- Email: [email protected]
Gene trapping and functional genomics
PER SPE CTI VE
TO\va rus the beginni ng of this century, genetic linkage in mice wa:-. fir~t ohsclTe d I and a:-. \\t~ approac h the end of the l'entury, mappin g of the whole genom e is virtually comrle !e, High demlty genetic mars of the m()u~e \\ ith an a\ erage :-.padng hetwee n marker s e(juh'a1ent to a phy:-.ic.l1 di:-.tance of only abollt 400 kh have heen puhli:-.he(F and there is continuing r.lpid progress on several fronts, Moreover, the high degree of :-.ynteny con:-.ervatiol1 hd\H:,en human and ll1ou~e allow~ dose linkage relati()n.,hip~ to he inferred one 10 the other, Added to the:-.e mappin g resource~, partial sequen ce infonnation from cDNA clones is being rapidly acquire d and these express ed sequen ce tags (many una:-.~igned to loci) are beginni ng to ,"aturate the set of fum:tional gene,.. , TIle availability of the~e re!>ources ha!> facilitated an almo~t expone ntial ri:-.e in the rate of physical mappin g and cloning of I(x:i with known functlon:-. or phenoty pe, but these are few compar ed with the dlscon~ry of new gene,., of unknow n genetic function Comple te sequen cing of the 'simpler' genome:-. of bacteria and yeaM ha .. found a considerahle percent age of entirely nm'el gene:-. and many loci can he identified only tentatively to a cIa ..:-. of functionj-'l,
Gene trapping and functional genomics MARTIN J. EVANS (mje2®cam,ac.uk) MARK B.L. CARLTON (mblc®mole,bio,cam.ac.uk) ANDREAS P. RUSS (apr@moie,bio.cam.ac,uk)
Classical genetics depends upon investigation offunction by random destruction u'ith linle i"'ormation on structure, Modern mapping using random polymorphisms, cloning and sequencing investigates structure withoutJunctlon. The genome projects with tbeir rapid gene discovery are, however, redefining classical genetic approaches. The efficient translation oj tbis wealth of new inJormation into insights In biological Junction at molecular, ceUular and organlsmal levels requires large-scale approaches to the generation oj mutants. Gene trapping in embryonic stem (ES) ceUs aUows an efficient approacb to tbefunctional analysis oJtbe murine genome. The usuaUy separate processes ofgene discovery, mapping, tbe obsenJation oJthe expression Phenotype-driven genetic screens pattern and the mutant phenot)pe in "ivo, can be Any approa ch to an underst anding of the role of integrated by the use of an indexed library oj the~e gene:-. in the context of the biolo!-,'Y of the organis m inserttonaUy mutated ES ceU clones, It should be possible require s genetic experim ents, and for mamma ls the to generate mutants for a large proportion of the genes of experimental genetic organism is the mouse, Mo:-.t genetic the mammaUan genome, !'IlTeenS in the mOU1>e have heen phenoty pe-driv en !'IlTCen:-., whkh have a long and succe~sful tradition, and are hemg adopted as one route to tying funltion to gene6 , The method:-. for mutage nesis ill lJil'O, treatme nt with the chemiclI El\l' or with X-mys, are well e<;tablbhed and effective but their apphca tlon IS limited, for a genom ewide screen in particular, by the animal housing resourc e required, Segregation of mutation.;, definin g alleli.;m, .,creens for rel'e ..:-.ive mutant s (e:-.pel'ially tho:-.e with an emhryonic or fetal lethahty >, require vast resource:-., Moreover, the po~itional dOlling method:-. require d to identify these anonymou~ mutation~. althoug h benet1ting gre-.nly from the in<:rea:-.ingly detailed genomi c re ..ources, are :-.tlll the search for the needle in a haystack that require s a large in\,e:-.tment of manpo wer and resourn::-., An alternative approa ch is il1 I'lfro mutage nesb by gene targeting or gene trappin g in embryo nic ..tern (ES) celb (Box 1 >, which allow mutations to he char.ll'terized in cell culture before tran:-.lat1on to the 1110U ..C, From thc.;c ES cells, tram'genic strains can he cstahli.. hed directly that carry a :-.ingle defined and tagged mutation, Each of these strains can ea:-.i1y he genoty ped, which greatly reduces the animal :-.pace reqUired and simp\ifie:-. breedin g manage ment and fal'ilitate~ phenot ypic analy.,i~ or .,creening,
applied their experie nce with homologou:-. recomb ination in tbsue culture celb and were able to e:-.tablish meth{xl~ that, with suh.~equent refinements and addition s, have allowed virtually any designe r m(xlification, rJnging from point mutation:-. to insertional inactivation, large deletion:-., tran~locati()n~, or tis:-.ue-~pedfjc gene inactivation, to be introdu(:ed into a known cloned m()u~e 1(X'us, Since 19H9, when the fir~t mice were derived with a loclls :-.peclfically modifie d by homolo gou,.. remmh ination in ES cell:-., the.,e technique:-. have hel'n u~ed to mutate approx imately 1% of the total predict ed numhe r of mouse 1(X'i and have hecome an e:-.:-.ential experim ental tool t{)r functional analy,.,h In mamma ltan genet Il':-' ,
ES cells and gene targeting: direct mutation of characterized loci ES celI:-. provide the route of choice for introdu cing mutated loci into the mouse genome~, One of the most direct and fruitful experim ental method s ha,~ been gene targetin g by homolo gous recomb ination , S(xm after the fiN e~tahli:-.hment of the route to germ line tran:-.genesis hy ES cell:-.H, Oliver Smithies et ai,') and Mario Capecc hi lO
TIC (OpHlf.dll t' I'}or .1,...,\ IU '-I... U..'llll.,' PII "'II I HlH-')=).!':;(')"')I II l .11-'""
I hi \11
n~h .... n',... rH d
OiftX
S~.I'TEM8~R
(}~1~ -r "'II~ 00
Box 1. ES cells Emhryonk ~1l'1l1 (ES) cdb are plunpoll'ntl,ll l'l'll~ dl'n\'l'd from pI'l'1l1lplanlallon mOll~l' l'l11hryo~ lhal rl'pfl'~l'nl a ~Iage of dl'vc\opml'111 hdore ~L'grl'galion 01 tIll' gl'rlll rdl linc..' from ,omall( linl'agl'" ~ I, Tlll'Y em he rl'-lIllorpoJ';lIl'd mlo prl'unplant:luon l'mhryo., to gl\'l' n~l' to l hlllll'f1( III In' , \\ hll h arl' fl'l1lk', (;aml'll'~ deflwd from till' (UhUfl'd ('db pa~~ Ihl' E," ll'll gl'nOm(' 10 lill' ()If~pnng (gl'rlll 11Ilt' Irans1l111>"jon) In contrJ,.,1 10 Ihl' flo .... ~Il'm cdl., III ,I normal emhryo, lllllured ES l db an: avallahle 111 unhmlll'd numher, 'l an 1)(' mamlall1l'd II1lh('lr lll1(hfkrt'nll:lIl,d ~Ialt' inddlJ1l1l'\Y, and arl'
:Il'l'e,,~ihll' for oh'>l'f\';l1lon :111<1 ('XIX'T1lJll'llIal m:lmplll:1 110n Tll1~ ha~ allowed a Illllnhl'r of l'XfWfln ll'llIal aprroadl l'~ 10 Ihl' mo(hh(,lIlon oflhl' E~ tell gt'nollll' III lUItUfl', l"lwllally
lhl' rl't'Cl\ t'!)' ot rarl' l'\'l~nt." ... ud, ,I'" "lll'-(hrl't'll'd Illllt,lllon:-. for Illl' gl'nl'ral1on of 1ll00N,' kn()l'kollt~,
1997 VOl , 13 No, 9
3 70
PER SPE CTI VE
A gene knockout project is a (a) (a) lengthy experiment. 1bere is the , p inevitable time of mouse breeding: GenomiccDNA DNA Genomi , (, , \ , 19 days incubation time before birth \ I I I I I / /' / , , , \ \ \ ,I II I / " " \ \ \I I I for an injected blastocyst and a miniI II // / \ " , , \ \\ \ \ III II /1 / '\ \ \ II I I /I mum life cycle of two to three \ '" ,\ \ III I I ' I , ,\ \ \ , II' months for the mice, gives a minimum time of about six months beAAAAAAA 123 mRNA 4 mRNA fore homozygous offspring could be born. In real life, nothing can be (b) (b) quite this fast, and the time required to generate the targeting construct, to isolate the desired ES cell clone, and to analyse the phenot ype, contribute to the overall time required to carry out this analysis. It is, therefore, difficult to imagine, that the GenomiccDNA DNA Genomi remaining 9')OAl 99% of genes in the mouse can be handled by targeted mutaTRAP AAAAAAA AA THf\Fl (i)(i) 11 genesis. How can these method s AAAAA possibly keep pace with genom e 1 (ii) 2 TRAP AAAAAAA AA (ii) mRNA AAAAA projects, which are produc ing such mRNA a huge and rich resource of new information? Homol ogous recombiFIGuu FJGUIU! 1. General strategy of gene trapping. (a) Expression scheme nation cannot easily be adapte for a typical gene adapted d to showing the promoter (P) driving expression of a gene with four exons 0-4) and three a production line approach; each tarintrons (pale grey) tenninating at the endogenous polyadenylation signal (black circle). circle). geting vector has to be individually Gene trapping relies on the random insertion of a promoterless reporter gene into the constructed and each targeting event genome of the host cell. celL Cell clones in which the expression of the reporter is driven by must be individually verified. Even cellular regulatory elements can be easily recovered by applying the appropriate with an optimistic estimate of three selection, usually G418. The reporter gene can be brought under the control of the months of work for generating a endogenous locus by long-range association with an enhancer, but more useful is a direct targeted targete d ES cell line, comprehensive fusion into the functional locus with consequential insertional mutation. (b) Integration (5' untranslated or in-frame) or (in coverage of the genom e would still into an exon (i) (;' (ii) into an intran intron (splice-acceptor for in-frame fusion, or splice-acceptor plus internal ribosome-entry site for any frame). require some 25 000 person years. frame). Would it be possible to acceler- A variety of different designs of gene-trap construct have been used. With a typical vector that uses selection for G418 resistance, the majority of genes expressed in embryon ate the preparation of the reqUire ic stem required cells can be transfonnation ation (not shown) allows efficient genetically modified clone by the single-co trapped. Retroviral vector transform py insertions. Informative sequence can be gained from analysis of novel exom; use of pre-pre pared resources? With fused to the trap cassette in mRNAs, mRNAs, or from the genomic locus directly (ringed).. isogenic DNA homology of reasonable lengthll lengthll.12 ,12 and a plus/m inus selectio n 13 over 10% of selected clones can be correctly sequen ce and allows rapid molecu lar characterization. targeted; so for gene targeting the resource require d This is an invaluable advant age in an animal with a would be the targeting construct. Despite their concep- large genom e (compa red with Drosophila), small litters tual Simplicity, these targeting constructs often take (compa red with zebrafish) and high maintenance costs. some time to make. It would be conceivable, but diffiIndeed , the first deliberate mutagenesis of mice with ES cult, to generate compre hensive pre-pre pared libraries cells used the insertion of retroviral vectors 16 16.. By genn germ of targeting vectors. vectors. Some approa ch to this has been line transmission and breeding, several mutations includmade by provision of numbe rs of suitable plasmids ing nodal (Refs 17-19) and the craniosynostosis muwith selection cassettes and by the genera tion of tation Bey (Ref. 20) were identified. The rates of mutation genomi genomicc libraries in vectors with suitable counter-selec- achieved (1 in 10-20 insertions) were useful, but in vivo table cassettes built into the flanks 14 . One effective and screening vel)' laborious. is very alternative fast-track method is to use long-range peR to A more attractive approa ch to random insertional prepare the genom ic homolo gy fragments 15. mutage nesis in ES cells is the use of 'gene trap' conIn contrast to homolo gous recombination, the gener- structs (Fig. 1). The principle behind these is that the ation of mouse strains from ES cell lends itself to scale-up inserte d DNA mutate s an endoge nous locus and inserts because each clone can be handle d similarly. There- a reporte r (usuallyy the neomycin gene and/or the (3(usuall fore, a resource of ES cells carrying random insertional galactosidase gene) under the transCr transcriptiona iptionall control of mutations could proVide provide the starting point for rapid and the trapped promoter. By selecting for the activation of the cost-effective functional analysis of the murine genome. reporte r gene in cell culture, the rate of gene disruption in recove red clones approa ches 100%. 100010. Thus, the screenIDIado lo8ertlooal mutaa mutageenais nesis and gene traps: known ing for mutage nic insertions takes place in vitro. Several ins mutatlo mutadooa os in In unkno unknow wn n Jod loci groups have used randomly chosen gene trap events for Unlike chemical mutagens or X-rays, a mutation transmi transmission ssion through the germ line and found a surpriscaused by DNA insertion tags the locus with a known ingly high incidence of interesting phenot ypes in vivo.
---1
i.
H
• •
....
_ _
..
:
-
.
-
-
/
I
. 1---
TIG SEPTEM SEPTEMB BER ER 1997 VOL. VOl. 13 No.9
371
PERSPECTIVE
(b) (b)
(c) (c)
(c) (c) GenomIC sequence
Genomic sequence
Genomic map· chr 7 Genomic map - chr 7
- ... .
...,.......
.......
... _
0,..
It~·
~ Q"Io'
.... '.-.l
...,
. . .1...
"'"
,,~
f..e _ 1 ~
_
~
.....,
~_
.. J •
-- -,. l't;1I . .
""2t"O'flt:"' ~
.;.
.... ,.., . . "'2 l1li •
""",
.... """'"
:;:w.- ..'01_'
..... ..... .. ............. ...... ta:J
·. ""·t _ ·t oao
. ,..,.,.
'~
·..- ·s· ...
lilt
" . ......... 1IIII' ::'·:oc.; . -
=: --
.t~I...tttcc.c.gc.e"nU99·.. ttI99'ttt99ctct~t.qtt
cDNA sequence cDNA sequence
ACCACTGCTTGACATACACCCCACAATATTTTCAM
ACCAGTGCTTGACATACACCCCAGMTAT1'TTGAM
AGCGCCCMATCCCACAGGCCCCCCCMAATTTTCC
AGCGCCCAAATCCC~GGCP..AAJ.TT'l'TCG
TTCCATCCCACACCCAAGCATAC'M'CCCACTTCTTC
TTCCA'l'CCGACACGCAAGCATAGTTGGGAGTTCTTC
TCCCATATGCCATCCACATA.C'fGCCA.TCACCACTCC TCCCATATGCCATGCACATAC'l'GCCA'l'CACCACTCG ACCTCCATCCTCCACCACACTATTTA.CAr.GTCACCT ~'1'CGTCGACGACAGTATTTAGAGGTGACCT
ACCTCTATCAAACCCCCTCCTCAACCTCACTATTAA
ACC'l'CTA'l'GAAAGCCc:crcGTCAACCTGAC'rATTAA
A(;GGGCTAACACAATCCCCACMCTACACCCACTTT AGGGGGT.v..CACAA'l'CC:CCAGAACTAGA.GCCAGTTT ACACATMATCTAACAN:TTACCCMCATCCACCTT
ACACATAAATCTMCAACTTACCCAACATCCACCTT
TMGATACTACTACTCCTTCTTGGCCCCATCTATAC
TAAGATACTACTAC'fCCT'rC'rTGGCCGGATCTATAG
CCCTCCCACCCTATACACCCCACACCCATATA7TAA
GCCTCCCACCCTATACACCCGACAGGCATATA'I'TM
ACACTACCCCT<:CCATAACCCCACCAAATTCCGCCC ACAG'I'AGCCC'1'CCCATAAGCGCA/;CAAATTGCGCCC AACCCTTCCCCCMTCGTCTCACTTCCTCACCf'TAA
AACGGTl'CCCCGAATCGTCTCAC'l'TCG'l'CAGGTl'AA
CAt:J.CCTCTCCCCCACACCACTCTTCATCATCACCA CAGACCTCTCGGCCAGACCACTGTTCATGA'l'CAGCA CTCATTTTATATACCTCACTCCACACATCTTCCTCC CTCA'M'TTATATAGCTGACTCGACACATCTTCcTGC TACTACCCTCCT
TAGTACCCTCC1'
FIGUlU! 2. Clones of gene-trapped embryonic stem cells are picked from the initial selection dish directly to a multiwell plate so that FIGURE
plates can be readily replicated and stored frozen. This format provides sufficient cells for staining and extraction of cDNA and genomic DNA. Specifically selected clones can be expanded further. (a) Shows multiwell plates containing gene-trap clones. clones. (h) (0) Transient chimera: 7.5-day-old egg cylinder showing expression in the ectodermal region. This clone would not have been selected for special study on the basis of this expression pattern alone, but (c) flanking genomic sequence allows mapping of this new locus and a shown). (d) Isolation of 5' flanking cDNA recessive mutation showing alteration of the shape of the head was recovered in mice (not shown). by RACE (rapid amplification of eDNA cDNA ends). The sequence of one such done clone is shown. shown. (e) Mice bearing this trap show a very specific pattern of staining in the cerebellum, and homozygous mutant animals (f) show a specific phenotype. The major alternative index for (I» but also these clones, which does not depend upon genomic information, is the pattern of transgene expression shown here in vivo (b) shown). fruitfully explored by differentiation in vitro (not shown).
Recently, several modified trapping strategies have been introduced that allow specific selection for integrations in subsets of genes, for example, secreted retinoid-responsive genes or genes involved proteins21 , retinOid-responsive •23 •, There are two main methods used in apoptosis 22 ,23 for the introduction of gene traps into cells: cells: (1) retroviral vectors 24,25 and (2) electroporation of naked DNA. Electroporation, which is the method of choice for DNA transformation for homologous recombination, is frequently used to insert gene trap constructs26 , but is relatively inefficient. Retroviral vectors provide a much higher efficiency of gene transfer and integrate, in contrast to electroporated DNA, as an intact single copy. copy.
An indexed resource of mutated ES cells Generating ES cell lines with a single gene mutation by gene trapping is very straightforward and hundreds of clones can be produced from a single experiment. The clones can be grown, replicated and frozen in 96-well dishes, and samples of this size can be used genotypic analysis. for genotypiC analysis. Thus, handling of large numbers of clones becomes feasible 27 . A comparatively small facility could readily scale-up to handle tens of thousands of clones and more. These frozen clones can be mutations. The timescale, kept as an in vitro library of mutations. cost and resources needed to set up and maintain this library are small compared with genome projects and large mouse facilities.
TIG SEPTEMBER 1997 VOL. 13 NO.9
372
PER SPE CTI VE
Every library requires a suitable index to be really useful. In this case, the index needs to relate to the locus mutated, or to its potential phenotype, and should be based upon in vitro assays as much as possible. Our laboratory and others have been develop develo ping ing techniques to adapt the molecular characterization of gene-trap integrations integrat ions to large numbers of clones in multiwell formats (Fig. 2). Four different types of data can be used to index the library.
cDNA sequence
In the past, most 'gene trappers' have relied on PCR-based techniques to isolate the cellular transcript sequence fused 5' to the gene-trap marker. Although the amplification of specific cDNAs can be achieved rapidly, cloning and screening of informative-sized cDNAs have proven to be time consuming but this has recently been circumvented by a specific protocol for direct sequencing28 . The cDNA sequence infonna information allows identification of homologies to known sequence, although these 5' exons are the least well represented in the present cDNA and EST (expressed sequence tag) databases. Furthermore, cDNA information is of only limited use for the monitoring of mouse breeding and gene mapping.
Genomic sequence
The genomi genomiCc DNA flanking flanking the insertion can be cloned by conventional methods of library construction and screen. Plasmid rescue 29 and inverse PCR methods are also applicable. Flanking clone or sequence information is required for genotyping mutant mice derived from the cell line. With the progress of the EST projects it should soon be possible to deduce cDNA information from any genomi genomicc sequence containing an exon, thus obviating the need for a separate cloning step for cDNA.
Map positio positionn The knowledge of flanking genomic sequences allows PCR-based genetic and physical mapping, for example, using interspecific backcross panels or somatic cell hybrids. This information is crucial to link the ES cell resource to pre-existing information on mouse or, by synteny, human mutations.
Expression pattern The developmental expression pattern of the reporter gene 30 in chimeric mice provides an alternative phenotype for selection of gene loci. loci. This can be important because many knockout studies have confirmed that an unexpe ctedly mild phenotypic effect can result from inactivation of a locus and such a mutation would not be found by a conventional genetic screen for mutated phenotype. Conversely, apparently interesting patterns of expression can be seen from unexpected loci (Fig. 3). The in vivo differentiation of ES cells is faster than mouse breeding studies but still a large effort for a relatively small number of clones. Others have sought the same type of information by in vitro differentiation, either spontaneous or induced induce d (Refs 31, 32). In a similar approach, the information on tissue-specific gene expression contained in EST databases, possibly refined by in situ hybridization, can be used to choose candid candidaate te genes for establishing mutant strains.
FIGURE 3. A 14-day-old embryo showing a pattern of LacZ FlGUBE staining as the reporter of a gene trap. Patterns of transgene e~pression expressi on are a pointer to gene function, which is entirely different from those proVided provided by analysis of the genomic or cDNA structure.. Surprising and unexpected patterns can be found. The locus trapped here has subsequently been identified (by cDNA and genomic flanking sequence analyses) as an insertion within histone H3-3a.
We propos e that the most effective way forward fOIWard is by a 'clone and sequence first' approach. ch. The sequence should be (or include) genomic flanking sequence as well as cDNA in order to facilitate mapping and so that any subsequent breeding programme can be immediately followed. Such an approach coupled with in vitro differen differe ntiation tiation!/expres expresssion ion screens should allow preselectio n of trapped loci for subsequent analYSi analysis in vivo. Pre-selection would either be on the basis of the genetic homologies known or predicted, or be on the bases of differential tissue-specific expression. With pre-characterization of the mutated loci the resources needed for screens at the whole animal level, be they phenotyypic phenot piC or by expression pattern, are much reduced. The informa information tion gained needs to be preserved, distributed and integrated. To this end, as part of an EU co-operative project, we have set up a database using ACeDB the Caenomabdit rbabditis elegans database to handle all information on gene-trap mutants from sequence information to genetic map, and pictures of in vivo expression patterns and mutant phenotypes. The usefulness of these data wiU will increase with accumulation of data from the genome projects.
Trapping the whole genome?
The numbe r of genes that can be mutated with gene traps is not known. The current standard vectors should
TIG SEPTEMBER 1997 VOL. TlG VOl. 13 NO.9 No.9
373
PEllSPECTIVE
Stop Press ... Tagged sequence mutagenesis: two new screens Th,' ),!IIIIII" III (.111,,1 ,III" 1{1I1,'\ ~ h,IH' 11'(l'III" ,k'IIIIIII'",II,'d Ih,' 1l',I'IllIhl\ 01 !'ol'qu"llll,d-ll.1'l.'d ~l'Ill' 11,111 '( Il'\.'n1> l h,Ir,IlI\"r1I111~ "" ,11111 ,,", 11Ih'gl ,II 11111'. 1"'lll'II1\"" 111.\\1'\1'1. Ih,'''' ,Ill' ,01l,,,I"I,lhll' dllll'll'II\l" 111 Ill\' r,lIll1 01 known g,'m', ,11111 I'~" 11'111\1',,'" • 01 IIP,II I'" \\llh 1111111'11'11'1\ nll,,'1 '1''1111'11\'" II I "'I'll' I hi 'l1u, I,m Ill' 1·'pI.IIIll'(1 h\ dtll"f\'nn'lo III \l'lIoi ""'lgII (hll\\llhlll \ 1'1,,1 11'1'" ,Ill l'I",II0P"I,lh ," 'phil' ,II I I 'pi III UtI'S II,IP I'1'(' FI~ 111. tlu, ,Irtllll'l ,lIld ,I d )':\-h,I'<'" II0IIUl)! '1I,1I1')!\. \\11111' 1111'" 1'1 al.hl"" ,1111111 'phllllg 11'110\\1,11 \l'dOl IFI)! It) ,and 1l'1'1I\l'r\"d gl'nll11\11 "'(Iul'nl'\,' h~ 1'1,1'"11" I.." II,' Ih,''1' \I'dlll' .111' ""I'" I.. h,lIl' dlll"I\'1I1 I,II~"I' ,mt! II 1"111,11"' 10 Ill' 'hO\\11 ho\\ 111,111\ 01 1IIl.' nO\d "'qll,·n,,·' !t ..m 1',Idi .IppIII,11 h Il'pll·','nl h"n,1 1111" ):"11'"
References
"h
I Lho\\llhllf\." ,'111111')1)-) \"d ICle" .!\ J I h, "'. (. 1'1,,1 11')1)-, .\"' (,"C'II,'/ Ih. HX -i II
I~il-l'ii(l
lx' ,Ihk- 10 Ir,Ip "II g,..'111'1> I'XPll'''l'd III ES 'l'II" Ihl' l'1>IImall' lor Ilw nllmlx'r 01 gl'nl'1o 1\-pII"II" \""pi l'1o'l'(l in ,I 1oin~k' wll In"" 110 \II', ,Ilthollgh M'wr,ll \\Orkl'r, 111 11ll' hl'ld Ix,lil'\'\' Ihal 11';\11'>( npliollal \ ol1lrol III E~ l\'1I1o I' 'k',lky' and. Ihl'R'foll'. till' numl",'" 01 pot\'lltlal 1.1I~I'1 Al'll\'lo i1> Illlll h highl'r COH'r,Igl' could ,,1»1) lx' IIll rl',I1ol'd hy pa"~llIl'I liM' 01 difkrl'lll \\"clor d\'Mgn, E"pl'nl'nl'l' With promot,'rk')\)\ gl'lll' targl'tlllg \l',·tor.' MIAAl'1ot., Ih.lt ,I Mlh:.t,lIlllal Illlmlx'r 01 A\'l1l'1o Ihat had I""l'n Ihought to h\, I'Xpr\'''l'd onl~ .11 !all'r lIl'\ l'iopll1l'nl,11 '1,IAl" l',m ,1111 rdatiw inahility to indul'l' 1ouhtll' or g,lin-of-funl'lIon mut.ltIOIl1>. B~l·.llI:-.t' of th~1ol' IIIllItatiOl11o. ~I'Ill'-tr.lp t~dl nology dOl'1o not tIlll'nd to "lIlx'r:-.t'd~ t.. rgl't~d mllt~lIion.~ .md ph~llotyp~-dfl\'t'11 1o\'\'\'l'n1> til 1111ll', or to l op~ tl1l' war ~llur..llion mut'lgl'nl'.,i:. h,l' IX'l'n apphl'<.l o,() 1olll·(·I·:O"...fully to thl' analy:.b of l'arly dl'wlopnll'nt in /)ms(lphlill or z~hrJtNl. Rathl'r, it 110 inll'mk'd to Intl'gr..lIl' t.lpld gl'nl' dbl'O\'l'ry, mappin~ and nlUt~Igl'nl'si:. hy minimil.ing till' dTon rl'
References 1 II:lld:lOl'.,1 n S. Spnllll. A I> and lIald:lOl'. l\; \1('. (19):;) ./ (;('II('(jcs:;. I.H-U:; 2 l>il'lndl. W.P ('I (/1 (1')1)";) Pm,: ,\'all ,1mtl Sn (. ,Ii A I)l, lOK·Il)...lIlH~.i
3 Pk',!'ol hlllann. R I> ('/ (II (l1)l):;) S(.'I('II(," 2h9. I%-'i 12 4 liufll'.IU. lI. ('I til (I')IX) s('I('IIu'r I, 'i-ttl S I>ulun, B (I')IX1) 7il'IIt1.~ (;""e'/ ll, 2h.~-r() 6 BrO\\ n. ~.I) and Il l'll'f1>. I (11)lX») 1h'IIds (;,,/1('1 12. ·I;H-I.~'i . 7 E\'an:., ~1.J. (11)l)61/:'IIt/{)cmwl .1Ma" .i. 1'i-:;2 8 E\·an)\. ~I.J . nr:,dlt,~. A and Rohl'rt"'n. F. (1I)X.i) 10
II II' Rid,'. II . ;\I.I,md,I)! F R ,and Ik'm!\. A (11)1.)2) Pm.: ,\all :tmel SCI ( S.-I H9, 'i I.!H-'i I,U U Ikng. C ,IIIl.I <':'lllI..'\.\'III. ~I R (11)1)2) .1/(11 C£'II 111(1/ 12. Hh<;-.i.i-I
U
.\ClllI/t' .Hh.
(Vol
2()),
Cold Spnn~ H:lrhor L:llx)r,ltor\'
:\ IX-.~'i.!
,., '\'111" 1\1 ('I al «1\)lJ I) /ti1l7hhmqlws I". ~(I-~'i IS \ ,lIIlonl. ~ . I>,IInl'~. ~. ,lI1d 1:\',10)\. ~IJ (11)l)~ I T/'(//I.~
R".~
, .!,--.!<;"
16 "udlll.
~I
R , Ur:ldll". A.. Rolll..'n)llm. 1':.1 and I':\·:ms. ;\1.1
( I')l'n .\allllt' :\16. 29'i-.M4
I i Conlon, F I., l\.tnh. K S .lIld Rolll'n"m. 1':.1 (11)91) /'}('n'/Ii/lI/I('/11 III. %9-'»1 I
IB Conlon. F L 1'1 til II,)\) I) lJt.n'lo/>I/I('III1211. 1919-19!X 19 I.hou. '\ J. ('I al (1\)I).i) .\il/lllt' :\61. 'i I.i-'i ,MI <-,II \ton. ;\1 B I. .and 1:\ :1111>. ~I,I (199'i) (;('11,,1 R('.'. 6~. 2.i-1 ,11 ~",Irn\"" \\' C . ~lo1>:o..,11: . IllIrtll.'~. S ~I ,and Ik'ddlllJ.,rtnn. R' (1 1)1)<;) I'm. \'all .-k{Ic/ !!ii:1 (' S .-I 92.
Cl'i92-M96
..t lJ.i. 16--lClX.! 23 Ru~,. A 1'. ('I a/ ( 1')lX,) PmI' ,\ill/ .-\cati Sd (' .'I :l 9.t 1'i'!-9-1<;lX-I 24 \on Melt-hiler. H , Rl'dd\'. ~ and Rull',·. H.E (19')()) PmI.' .\(111 .-taul Sd I .11.-1 ·X-. :\-.-\.i-.i-_~':' 2J 1-1I1'(lndl. (j ,lIld ScIO:lno. I' (11)1.)1) (;"/1('$ [Jt.'I' <;, l'i I:\-I 'i2.i 26 (;I",ll'l, -\. ,1O\nl'r A I.. Ro",lIlt.,1 :lnd Sk,lml". \X' C « IlJXC)) .'it/('II((' 211. 16:\-16'i 2i F.\ .1010, M.,1 «llJl) I) 111 Cellllm/oRI' .4 I"{I/)O/,(IIOI")' 1/(l/Ielhoo/.J«Cl.'iI'.,1 • l-d ). :kadl'llIk P~:o." 28 To\\ nil,,·. D,I . A\'\.'I)·. R,I .. RO)ot>tl. n .Ind ~karnt'lo. \x· C ( II)lr) (;('1/111/1(' Rl's -.29_-\-29H 29 )111.11, Y. ('Ill/ «19')<;) /1rmll R('s ,\10/. BI't/I/I Res :\1. 1-9 30 \X'Uf1>I. \X' ('llIl ( 1\)1)<; I (;('1""1($ 1:\9. HH94l9'J 31 ~d1l.'l'l'f. C.A. ('llIl II9'Xl) C('I/ Grml'lb Dufer -. 1.:\'1:\-1 1111 32 (~ogo,.,1 A • 1.0\\ I). \X' :lnd Kar.t~ lor~oll. ~I <1 <)lr I ./I·ml/ -I. 1611-16~1l j j Sdl\\'.ln7.I""r~, J> L.. Rolll'n)llm. F. I. and GotT. S.I'. (1990) PIl/(.· .\·tll/ :\md Sd {' S A 32111-:\211 34 E\',tn,. \1.1 and Kaufman. \III (11)K1l.\1I11/1l!~Jl. 1'i+-l'i6
,12 Fom"ll'r. 1..;\1. 1'1 al ( I')IX,) I'm.: .\iltl .4mci SCI (' S
H"':
AlJ. EII""S. II.&L Cnrllo" (/1/(/ A.P. Russ (/n' 111 IlJ(' W'dlwllle' 1'nm'C(/Ill('" R('$(,(lIt-h C(/lIIpm,~II. IIISI/Ill/(, (!f
(;"",,/ic .lltllll/Jul(II/(1/i {)f Ihe /:'ar/I' .1/(III11/whfm /:'mh",o J ()uct.'(·hman. T
\I,IIl"'III.!'\ '-.1110111,1'. K R ,\Ild c'1/X'l·l'IlI. M R (II)XH)
(.'lIIll1'r tIIullk'I'('/II/lI//('lIlal Hlll/oR)'. amll>tYltlllm,'"II{ (;('/It'I/(s ('III1WSII,I' (.'t/lllhl'lt(t:(,. 7('I/II;S (.(1//11 Rlltld. (.(/""mll.~('. ('1\ CB.! IQR
1'\'\':0.,'
"l
<;....(I-';7K 10 Thomas. K R :an<.l C.lJ'll-'c:dli. M R (19X.... ) (.'('1/ 'i I. 'i()~-:; 12 ('1 Cli. 1l9H.... ) ,\(Itlln' .i:\().
TIG SF.PTF.M8FR 1997 VOl, 13 No, 9
374
TO\va rus the beginni ng of this century, genetic linkage in mice wa:-. fir~t ohsclTe d I and a:-. \\t~ approac h the end of the l'entury, mappin g of the whole genom e is virtually comrle !e, High demlty genetic mars of the m()u~e \\ ith an a\ erage :-.padng hetwee n marker s e(juh'a1ent to a phy:-.ic.l1 di:-.tance of only abollt 400 kh have heen puhli:-.he(F and there is continuing r.lpid progress on several fronts, Moreover, the high degree of :-.ynteny con:-.ervatiol1 hd\H:,en human and ll1ou~e allow~ dose linkage relati()n.,hip~ to he inferred one 10 the other, Added to the:-.e mappin g resource~, partial sequen ce infonnation from cDNA clones is being rapidly acquire d and these express ed sequen ce tags (many una:-.~igned to loci) are beginni ng to ,"aturate the set of fum:tional gene,.. , TIle availability of the~e re!>ources ha!> facilitated an almo~t expone ntial ri:-.e in the rate of physical mappin g and cloning of I(x:i with known functlon:-. or phenoty pe, but these are few compar ed with the dlscon~ry of new gene,., of unknow n genetic function Comple te sequen cing of the 'simpler' genome:-. of bacteria and yeaM ha .. found a considerahle percent age of entirely nm'el gene:-. and many loci can he identified only tentatively to a cIa ..:-. of functionj-'l,
Gene trapping and functional genomics MARTIN J. EVANS (mje2®cam,ac.uk) MARK B.L. CARLTON (mblc®mole,bio,cam.ac.uk) ANDREAS P. RUSS (apr@moie,bio.cam.ac,uk)
Classical genetics depends upon investigation offunction by random destruction u'ith linle i"'ormation on structure, Modern mapping using random polymorphisms, cloning and sequencing investigates structure withoutJunctlon. The genome projects with tbeir rapid gene discovery are, however, redefining classical genetic approaches. The efficient translation oj tbis wealth of new inJormation into insights In biological Junction at molecular, ceUular and organlsmal levels requires large-scale approaches to the generation oj mutants. Gene trapping in embryonic stem (ES) ceUs aUows an efficient approacb to tbefunctional analysis oJtbe murine genome. The usuaUy separate processes ofgene discovery, mapping, tbe obsenJation oJthe expression Phenotype-driven genetic screens pattern and the mutant phenot)pe in "ivo, can be Any approa ch to an underst anding of the role of integrated by the use of an indexed library oj the~e gene:-. in the context of the biolo!-,'Y of the organis m inserttonaUy mutated ES ceU clones, It should be possible require s genetic experim ents, and for mamma ls the to generate mutants for a large proportion of the genes of experimental genetic organism is the mouse, Mo:-.t genetic the mammaUan genome, !'IlTeenS in the mOU1>e have heen phenoty pe-driv en !'IlTCen:-., whkh have a long and succe~sful tradition, and are hemg adopted as one route to tying funltion to gene6 , The method:-. for mutage nesis ill lJil'O, treatme nt with the chemiclI El\l' or with X-mys, are well e<;tablbhed and effective but their apphca tlon IS limited, for a genom ewide screen in particular, by the animal housing resourc e required, Segregation of mutation.;, definin g alleli.;m, .,creens for rel'e ..:-.ive mutant s (e:-.pel'ially tho:-.e with an emhryonic or fetal lethahty >, require vast resource:-., Moreover, the po~itional dOlling method:-. require d to identify these anonymou~ mutation~. althoug h benet1ting gre-.nly from the in<:rea:-.ingly detailed genomi c re ..ources, are :-.tlll the search for the needle in a haystack that require s a large in\,e:-.tment of manpo wer and resourn::-., An alternative approa ch is il1 I'lfro mutage nesb by gene targeting or gene trappin g in embryo nic ..tern (ES) celb (Box 1 >, which allow mutations to he char.ll'terized in cell culture before tran:-.lat1on to the 1110U ..C, From thc.;c ES cells, tram'genic strains can he cstahli.. hed directly that carry a :-.ingle defined and tagged mutation, Each of these strains can ea:-.i1y he genoty ped, which greatly reduces the animal :-.pace reqUired and simp\ifie:-. breedin g manage ment and fal'ilitate~ phenot ypic analy.,i~ or .,creening,
applied their experie nce with homologou:-. recomb ination in tbsue culture celb and were able to e:-.tablish meth{xl~ that, with suh.~equent refinements and addition s, have allowed virtually any designe r m(xlification, rJnging from point mutation:-. to insertional inactivation, large deletion:-., tran~locati()n~, or tis:-.ue-~pedfjc gene inactivation, to be introdu(:ed into a known cloned m()u~e 1(X'us, Since 19H9, when the fir~t mice were derived with a loclls :-.peclfically modifie d by homolo gou,.. remmh ination in ES cell:-., the.,e technique:-. have hel'n u~ed to mutate approx imately 1% of the total predict ed numhe r of mouse 1(X'i and have hecome an e:-.:-.ential experim ental tool t{)r functional analy,.,h In mamma ltan genet Il':-' ,
ES cells and gene targeting: direct mutation of characterized loci ES celI:-. provide the route of choice for introdu cing mutated loci into the mouse genome~, One of the most direct and fruitful experim ental method s ha,~ been gene targetin g by homolo gous recomb ination , S(xm after the fiN e~tahli:-.hment of the route to germ line tran:-.genesis hy ES cell:-.H, Oliver Smithies et ai,') and Mario Capecc hi lO
TIC (OpHlf.dll t' I'}or .1,...,\ IU '-I... U..'llll.,' PII "'II I HlH-')=).!':;(')"')I II l .11-'""
I hi \11
n~h .... n',... rH d
OiftX
S~.I'TEM8~R
(}~1~ -r "'II~ 00
Box 1. ES cells Emhryonk ~1l'1l1 (ES) cdb are plunpoll'ntl,ll l'l'll~ dl'n\'l'd from pI'l'1l1lplanlallon mOll~l' l'l11hryo~ lhal rl'pfl'~l'nl a ~Iage of dl'vc\opml'111 hdore ~L'grl'galion 01 tIll' gl'rlll rdl linc..' from ,omall( linl'agl'" ~ I, Tlll'Y em he rl'-lIllorpoJ';lIl'd mlo prl'unplant:luon l'mhryo., to gl\'l' n~l' to l hlllll'f1( III In' , \\ hll h arl' fl'l1lk', (;aml'll'~ deflwd from till' (UhUfl'd ('db pa~~ Ihl' E," ll'll gl'nOm(' 10 lill' ()If~pnng (gl'rlll 11Ilt' Irans1l111>"jon) In contrJ,.,1 10 Ihl' flo .... ~Il'm cdl., III ,I normal emhryo, lllllured ES l db an: avallahle 111 unhmlll'd numher, 'l an 1)(' mamlall1l'd II1lh('lr lll1(hfkrt'nll:lIl,d ~Ialt' inddlJ1l1l'\Y, and arl'
:Il'l'e,,~ihll' for oh'>l'f\';l1lon :111<1 ('XIX'T1lJll'llIal m:lmplll:1 110n Tll1~ ha~ allowed a Illllnhl'r of l'XfWfln ll'llIal aprroadl l'~ 10 Ihl' mo(hh(,lIlon oflhl' E~ tell gt'nollll' III lUItUfl', l"lwllally
lhl' rl't'Cl\ t'!)' ot rarl' l'\'l~nt." ... ud, ,I'" "lll'-(hrl't'll'd Illllt,lllon:-. for Illl' gl'nl'ral1on of 1ll00N,' kn()l'kollt~,
1997 VOl , 13 No, 9
3 70
PER SPE CTI VE
A gene knockout project is a (a) (a) lengthy experiment. 1bere is the , p inevitable time of mouse breeding: GenomiccDNA DNA Genomi , (, , \ , 19 days incubation time before birth \ I I I I I / /' / , , , \ \ \ ,I II I / " " \ \ \I I I for an injected blastocyst and a miniI II // / \ " , , \ \\ \ \ III II /1 / '\ \ \ II I I /I mum life cycle of two to three \ '" ,\ \ III I I ' I , ,\ \ \ , II' months for the mice, gives a minimum time of about six months beAAAAAAA 123 mRNA 4 mRNA fore homozygous offspring could be born. In real life, nothing can be (b) (b) quite this fast, and the time required to generate the targeting construct, to isolate the desired ES cell clone, and to analyse the phenot ype, contribute to the overall time required to carry out this analysis. It is, therefore, difficult to imagine, that the GenomiccDNA DNA Genomi remaining 9')OAl 99% of genes in the mouse can be handled by targeted mutaTRAP AAAAAAA AA THf\Fl (i)(i) 11 genesis. How can these method s AAAAA possibly keep pace with genom e 1 (ii) 2 TRAP AAAAAAA AA (ii) mRNA AAAAA projects, which are produc ing such mRNA a huge and rich resource of new information? Homol ogous recombiFIGuu FJGUIU! 1. General strategy of gene trapping. (a) Expression scheme nation cannot easily be adapte for a typical gene adapted d to showing the promoter (P) driving expression of a gene with four exons 0-4) and three a production line approach; each tarintrons (pale grey) tenninating at the endogenous polyadenylation signal (black circle). circle). geting vector has to be individually Gene trapping relies on the random insertion of a promoterless reporter gene into the constructed and each targeting event genome of the host cell. celL Cell clones in which the expression of the reporter is driven by must be individually verified. Even cellular regulatory elements can be easily recovered by applying the appropriate with an optimistic estimate of three selection, usually G418. The reporter gene can be brought under the control of the months of work for generating a endogenous locus by long-range association with an enhancer, but more useful is a direct targeted targete d ES cell line, comprehensive fusion into the functional locus with consequential insertional mutation. (b) Integration (5' untranslated or in-frame) or (in coverage of the genom e would still into an exon (i) (;' (ii) into an intran intron (splice-acceptor for in-frame fusion, or splice-acceptor plus internal ribosome-entry site for any frame). require some 25 000 person years. frame). Would it be possible to acceler- A variety of different designs of gene-trap construct have been used. With a typical vector that uses selection for G418 resistance, the majority of genes expressed in embryon ate the preparation of the reqUire ic stem required cells can be transfonnation ation (not shown) allows efficient genetically modified clone by the single-co trapped. Retroviral vector transform py insertions. Informative sequence can be gained from analysis of novel exom; use of pre-pre pared resources? With fused to the trap cassette in mRNAs, mRNAs, or from the genomic locus directly (ringed).. isogenic DNA homology of reasonable lengthll lengthll.12 ,12 and a plus/m inus selectio n 13 over 10% of selected clones can be correctly sequen ce and allows rapid molecu lar characterization. targeted; so for gene targeting the resource require d This is an invaluable advant age in an animal with a would be the targeting construct. Despite their concep- large genom e (compa red with Drosophila), small litters tual Simplicity, these targeting constructs often take (compa red with zebrafish) and high maintenance costs. some time to make. It would be conceivable, but diffiIndeed , the first deliberate mutagenesis of mice with ES cult, to generate compre hensive pre-pre pared libraries cells used the insertion of retroviral vectors 16 16.. By genn germ of targeting vectors. vectors. Some approa ch to this has been line transmission and breeding, several mutations includmade by provision of numbe rs of suitable plasmids ing nodal (Refs 17-19) and the craniosynostosis muwith selection cassettes and by the genera tion of tation Bey (Ref. 20) were identified. The rates of mutation genomi genomicc libraries in vectors with suitable counter-selec- achieved (1 in 10-20 insertions) were useful, but in vivo table cassettes built into the flanks 14 . One effective and screening vel)' laborious. is very alternative fast-track method is to use long-range peR to A more attractive approa ch to random insertional prepare the genom ic homolo gy fragments 15. mutage nesis in ES cells is the use of 'gene trap' conIn contrast to homolo gous recombination, the gener- structs (Fig. 1). The principle behind these is that the ation of mouse strains from ES cell lends itself to scale-up inserte d DNA mutate s an endoge nous locus and inserts because each clone can be handle d similarly. There- a reporte r (usuallyy the neomycin gene and/or the (3(usuall fore, a resource of ES cells carrying random insertional galactosidase gene) under the transCr transcriptiona iptionall control of mutations could proVide provide the starting point for rapid and the trapped promoter. By selecting for the activation of the cost-effective functional analysis of the murine genome. reporte r gene in cell culture, the rate of gene disruption in recove red clones approa ches 100%. 100010. Thus, the screenIDIado lo8ertlooal mutaa mutageenais nesis and gene traps: known ing for mutage nic insertions takes place in vitro. Several ins mutatlo mutadooa os in In unkno unknow wn n Jod loci groups have used randomly chosen gene trap events for Unlike chemical mutagens or X-rays, a mutation transmi transmission ssion through the germ line and found a surpriscaused by DNA insertion tags the locus with a known ingly high incidence of interesting phenot ypes in vivo.
---1
i.
H
• •
....
_ _
..
:
-
.
-
-
/
I
. 1---
TIG SEPTEM SEPTEMB BER ER 1997 VOL. VOl. 13 No.9
371
PERSPECTIVE
(b) (b)
(c) (c)
(c) (c) GenomIC sequence
Genomic sequence
Genomic map· chr 7 Genomic map - chr 7
- ... .
...,.......
.......
... _
0,..
It~·
~ Q"Io'
.... '.-.l
...,
. . .1...
"'"
,,~
f..e _ 1 ~
_
~
.....,
~_
.. J •
-- -,. l't;1I . .
""2t"O'flt:"' ~
.;.
.... ,.., . . "'2 l1li •
""",
.... """'"
:;:w.- ..'01_'
..... ..... .. ............. ...... ta:J
·. ""·t _ ·t oao
. ,..,.,.
'~
·..- ·s· ...
lilt
" . ......... 1IIII' ::'·:oc.; . -
=: --
.t~I...tttcc.c.gc.e"nU99·.. ttI99'ttt99ctct~t.qtt
cDNA sequence cDNA sequence
ACCACTGCTTGACATACACCCCACAATATTTTCAM
ACCAGTGCTTGACATACACCCCAGMTAT1'TTGAM
AGCGCCCMATCCCACAGGCCCCCCCMAATTTTCC
AGCGCCCAAATCCC~GGCP..AAJ.TT'l'TCG
TTCCATCCCACACCCAAGCATAC'M'CCCACTTCTTC
TTCCA'l'CCGACACGCAAGCATAGTTGGGAGTTCTTC
TCCCATATGCCATCCACATA.C'fGCCA.TCACCACTCC TCCCATATGCCATGCACATAC'l'GCCA'l'CACCACTCG ACCTCCATCCTCCACCACACTATTTA.CAr.GTCACCT ~'1'CGTCGACGACAGTATTTAGAGGTGACCT
ACCTCTATCAAACCCCCTCCTCAACCTCACTATTAA
ACC'l'CTA'l'GAAAGCCc:crcGTCAACCTGAC'rATTAA
A(;GGGCTAACACAATCCCCACMCTACACCCACTTT AGGGGGT.v..CACAA'l'CC:CCAGAACTAGA.GCCAGTTT ACACATMATCTAACAN:TTACCCMCATCCACCTT
ACACATAAATCTMCAACTTACCCAACATCCACCTT
TMGATACTACTACTCCTTCTTGGCCCCATCTATAC
TAAGATACTACTAC'fCCT'rC'rTGGCCGGATCTATAG
CCCTCCCACCCTATACACCCCACACCCATATA7TAA
GCCTCCCACCCTATACACCCGACAGGCATATA'I'TM
ACACTACCCCT<:CCATAACCCCACCAAATTCCGCCC ACAG'I'AGCCC'1'CCCATAAGCGCA/;CAAATTGCGCCC AACCCTTCCCCCMTCGTCTCACTTCCTCACCf'TAA
AACGGTl'CCCCGAATCGTCTCAC'l'TCG'l'CAGGTl'AA
CAt:J.CCTCTCCCCCACACCACTCTTCATCATCACCA CAGACCTCTCGGCCAGACCACTGTTCATGA'l'CAGCA CTCATTTTATATACCTCACTCCACACATCTTCCTCC CTCA'M'TTATATAGCTGACTCGACACATCTTCcTGC TACTACCCTCCT
TAGTACCCTCC1'
FIGUlU! 2. Clones of gene-trapped embryonic stem cells are picked from the initial selection dish directly to a multiwell plate so that FIGURE
plates can be readily replicated and stored frozen. This format provides sufficient cells for staining and extraction of cDNA and genomic DNA. Specifically selected clones can be expanded further. (a) Shows multiwell plates containing gene-trap clones. clones. (h) (0) Transient chimera: 7.5-day-old egg cylinder showing expression in the ectodermal region. This clone would not have been selected for special study on the basis of this expression pattern alone, but (c) flanking genomic sequence allows mapping of this new locus and a shown). (d) Isolation of 5' flanking cDNA recessive mutation showing alteration of the shape of the head was recovered in mice (not shown). by RACE (rapid amplification of eDNA cDNA ends). The sequence of one such done clone is shown. shown. (e) Mice bearing this trap show a very specific pattern of staining in the cerebellum, and homozygous mutant animals (f) show a specific phenotype. The major alternative index for (I» but also these clones, which does not depend upon genomic information, is the pattern of transgene expression shown here in vivo (b) shown). fruitfully explored by differentiation in vitro (not shown).
Recently, several modified trapping strategies have been introduced that allow specific selection for integrations in subsets of genes, for example, secreted retinoid-responsive genes or genes involved proteins21 , retinOid-responsive •23 •, There are two main methods used in apoptosis 22 ,23 for the introduction of gene traps into cells: cells: (1) retroviral vectors 24,25 and (2) electroporation of naked DNA. Electroporation, which is the method of choice for DNA transformation for homologous recombination, is frequently used to insert gene trap constructs26 , but is relatively inefficient. Retroviral vectors provide a much higher efficiency of gene transfer and integrate, in contrast to electroporated DNA, as an intact single copy. copy.
An indexed resource of mutated ES cells Generating ES cell lines with a single gene mutation by gene trapping is very straightforward and hundreds of clones can be produced from a single experiment. The clones can be grown, replicated and frozen in 96-well dishes, and samples of this size can be used genotypic analysis. for genotypiC analysis. Thus, handling of large numbers of clones becomes feasible 27 . A comparatively small facility could readily scale-up to handle tens of thousands of clones and more. These frozen clones can be mutations. The timescale, kept as an in vitro library of mutations. cost and resources needed to set up and maintain this library are small compared with genome projects and large mouse facilities.
TIG SEPTEMBER 1997 VOL. 13 NO.9
372
PER SPE CTI VE
Every library requires a suitable index to be really useful. In this case, the index needs to relate to the locus mutated, or to its potential phenotype, and should be based upon in vitro assays as much as possible. Our laboratory and others have been develop develo ping ing techniques to adapt the molecular characterization of gene-trap integrations integrat ions to large numbers of clones in multiwell formats (Fig. 2). Four different types of data can be used to index the library.
cDNA sequence
In the past, most 'gene trappers' have relied on PCR-based techniques to isolate the cellular transcript sequence fused 5' to the gene-trap marker. Although the amplification of specific cDNAs can be achieved rapidly, cloning and screening of informative-sized cDNAs have proven to be time consuming but this has recently been circumvented by a specific protocol for direct sequencing28 . The cDNA sequence infonna information allows identification of homologies to known sequence, although these 5' exons are the least well represented in the present cDNA and EST (expressed sequence tag) databases. Furthermore, cDNA information is of only limited use for the monitoring of mouse breeding and gene mapping.
Genomic sequence
The genomi genomiCc DNA flanking flanking the insertion can be cloned by conventional methods of library construction and screen. Plasmid rescue 29 and inverse PCR methods are also applicable. Flanking clone or sequence information is required for genotyping mutant mice derived from the cell line. With the progress of the EST projects it should soon be possible to deduce cDNA information from any genomi genomicc sequence containing an exon, thus obviating the need for a separate cloning step for cDNA.
Map positio positionn The knowledge of flanking genomic sequences allows PCR-based genetic and physical mapping, for example, using interspecific backcross panels or somatic cell hybrids. This information is crucial to link the ES cell resource to pre-existing information on mouse or, by synteny, human mutations.
Expression pattern The developmental expression pattern of the reporter gene 30 in chimeric mice provides an alternative phenotype for selection of gene loci. loci. This can be important because many knockout studies have confirmed that an unexpe ctedly mild phenotypic effect can result from inactivation of a locus and such a mutation would not be found by a conventional genetic screen for mutated phenotype. Conversely, apparently interesting patterns of expression can be seen from unexpected loci (Fig. 3). The in vivo differentiation of ES cells is faster than mouse breeding studies but still a large effort for a relatively small number of clones. Others have sought the same type of information by in vitro differentiation, either spontaneous or induced induce d (Refs 31, 32). In a similar approach, the information on tissue-specific gene expression contained in EST databases, possibly refined by in situ hybridization, can be used to choose candid candidaate te genes for establishing mutant strains.
FIGURE 3. A 14-day-old embryo showing a pattern of LacZ FlGUBE staining as the reporter of a gene trap. Patterns of transgene e~pression expressi on are a pointer to gene function, which is entirely different from those proVided provided by analysis of the genomic or cDNA structure.. Surprising and unexpected patterns can be found. The locus trapped here has subsequently been identified (by cDNA and genomic flanking sequence analyses) as an insertion within histone H3-3a.
We propos e that the most effective way forward fOIWard is by a 'clone and sequence first' approach. ch. The sequence should be (or include) genomic flanking sequence as well as cDNA in order to facilitate mapping and so that any subsequent breeding programme can be immediately followed. Such an approach coupled with in vitro differen differe ntiation tiation!/expres expresssion ion screens should allow preselectio n of trapped loci for subsequent analYSi analysis in vivo. Pre-selection would either be on the basis of the genetic homologies known or predicted, or be on the bases of differential tissue-specific expression. With pre-characterization of the mutated loci the resources needed for screens at the whole animal level, be they phenotyypic phenot piC or by expression pattern, are much reduced. The informa information tion gained needs to be preserved, distributed and integrated. To this end, as part of an EU co-operative project, we have set up a database using ACeDB the Caenomabdit rbabditis elegans database to handle all information on gene-trap mutants from sequence information to genetic map, and pictures of in vivo expression patterns and mutant phenotypes. The usefulness of these data wiU will increase with accumulation of data from the genome projects.
Trapping the whole genome?
The numbe r of genes that can be mutated with gene traps is not known. The current standard vectors should
TIG SEPTEMBER 1997 VOL. TlG VOl. 13 NO.9 No.9
373
PEllSPECTIVE
Stop Press ... Tagged sequence mutagenesis: two new screens Th,' ),!IIIIII" III (.111,,1 ,III" 1{1I1,'\ ~ h,IH' 11'(l'III" ,k'IIIIIII'",II,'d Ih,' 1l',I'IllIhl\ 01 !'ol'qu"llll,d-ll.1'l.'d ~l'Ill' 11,111 '( Il'\.'n1> l h,Ir,IlI\"r1I111~ "" ,11111 ,,", 11Ih'gl ,II 11111'. 1"'lll'II1\"" 111.\\1'\1'1. Ih,'''' ,Ill' ,01l,,,I"I,lhll' dllll'll'II\l" 111 Ill\' r,lIll1 01 known g,'m', ,11111 I'~" 11'111\1',,'" • 01 IIP,II I'" \\llh 1111111'11'11'1\ nll,,'1 '1''1111'11\'" II I "'I'll' I hi 'l1u, I,m Ill' 1·'pI.IIIll'(1 h\ dtll"f\'nn'lo III \l'lIoi ""'lgII (hll\\llhlll \ 1'1,,1 11'1'" ,Ill l'I",II0P"I,lh ," 'phil' ,II I I 'pi III UtI'S II,IP I'1'(' FI~ 111. tlu, ,Irtllll'l ,lIld ,I d )':\-h,I'<'" II0IIUl)! '1I,1I1')!\. \\11111' 1111'" 1'1 al.hl"" ,1111111 'phllllg 11'110\\1,11 \l'dOl IFI)! It) ,and 1l'1'1I\l'r\"d gl'nll11\11 "'(Iul'nl'\,' h~ 1'1,1'"11" I.." II,' Ih,''1' \I'dlll' .111' ""I'" I.. h,lIl' dlll"I\'1I1 I,II~"I' ,mt! II 1"111,11"' 10 Ill' 'hO\\11 ho\\ 111,111\ 01 1IIl.' nO\d "'qll,·n,,·' !t ..m 1',Idi .IppIII,11 h Il'pll·','nl h"n,1 1111" ):"11'"
References
"h
I Lho\\llhllf\." ,'111111')1)-) \"d ICle" .!\ J I h, "'. (. 1'1,,1 11')1)-, .\"' (,"C'II,'/ Ih. HX -i II
I~il-l'ii(l
lx' ,Ihk- 10 Ir,Ip "II g,..'111'1> I'XPll'''l'd III ES 'l'II" Ihl' l'1>IImall' lor Ilw nllmlx'r 01 gl'nl'1o 1\-pII"II" \""pi l'1o'l'(l in ,I 1oin~k' wll In"" 110 \II', ,Ilthollgh M'wr,ll \\Orkl'r, 111 11ll' hl'ld Ix,lil'\'\' Ihal 11';\11'>( npliollal \ ol1lrol III E~ l\'1I1o I' 'k',lky' and. Ihl'R'foll'. till' numl",'" 01 pot\'lltlal 1.1I~I'1 Al'll\'lo i1> Illlll h highl'r COH'r,Igl' could ,,1»1) lx' IIll rl',I1ol'd hy pa"~llIl'I liM' 01 difkrl'lll \\"clor d\'Mgn, E"pl'nl'nl'l' With promot,'rk')\)\ gl'lll' targl'tlllg \l',·tor.' MIAAl'1ot., Ih.lt ,I Mlh:.t,lIlllal Illlmlx'r 01 A\'l1l'1o Ihat had I""l'n Ihought to h\, I'Xpr\'''l'd onl~ .11 !all'r lIl'\ l'iopll1l'nl,11 '1,IAl" l',m ,1111
References 1 II:lld:lOl'.,1 n S. Spnllll. A I> and lIald:lOl'. l\; \1('. (19):;) ./ (;('II('(jcs:;. I.H-U:; 2 l>il'lndl. W.P ('I (/1 (1')1)";) Pm,: ,\'all ,1mtl Sn (. ,Ii A I)l, lOK·Il)...lIlH~.i
3 Pk',!'ol hlllann. R I> ('/ (II (l1)l):;) S(.'I('II(," 2h9. I%-'i 12 4 liufll'.IU. lI. ('I til (I')IX) s('I('IIu'r I, 'i-ttl S I>ulun, B (I')IX1) 7il'IIt1.~ (;""e'/ ll, 2h.~-r() 6 BrO\\ n. ~.I) and Il l'll'f1>. I (11)lX») 1h'IIds (;,,/1('1 12. ·I;H-I.~'i . 7 E\'an:., ~1.J. (11)l)61/:'IIt/{)cmwl .1Ma" .i. 1'i-:;2 8 E\·an)\. ~I.J . nr:,dlt,~. A and Rohl'rt"'n. F. (1I)X.i) 10
II II' Rid,'. II . ;\I.I,md,I)! F R ,and Ik'm!\. A (11)1.)2) Pm.: ,\all :tmel SCI ( S.-I H9, 'i I.!H-'i I,U U Ikng. C ,IIIl.I <':'lllI..'\.\'III. ~I R (11)1)2) .1/(11 C£'II 111(1/ 12. Hh<;-.i.i-I
U
.\ClllI/t' .Hh.
(Vol
2()),
Cold Spnn~ H:lrhor L:llx)r,ltor\'
:\ IX-.~'i.!
,., '\'111" 1\1 ('I al «1\)lJ I) /ti1l7hhmqlws I". ~(I-~'i IS \ ,lIIlonl. ~ . I>,IInl'~. ~. ,lI1d 1:\',10)\. ~IJ (11)l)~ I T/'(//I.~
R".~
, .!,--.!<;"
16 "udlll.
~I
R , Ur:ldll". A.. Rolll..'n)llm. 1':.1 and I':\·:ms. ;\1.1
( I')l'n .\allllt' :\16. 29'i-.M4
I i Conlon, F I., l\.tnh. K S .lIld Rolll'n"m. 1':.1 (11)91) /'}('n'/Ii/lI/I('/11 III. %9-'»1 I
IB Conlon. F L 1'1 til II,)\) I) lJt.n'lo/>I/I('III1211. 1919-19!X 19 I.hou. '\ J. ('I al (1\)I).i) .\il/lllt' :\61. 'i I.i-'i ,MI <-,II \ton. ;\1 B I. .and 1:\ :1111>. ~I,I (199'i) (;('11,,1 R('.'. 6~. 2.i-1 ,11 ~",Irn\"" \\' C . ~lo1>:o..,11: . IllIrtll.'~. S ~I ,and Ik'ddlllJ.,rtnn. R' (1 1)1)<;) I'm. \'all .-k{Ic/ !!ii:1 (' S .-I 92.
Cl'i92-M96
..t lJ.i. 16--lClX.! 23 Ru~,. A 1'. ('I a/ ( 1')lX,) PmI' ,\ill/ .-\cati Sd (' .'I :l 9.t 1'i'!-9-1<;lX-I 24 \on Melt-hiler. H , Rl'dd\'. ~ and Rull',·. H.E (19')()) PmI.' .\(111 .-taul Sd I .11.-1 ·X-. :\-.-\.i-.i-_~':' 2J 1-1I1'(lndl. (j ,lIld ScIO:lno. I' (11)1.)1) (;"/1('$ [Jt.'I' <;, l'i I:\-I 'i2.i 26 (;I",ll'l, -\. ,1O\nl'r A I.. Ro",lIlt.,1 :lnd Sk,lml". \X' C « IlJXC)) .'it/('II((' 211. 16:\-16'i 2i F.\ .1010, M.,1 «llJl) I) 111 Cellllm/oRI' .4 I"{I/)O/,(IIOI")' 1/(l/Ielhoo/.J«Cl.'iI'.,1 • l-d ). :kadl'llIk P~:o." 28 To\\ nil,,·. D,I . A\'\.'I)·. R,I .. RO)ot>tl. n .Ind ~karnt'lo. \x· C ( II)lr) (;('1/111/1(' Rl's -.29_-\-29H 29 )111.11, Y. ('Ill/ «19')<;) /1rmll R('s ,\10/. BI't/I/I Res :\1. 1-9 30 \X'Uf1>I. \X' ('llIl ( 1\)1)<; I (;('1""1($ 1:\9. HH94l9'J 31 ~d1l.'l'l'f. C.A. ('llIl II9'Xl) C('I/ Grml'lb Dufer -. 1.:\'1:\-1 1111 32 (~ogo,.,1 A • 1.0\\ I). \X' :lnd Kar.t~ lor~oll. ~I <1 <)lr I ./I·ml/ -I. 1611-16~1l j j Sdl\\'.ln7.I""r~, J> L.. Rolll'n)llm. F. I. and GotT. S.I'. (1990) PIl/(.· .\·tll/ :\md Sd {' S A 32111-:\211 34 E\',tn,. \1.1 and Kaufman. \III (11)K1l.\1I11/1l!~Jl. 1'i+-l'i6
,12 Fom"ll'r. 1..;\1. 1'1 al ( I')IX,) I'm.: .\iltl .4mci SCI (' S
H"':
AlJ. EII""S. II.&L Cnrllo" (/1/(/ A.P. Russ (/n' 111 IlJ(' W'dlwllle' 1'nm'C(/Ill('" R('$(,(lIt-h C(/lIIpm,~II. IIISI/Ill/(, (!f
(;"",,/ic .lltllll/Jul(II/(1/i {)f Ihe /:'ar/I' .1/(III11/whfm /:'mh",o J ()uct.'(·hman. T
\I,IIl"'III.!'\ '-.1110111,1'. K R ,\Ild c'1/X'l·l'IlI. M R (II)XH)
(.'lIIll1'r tIIullk'I'('/II/lI//('lIlal Hlll/oR)'. amll>tYltlllm,'"II{ (;('/It'I/(s ('III1WSII,I' (.'t/lllhl'lt(t:(,. 7('I/II;S (.(1//11 Rlltld. (.(/""mll.~('. ('1\ CB.! IQR
1'\'\':0.,'
"l
<;....(I-';7K 10 Thomas. K R :an<.l C.lJ'll-'c:dli. M R (19X.... ) (.'('1/ 'i I. 'i()~-:; 12 ('1 Cli. 1l9H.... ) ,\(Itlln' .i:\().
TIG SF.PTF.M8FR 1997 VOl, 13 No, 9
374