Fundamental Research Funds for the Central Universities (2010PY010, 2011PY030).
References Angotzi, A.R., Stefansson, S.O., Nilsen, T.O., Rathore, R.M., Rønnestad, I., 2013. Molecular cloning and genomic characterization of novel leptin-like genes in salmonids provide new insight into the evolution of the leptin gene family. Gen. Comp. Endocrinol. 187, 48–59. Baker, D.M., Larsen, D.A., Swanson, P., Dickhoff, W.W., 2000. Long-term peripheral treatment of immature coho salmon (Oncorhynchus kisutch) with human leptin has no clear physiologic effect. Gen. Comp. Endocrinol. 118, 134–138. Boswell, T., Dunn, I.C., Wilson, P.W., Joseph, N., Burt, D.W., Sharp, P.J., 2006. Identification of a non-mammalian leptin-like gene: characterization and expression in the tiger salamander (Ambystoma tigrinum). Gen. Comp. Endocrinol. 146, 157–166. Chowdhury, I., Chien, J.T., Chatterjee, A., Yu, J.Y., 2004. In vitro effects of mammalian leptin, neuropeptide-Y, beta-endorphin and galanin on transcript levels of thyrotropin beta and common alpha subunit mRNAs in the pituitary of bighead carp (Aristichthys nobilis). Comp. Biochem. Physiol. B. 139, 87–98. Crespi, E.J., Denver, R.J., 2006. Leptin (ob gene) of the South African clawed frog Xenopus laevis. Proc. Natl. Acad. Sci. USA 103, 10092–10097. de Pedro, N., Martinez-Alvarez, R., Delgado, M.J., 2006. Acute and chronic leptin reduces food intake and body weight in goldfish (Carassius auratus). J. Endocrinol. 188, 513–520. Dridi, S., Williams, J., Bruggeman, V., Onagbesan, M., Raver, N., Decuypere, E., Djiane, J., Gertler, A., Taouis, M., 2000. A chicken leptin-specific radioimmunoassay. Domest. Anim. Endocrinol. 18, 325–335. Friedman-Einat, M., Boswell, T., Horev, G., Girishvarma, G., Dunn, I.C., Talbot, R.T., Sharp, P.J., 1999. The chicken leptin gene: has it been cloned? Gen. Comp. Endocrinol. 115, 354–363. Fukuda, H., Iritani, N., 1999. Transcriptional regulation of leptin gene promoter in rat. FEBS Lett. 455, 165–169. Gorissen, M., Bernier, N.J., Nabuurs, S.B., Flik, G., Huising, M.O., 2009. Two divergent leptin paralogues in zebrafish (Danio rerio) that originate early in teleostean evolution. J. Endocrinol. 201, 329–339. Gorissen, M., Bernier, N.J., Manuel, R., de Gelder, S., Metz, J.R., Huising, M.O., Flik, G., 2012. Recombinant human leptin attenuates stress axis activity in common carp (Cyprinus carpio L.). Gen. Comp. Endocrinol. 178, 75–81. Hedges, S.B., 2002. The origin and evolution of model organisms. Nat. Rev. Genet. 3, 838–849. Helfman, G.S., Collette, B.B., Facey, D.E., 1997. The Diversity of Fishes. Blackwell Science, Malden, MA. Huising, M.O., Geven, E.J., Kruiswijk, C.P., Nabuurs, S.B., Stolte, E.H., Spanings, F.A., Verburg-van Kemenade, B.M., Flik, G., 2006. Increased leptin expression in common carp (Cyprinus carpio) after food intake but not after fasting or feeding to satiation. Endocrinology 147, 5786–5797. Hwang, C.S., Mandrup, S., MacDougald, O.A., Geiman, D.E., Lane, M.D., 1996. Transcriptional activation of the mouse obese (ob) gene by CCAAT/enhancer binding protein alpha. Proc. Natl. Acad. Sci. USA 93, 873–877. Klok, M.D., Jakobsdottir, S., Drent, M.L., 2007. The role of leptin and ghrelin in the regulation of food intake and body weight in humans: a review. Obes. Rev. 8, 21–34. Kurokawa, T., Murashita, K., 2009. Genomic characterization of multiple leptin genes and a leptin receptor gene in the Japanese medaka, Oryzias latipes. Gen. Comp. Endocrinol. 161, 229–237. Kurokawa, T., Uji, S., Suzuki, T., 2005. Identification of cDNA coding for a homologue to mammalian leptin from pufferfish, Takifugu rubripes. Peptides 26, 745–750.
Li, G.G., Liang, X.F., Xie, Q., Li, G., Yu, Y., Lai, K., 2010. Gene structure, recombinant expression and functional characterization of grass carp leptin. Gen. Comp. Endocrinol. 166, 117–127. Liang, X.F., Li, G.Z., Yao, W., Cheong, L.W., Liao, W.Q., 2007. Molecular characterization of neuropeptide Y gene in Chinese perch, an acanthomorph fish. Comp. Biochem. Physiol. B. 148, 55–64. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25, 402–408. Londraville, R.L., Duvall, C.S., 2002. Murine leptin injections increase intracellular fatty acid-binding protein in green sunfish (Lepomis cyanellus). Gen. Comp. Endocrinol. 129, 56–62. Margetic, S., Gazzola, C., Pegg, G.G., Hill, R.A., 2002. Leptin: a review of its peripheral actions and interactions. Int. J. Obes. 26, 1407–1433. Mason, M.M., He, Y., Chen, H., Quon, M.J., Reitman, M., 1998. Regulation of leptin promoter function by SP1, C/EBP, and a novel factor. J. Endocrinol. 139, 1013– 1022. Miller, S.G., De Vos, P., Guerre-Millo, M., Wong, K., Hermann, T., Staels, B., Briggs, M.R., Auwerx, J., 1996. The adipocyte specific transcription factor C/EBPalpha modulates human ob gene expression. Proc. Natl. Acad. Sci. USA 9, 5507–5511. Murashita, K., Uji, S., Yamamoto, T., Ronnestad, I., Kurokawa, T., 2008. Production of recombinant leptin and its effects on food intake in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B. 150, 377–384. Murashita, K., Jordal, A.-E.O., Nilsen, T.O., Stefansson, S.O., Kurokawa, T., Björnsson, B.T., Moen, A.-G.G., Ronnestad, I., 2011. Leptin reduces Atlantic salmon growth through the central pro-opiomelanocortin pathway. Comp. Biochem. Physiol. A. 158, 79–86. Peyon, P., Zanuy, S., Carrillo, M., 2001. Action of leptin on in vitro luteinizing hormone release in the European sea bass (Dicentrarchus labrax). Biol. Reprod. 65, 1573–1578. Roy, S.S., Mukherjee, M., Bhattacharya, S., Mandal, C.N., Kumar, L.R., Dasgupta, S., Bandyopadhyay, I., Wakabayashi, K., 2003. A new cell secreting insulin. Endocrinology 144, 1585–1593. Sahu, A., 1998. Leptin decreases food intake induced by melanin-concentrating hormone (MCH), galanin (GAL) and neuropeptide Y (NPY) in the rat. Endocrinology 139, 4739–4742. Sahu, A., 2004. Minireview: a hypothalamic role in energy balance with special emphasis on leptin. Endocrinology 145, 2613–2620. Schwartz, M.W., Woods, S.C., Porte, D., Seeley, R.J., Baskin, D.G., 2000. Central nervous system control of food intake. Nature 404, 661–671. Seeley, R.J., van Dijk, G., Campfield, L.A., Smith, F.J., Burn, P., Nelligan, J.A., Bell, S.M., Baskin, D.G., Woods, S.C., Schwartz, M.W., 1996. Intraventricular leptin reduces food intake and body weight of lean rats but not obese Zucker rats. Horm. Metab. Res. 28, 664–668. Silverstein, J.T., Plisetskaya, E.M., 2000. The effects of NPY and insulin on food intake regulation in fish. Am. Zool. 40, 296–308. Taniguchi, Y., Itoh, T., Yamada, T., Sasaki, Y., 2002. Genomic structure and promoter analysis of the bovine leptin gene. IUBMB Life 53, 131–135. Taouis, M., Chen, J.W., Daviaud, C., Dupont, J., Derouet, M., Simon, J., 1998. Cloning the chicken leptin gene. Gene 208, 239–242. Volkoff, H., Eykelbosh, A.J., Peter, R.E., 2003. Role of leptin in the control of feeding of goldfish Carassius auratus: interactions with cholecystokinin, neuropeptide Y and orexin A, and modulation by fasting. Brain Res. 972, 90–109. Weil, C., Le Bail, P.Y., Sabin, N., Le Gac, F., 2003. In vitro action of leptin on FSH and LH production in rainbow trout (Onchorynchus mykiss) at different stages of the sexual cycle. Gen. Comp. Endocrinol. 130, 2–12. Wetzler, S., Dumaz, V., Goubern, M., Tome, D., Larue-Achagiotis, C., 2004. Intraperitoneal leptin modifies macronutrient choice in self-selecting rats. Physiol. Behav. 83, 65–72. Won, E.T., Baltzegar, D.A., Picha, M.E., Borski, R.J., 2012. Cloning and characterization of leptin in a Perciform fish, the striped bass (Morone saxatilis): control of feeding and regulation by nutritional state. Gen. Comp. Endocrinol. 178, 98– 107. Yacobovitz, M., Solomon, G., Gusakovsky, E.E., Levavi-Sivan, B., Gertler, A., 2008. Purification and characterization of recombinant pufferfish (Takifugu rubripes) leptin. Gen. Comp. Endocrinol. 156, 83–90. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J.M., 1994. Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425–432.