- Email: [email protected]
General stress proteins in Bacillus subtilis
FEMS Microbiology Ecology 74 (1990) 197-214 Published by Elsevi'~r
197
FEMSEC 00294
General stress proteins in Bacillus subtilis Michael Hecker and U w e V~51ker Department of Biology, Ernst-M~oritz-Arndt University, GreifswaM, F.R,G.
Key words: Heat shock proteins; Stringent response; Adaptational network; Signalling
1. SUMMARY Bacillus cells frequently faced with various ad~ verse environmental factors in nature have-evolved different adaptational strategies. The induction of stress proteins is an essential component of this adaptational network. In Bacillus subtilis there are two groups of stress proteins. The first group is factor specific, whereas the second group is induced by growth restrictive conditions in general. The relationship between the stringent response and the induction of stress proteins is discussed.
2. I N T R O D U C T I O N - S I G N A L S A N D S I G N A L L I N G IN B A C I L L U S S U B T I L I S Bacteria spend most of their lifetime in a starving or nongrowing state [1,2]. The exponential growth typical of laboratory conditions is an exception in nature, whereas the transition from one transient state into another may be the rule. Cells of B. subtilis can reach a generation time of 20 to 30 min under optimal conditions using laboratory media. However, in their natural ecosystems, for example in the upper layers of soil. Bacillus cells have a mean generation time in the order of 50 to even 100 h. Furthermore, a considerable portion of the Bacillus population in soil is unable to
Correspondence to: Michael Hecker, Department of Biology,
Ernst-Moritz-Arndt University, 9200 Greifswald, F.R.G.
grow. These starving cells have to concentrate their cell physiology on survival. The capability for survival or even for growth under natural growth-limiting conditions needs special strategies which are of fundamental importance for microbial life in nature. The study of these survival strategies is a very useful concept for the understanding of microbiology in general [1-31. To analyse these survival strategies it is necessary to look for the environmental signals which have not o n ' j limited the bacterial growth in nature, but have also forced adaptational strategies in order to keep viability during stress. In Fig. 1 different environmental signals are sumrnarised which may be suggested to be important for the dialog between a Bacillus cell and its natural habitat. First and foremost there is starvation for energy or carbon sources, nitrogen or phosphorous sources etc., which are common signals for many other ecosystems too. A more typical environmental factor may be starvation for oxygen because B. subtilis is not able to generate energy solely by fermentation processes. Besides many other common signals like thermal or oxidative stress, salt stress should also be mentioned because desiccation occurs very frequently in soil [4]. During desiccation, osmotic stress caused by the increasing salt concentration occurs. The interaction with these growth-limiting factors is a central part of the physiology of a Bacillus cell. The well known process of sporulation should be mentioned first in this very complex
0168-6496/90/$03.50 © 1990 Federation of European MicrobiologicalS~':ieties
198
signalling
extracellulor signals
globalresponse oxy , I chem0taxls reSO~orl ] regLI/orl~~
(///~ limofitation
i:;o0 I.oo.u,.,,ooIII
~i~:~ion~
alamarts g:n, ~
iiias~!!!s:~ % ~
l n~r~rgo~n JrS:rinoglnet ' r¢gulati°n
i I} ~
~
Fig. 1. Growth limitingfactors and the adaptational network of B. subtilis.
adaptational network of a nongrowing cell. Hewever, there are m a n y alternative stationary phase reactions like stringent control, chemotaxis, cam-
petence, nitrogen, carbon or phosphorous regulation, etc. The information on these alternate adaptational reactions is rather restricted [5-7].
two-component intracellular(atormons)Signolsregu atorysystems
extracel[ular signas I
~~_~
02--~ limofitation C nut.ents N---=.P---t~
response
5po0A ~00~._% ~0o0~.E~or~- ~o~,oo Spo]IJ ~/ DegU
;.
%/ Fig. 2. Signallingin B. subtilis - a simplifiedand general view.
i99
This scenario is even more complicated as result of interactions and overlapping areas between these strategies in the network (Fig. 1). All these components constitute the so-called global response of a Bacillus cell to starvation. Thc-ze survival strategies are mainly realised at the level of gene expression. The gene expression program of a Bacillus cell is a reflection of the environment, it is determined by the extrace!lular signals [8]. The question arises: What is known on signalling in B. subtilis? The study of signal transduction is very important in order to understand the
7,0 '
~ i
control of gene expression in bacteria in general. A low GTP content may be an indicator for nutrient starvation in Bacillus and one of the most crucial cellular signals controlling the adaptational network (Fig. 2; [9-11]). Furthermore, cAMP is accumulated after starvation for oxygen or energy sources [12], but there is no information on the physiological role of cAMP in Bacillus. A central position in this signalling is occupied by the two-component regulatory systems [13-15]. ~ B. subtilis several two-component systems are involved in the dialog between the cell and the environment. The s p o l I J / s p o O A system controls
B..~ | G12
2E
6,0 I ~.
4P
"
5,5 i
pH
"J~" ~P "
"
7 60
•
°
°...~G9
.~--GIO 8..~.-Gll
F
~ "~--GIS .q..-.G20
l $ 58 Ko
~
Fig. 3. Synthesis of stress proteins in Bacillus subtilis 1 S 5 8 (relA ÷ ). Bacteria were labelled with "S-L-methionine before (A, control) and after imposition of the stress (B, heat stress, 50°C; C, heat stress, 52°C; D, stringent response induced by no~'alin; E, oxygen limitation; F, salt stress, 4% NaCI). Fluorograms of the corresponding two-dimensional polyacrylamide gels are presented. The different groups of stress proteins are marked with capital letters. H, heat specific stress proteins; G, general stress protei s; S, salt specific proteins; H/St, proteins induced by heat and starvation; H/S, proteins induced by heat and salt (for details see [4,29,35], see also Fig. 5).
200
different growth-limiting signals typical of the soil ecosystem trigger the production of a set of proteins which may confer a general protection of cellular life under stress conditions. The induction of this stress regulon with many overlapping areas to other stationary-phase responses might be an important component in the adaptational network. The well-known heat shock proteins are among these stress proteins.
many stationa~ phase reactions and sporulation. The de~S/degU system controls among other things the production of degradative enzymes, and the comP/comA system regulates competence [i6-18]. Unfortunately, some cardinal questions concerning signalling can not yet be answered. Such questions are: (i) What signals for starvation are recognised by these different sensor proteins in the twocomponent systems? (ii) Is a low GTP content directly involved in this sensing process? (iii) Are GTP-binding proteins important mediators iil signalling [19,20]? The elucidation of these problems awaits further investigation. An essential element in this adaptational network is the induction of the stress regulon. Quite
7,0
P R O D U C T I O N IN BACILLUS SUBTILIS All organisms, from bacteria to man, produce about I0, 20 or more heat shock proteins in response to heat stress. These proteins are of fundamental importance for cellular physiology in gen-
6.5
6,0
5,5
I
!
!
GI2
90,
H1 J
7s
H4
H2
-"
60
30
3. P H Y S I O L O G Y OF H E A T S H O C K P R O T E I N
. ..... . . . . . . .
':~'
H3
O f" "\"
:
j'- '
41~.'
~7,,
Fig. 3. (continued).
~ , ~r''G9
~
,p----Gi5
201
era!. The heat s,o,~,,'-'- response might be as ancient as cellular life itself [21-23]. Information on the basic func!ions of some heat shock proteins has been obwi:.:~!. They are involved in controlling intra- a:~,~ mtermolecular interactions of proteins [24-26]. Bacilt~ cells are able to accumulate several heat shock proteins in response to heat stress (Fig. 3, [27-30]). Many heat shock proteins are synthesised at 37 ° C, the "control" growth temperature, but at a lower rate. This might be because they also perform essential physiological functions at this temperature. However, other heat shock proteins (e.g. proteins numbered H1 and H2 in Fig. 3) can not be detected by 2D-ge! electrophoresis of extracts of cells grown at normal temperatures. As in the eukaryotes, the heat shock proteins can be grouped into proteins with low (10-20 kD) and
7,0
6.5
l
!
high (60-90 kD) relative molecular mass. Three of the heat shock proteins were found to be immunologically related to the Escherichia coli heat shock proteins DnaK, Lon and GroEL [30]. In addition to the cytoplasm, heat shock proteins were shown to be localised in the cytoplasmic membrane [31,32]o It is not in the scope of this review to give a detailed picture on different shift up- and shift down-experiments or on the kinetics of the synthesis of individual heat shock proteins [;3]. Only one aspect should be pointed out: The heat shock response is pronounced with increa~ing temperature. At 52°C the growth rate :,~ drastically diminished because the synthesis of vegetative proteins is inhibited. Under these conditions the heat shock proteins constitute a considerable portion of the proteins synthesised. The groEL gene product accounts for more than 50% of the
6,0
5,5
I
I
pH
C G12
90 -
I
.#/~2 HI
HL, H3
/.i" ~p~H5
75 o
X
4--O10 ~'-G11
H/St23
"~" H1521
30
j.-.HIS22 0 q~--Gl 4 •.L-.GI 5 j,.G13
.ISS8 52°C Fig. 3. (continued).
G20
~ ~=~G17
202
protein synthesising capacity at this temperature (Fig. 3C). Similar resulls were published by Neidhardt et al. for E. coli [23].
4. HEAT SHOCK PROTEINS A N D STRESS PROTEINS It is well known that several extracellular stimuli are able to enhance the synthesis of heat shock proteins [22,23,34]. Therefore the question arises, whether the heat shock proteins of B. subtilis indicated in Fig. 3 are specific for the heat shock response. Is their synthesis exclusively stimulated by heat stress or is the induction rather a response of the cell to the nongrowing state induced by heat stress?
ZO
oo!
To investigate this problem we measured the protein synthesis profile after different shifts from a growing to a nongrowing state. Growth-inhibiting conditions were induced by extracellular stimuli such as starvation for amino acids, glucose or oxygen or osmotic and oxidative stress which may be characteristic of the natural ecosystem of Bacillus (see Fig. 1). It is interesting to note that all growth-restrictive conditions tested so far induced or accelerated the synthesis of a set of proteins whose synthesis was also stimulated by heat stress (Fig. 4 and 5). However, some heat shock proteins (marked with H - heat specific) were not induced by these nongrowing conditions. These proteins were called specific heat shock proteins (H-group) which may exert a specific protection against heat damage.
6.5
6,0
i
i
5,5
pH
I - ...............................
G12
...
JJ
.e
HS
K..
b.~.- 09 'o 6(
,.---G11 .i---G16
3( .~--G15 ~20
Fig. 3. (continued).
203 The other group of proteins, induced by heat, ethanol, hydrogen peroxide, high osmotic pressure or by amino acid, glucose, or oxygen starvation, were called general stress proteins (G-group). These proteins were induced under nongrowing conditions regardless of the specific stress factor. They may provide a general protection of the cell under nongrowing conditions [29,35]. These proteins could exert a similar function as the pex-proteins in E. coli, which are believed to be involved in the maintenance of life in a starving state [36J. It should be mentioned that salt stress is an excellent inducer of general stress proteins. This is in keeping with the suggestion that salt st~'ess is an important environmental factor especially for soil-living bacteria [4]. Furthermore, it should be pointed out that all these extracellular signals in-
duce a set of specific prt~teins besides the general stress proteins (see Figs. 3 and 5, e.g. S - salt specific proteins).
5. STRINGENT RESPONSE A N D STRESS PROTEIN P R O D U C T I O N IN B A C I L L U S S U B TILLS Obviously quite different extracellular signals can activate the same or a similar set of stress genes m Bacillus subtilis. There might be an internal focusing signal which allows this type of overlapping control. Do all the extracelhilar signals analysed in our investigation trigger the same mechanism? We looked for elements which may mediate such signal focusing and we obtained
Fig. 3. (continued).
204
energy consuming process which may be superfluous in the starving cell, is an important reaction mediated by p p G p p [37]. Furthermore, the initiation of D N A replication seems to be stringently controlled [38-40]. This makes sense because the starving cell should be cell cycle arrested. In addition p p G p p is involved in the improvement of translational accuracy during amino acid starva-, tion [37,41]. We obtained preliminary results which indicate a relationship between the stringent response and stress protein induction in B. subtilis [29,35,42]. We found that all extracellular signals analysed in our studies led to the accumulation of ppGpp. This applies to amino acid and glucose starvation in a relA-dependent manner [43-45]. Furthermore, we found that oxygen starvation is also a
indications for the involvement of the stringent response. The bacterial response to the transition from a growing to a nongrowing state is achieved by an extremely complex metabolic and gene expression network (Fig. 1). One of the key elements in this network in bacteria is the ~tringent response, which is fairly well elucidated in E. coli. The stringent response may be very important in order to retain cell viability during metabolic stress [37]. Guanosinetetraphosphate (ppGpp) is an indicator for certain starvation conditions and is involved in the adaptation to the nongrowing state. This adaptation includes the reduction of nutrient-wasting processes characteristic of growth in order to preserve the limited nutrients for the maintenance of life. The prevention of ribosome synthesis, an
7,0
6,5
6,0
5,5
I
I
!
pH
~L
G12
90 75
60 oe~
'o
$24
0 . ~ - - G9
S2S
:i
~5
41~
30
¸
~.~
W•
G15
~i~~- :;:~ Fig. 3. (continued).
205
very good inducer of p p G p p accumulation in a relA-dependent mode [35]. In addition an alternative relA-independent mechanism of p p G p p accumulation by salt stress and probably by oxidative stress was observed (unpubl. results, [42]). The mechanism of this alteraative ppGpp-accumulation remains unclear. Our results indicate that the p p G p p dependent stringent control is a central defence reaction of the Bacillus ce!! under nongrowing conditions. p p G p p may act as a cellular indicator for unfavourable conditions in generai in B. subtilis (Fig. 6). However, information on the fzzn,°ticn ,~f p p G p p in B. subti/,is is rather limited, p p G p p is involved in the control of ribosome synthesis [46] and D N A synthesis [47] similar to E. coli. Furthermore, there are some results on the influence
7,O
9°i!
6,S
of p p G p p on different physiological reactions in Bacillus (stability of enzymes [48], inhibition of the inosine monophosphate dehydrogenase activity [45]). Concerning stress protein production, the question arises whether p p G p p is involved in the induction of stress proteins by different extracellular stress factors at normal temperature. There is a good correlation between p p G p p production and the induction of stress proteins (see Fig. 5). When p p G p p is accumulated the induction of general stress proteins occurs. However, at lower p p G p p concentrations (e.g. in the ~'elA mutant sta~ed for amino acids or oxygen) the induction of heat shock proteins is less pronounced (Fig. 4). Therefore we suggest that p p G p p is involved in the induction of general stress proteins at normal temperatures in B. subtilis. The
G,0
5,5
I
I
pH
15 D
¢'ft
!
C~
,
X
:E
GII o
,, .=..-GIG 2
IS58 C0
qr.,..,G20
Fig. 4. Stringent response and stress protein synthesis in B. subtilis ([35]; Mach et at., unpubl, data). Bacteria were labelled with 35S-L-methionine before (A, C) and after amino acid limitation (B, D) induced by the addition of nitrofurantoin [65]. A, B, IS58 (relA + ); C, D, IS56 (relA); for details see Figs. 3 and 5.
206 data indicate that an increase in the amount of p p G p p is a prerequisite for a maximal expression of genes encoding stress proteins (Fig. 5). The increased synthesis rate of stress proteins could be an essential component of the stringent response in Bacillus. For E. coli the results concerning the influence of p p G p p on the heat shock protein induction are conflicting [49-51]. For B. subtilis we would like to suggest two putative mechanisms of stress protein production: (i) a relA-independent mechanism, since heat shock proteins are induced also in the relA mutant (heat stress, salt stress, oxidative stress [29,33,42]; (ii) a relA-dependent mechanism during nutrient starvation. A high p p G p p content in the wild type is accompanied by a strong induction of stress proteins, but in the relA mutant the
L,
7,0
,O! il
stress response is weaker (Fig. 4; Mach et al. unpubl, data; [35]). However, there is neither clear evidence for a direct involvement of p p G p p in the induction of stress proteins nor do we know how p p G p p acts on gene expression in B. subtilis. One of the first reactions triggered by p p G p p in Bacillus is the decrease of the concentration of G T P [45]. The low G T P content may be a critical element in the signal route from starvation to the induction of several stationary phase phenomena, among them sporulation. It is tempting to speculate that GTP-binding Ras-like proteins recently detected in Bacillus are involved in this sensing process [19020]. One of the next steps in this signalling is the activation of the SpoOA protein (probably by phosphorylation), a protein belonging to the regulator class of the two-component
6,5
6,0
5,S
I
I
I
pH
G12 H3
f
75
HS
60
!
c~ x
45
22
IS58 oa-lim
Fig. 4.(continued).
207
regulatory systems (Fig. 2, [16]). There is good evidence that sporulation is induced by such a mechanism. On the other hand the synthesis of ribosomal R N A as an example of the "classical stringent response" (and probably many other reactions) is not regulated via tl~ds signal route, because the spoOA protein is not involved. Therefore there might be a spoOA-dependent and a spoOA-independent (see Fig. 6) mode of action of p p G p p in B. subtilis. Returning to stress proteins we suggest that the synthesis of these polypeptides is controlled in a spoOA-independent manner since stress proteins were induced also in the spoOA mutant (unpubl. results, [30]). Furthermore, a low G T P content does not seem to be involved because an experimental decrease of the G T P content by decoyinine
J 7.0
[52] did not trigger the induction of stress proteins (Mach et al., unpubl, data). In the literature there are some indications that a subset of heat shock genes is induced at the onset of sporulation. This seems to be true for Saccharomyces cerevisiae [22] as well as for prokaryotes (e.g. Myxococcus, see [53]). We measured the protein synthesis of B. subtilis during the transition to the stationary phase induced by starvation for glucose or amino acids. Both conditions trigger sporulation. Even in the beginning of the transient phase, general stress proteins were induced but specific heat shock proteins were not (Fig. 7). As already mentioned, the induction of general stress proteins by starvation is an early stationary phase event and not a sporulation event. The activation of the stress regulon does not de-
.6.5 ..
C
5,5
6,0
!
-
pH
I
~ G12
/
90
75 ~r
%! x
~r
j.--GI0 -.i---GlI
O
9!P "~H7"S22
30
"--'GI5 IS56 Co
"~-'G8
Fig. 4. (continued).
G20
208
~
7,0
6,5
5,5
6,0
pH
I
o'
' /
,!I
G12
'
~II~
~
H3
6
~ x
~4~ ~E
30
;22 IS56 aa-iim
"~Ga
Fig. 4. (continued).
General view of the induction
of stress
proteins
heat-specific stress proteins
by environmental
stress
fQctors special
general stress proteins
groups
salt specific stress proteins
treatment heat
relA ÷
heat
r¢tA
amino acid starvation 0 oxygen. limffatlon amino qcid starvation ×ygen m~tatton ~t salt stress
relA +
?
T J
J
'"
' 77~.
"
"
f
~
/
" "
relA*
re,. - Q
.
I
~
salt stress
Fig. 5. General scheme of the induction of stress proteins by environmental stress factors in B. subtilis: heat, 50°C; amino aclcl starvation, norvatin treatment; salt stress, 4% NaCI. II, strong induction; 6, induction; g& weak induction; 1:3, no induction (for nomenclature of proteins see Fig. 3, for details see [4,35,42]).
209 extrocellulor signals H202 salt stress ~ ~
heat stress
relAindependent
I I
limitation of oxygen aminoacids glucose
\\\
stress regulon
•
high temperature regulon
G20
relAdependent
i
l!
SpoOA-independent pathway
\
inhibitio~c,f r RNA-synthesis DNA-synthesis
I I ?
Spo0A- dependent
pathway
r" - - - J
l
GTP-binding 9 *',,-q I'o i ~ e " t_ ._~........ sensor
~
I
~
Spo0A* - - ~
I
regulator
sporulation
co,no=fence chemotaxis
Fig. 6. ppGpp, an alarmon involvedin signalling in B. subtilis (for details see text).
pend on sporulation, because spoOA mutants show the typical stress protein induction. Possibly, both strategies start with the same cellular signal for starvation. Then the signal transduction may be divided into at least two 16ute~ one leading to sporulation in a spoOA-dependent manner and the otker to the induction of stress proteins by a spoOA-independent mechanism. Nevertheless, initiation of sporulation and stress protein production occur at the same time. The stress proteins might be necessary in the structural stabilization of the sporulating cell [36], but the actual function of stress proteins in the starving cell remains a matter of speculation. Recent investigations suggest that the stress proteins may be involved in the development of stress tolerance in B. subtilis [54,55].
6. STRUCTURE A N D F U N C T I O N OF HEAT SHOCK GENES IN BACTERIA In E. coli the heat shock response has become one of the best known model systems for studying global control of gene expression [2 ~,34]. Sigma-32, the heat stress specific sigma factor was the first alternative sigma factor discovered in E. coli. Alternative promoters which allow a uniform regulation by the environmental signal "'heat stress" are a characteristic feature of heat shock genes in E. coli. The major sigma factor, sigma-70, is probably not able to recognise these alternative promoter structures (for review see [23]). Recently the mechanism of heat shock induction in E. coli has been elucidated. After a heat shock the concentration of sigma-32 transiently
210 increases about 10-fold. Sigma-32 now successfully competes with sigma-70 for ti~e c o m m o n core enzyme of RNA-polymerase. As a ;esult e 32 outcompetes 070 and the heat shock genes are transcribed [56-58]. As simple as tids mechanism seems to be, equally complicated is the control of the expression of rpoH which codes for sigma-32. A very complex regulation of gene exi~ression, acting at ~ranscriptional, posttranscriptioi~al and posttranslational levels, is involved [58,59]. However, to date there is only limited information available on the structure and function of
heat shock genes in Bacillus [60-64]. It is our aim to characterise heat shock genes in Bacillus in order to gain insights into this very fascinating class of genes. We are especially interested in the prolnoter structures, the key elements of the heat shock protein expression. We have cloned several promoter fragments using promoter probe vectors containing promoter-less genes. By an extensive screening program, about 2L) promoter-containing fragments were characterised, some of them seemed to be heat-inducible. These preselected transformants were further analysed by comparing
ill,
/~
5,5
!
I
pH
_air
f-
.....
6,0
I
90 75
9|ucos~ ttrnitdtion
0
65
6O
ie 1.5 2
_i i
I,,:
t
3~
#"
(9
* ",,-- G8
_•_ 90
G12..-...~
-
"~" ~
6..5
6,0
G20
55
pH
i
60I
21q)-' ' ""
'-""°
i, G,s
< ,I v -
-
Q, .
-
.
li--~',,
f d,5
._o,7~01il
~--G,3
"-
=--rW
Fig. 7. Stress protein induction in B. subtilis after exhaustion of glucose (Mach et al., unpubl, data). Bacteria were labelled with 35S-L-methionineduring exponential growth (1), in the transient phase (2) and 1 h after the entry into the stationary phase induced by the exhaustion ol glucose(3). Fluorograms of the corresponding two-dimensionalprotein gels are presented.
211 Promoter fragment l 0/ 8
CTGTCATTCTTGATTCAATGCGATCCTCTAGAGTAAAATCATTTT_GGAGGTG
10/48
TTTCTTCTATTGACAGAAACAGGAGAGAAI'AATATATTCTAATGTT_AACCT
CO-2H CACCCAAAATTGTCTTTACTTTCAGGCTGTCTGTTTTTATGATTAAAGCAGA Fig. 8. Putative str~wt~we~f heat regulated promoters of B. subtilis The putative 35 and 1~ rcgi~m.;~i~d the ~ta,-t i~u~i~6f transcription are underlined. The promoter fragments 10/8 and 10/48 were analysed in our laboratory (for further details see text). The sequenceof the fragment CO-2H was derived from tmanaka and Takagaki [64]. The starting point of transcription has not been determined for this promoter fragment.
the synthesis rates of the reporter enzyme in bacteria grown at 37°C and after imposition o | the heat stless using 3sS-L-methionine labelling. In some cases a 5- to 10-fold induction in response to heat stress could be demonstrated. This is in the range of heat-dependent promoters of E. colt [23,3~'o After sequencing and transcriptional start point analyses by the primer extension method (in cooperation with the group of P. Fortnagel in Hamb'arg) we gained preliminary insights into the structure of these heat-sensitive promoters (Fig. 8, ViSlker et al., in prep.). However, the results were surprising. The promoters we found look like vegetative promoters which may be utilised b y the vegetative sigma factor, o 43. Certainly it may be correct to presume that the mechanism of heat shock induction by alternative sigma factors has been conserved in bacteria. Do we have to take into consideration that the heat shock protein induction could be conserved in bacteria b u t the induction mechanism might be different? There are m a n y unsolved problems which need further investigation for their elucidation. I n conclusion it should be emphasised that: (i) Heat shock proteins in B. subtilis are interesting proteins ft'om an ecophysio|ogical point of view because the induction of stress proteins may be a very important adaptational strategy, in order to survive adverse environmental conditions. (it) The detaiied study of the molecular architecture of the heat shock/stress regulou in B. subtilis is very important for the understanding of global control of gene expression in B. subtilis in general.
ACKNOWLEDGEMENTS We would like to thank the Upjolm C o m p a n y for supplying the decoyinine and Mr. Stii!ke for critical reading of the manuscript.
REFERENCES [1] Starer,J.H.. Whittenbury.R. and Wimpenny,J.W.T. (Eds.) (1983) Microbes in their Natural Environment. Symposium 34. Societ7 General Microbiology, Cambridge UniversltyPress, C lmbridge. [2] Harder. W. and Dijkhuizen, D.E. (1983) Physiological responses to nutrient limitation. Ann. Rev. Microbiot. 37, 1-23.
{3] Hecker, M. and Babel, W. (Eds.) (1988) Physiologic der Mikroorganismen. VEB Gustav Fischer Verlag, Jena, Stuttgart. [4] Hecker, M., Heim, C, V~lker, U. and WrlfeL L. (1988) Induction of stress proteins by sodium chloride treatment in Bacillus subtilis. Arch. Microbiol. 150, 564-566. [5] Sonenshein,A.L. (1989) Metabolic regulation of sporulation and other stationar3,-phasephenomena, in Regulation of Procar3,'otic Development. Structural and Functional Analysisof Bacterial Sporulationand Germination (Smith, 1., Slepecky, R.A. and Setlow, P., Eds.). pp. 109-130. American Soc. for Microbiology,Washington D.C. [6] Smith, I (1989) Initiation of sporulation,in Regulation ot Procaryc ,,: Development. Structural and Functional Analysisof ~?~acterialSporulationand Germination (Smith, I., Slepecky, R.A. and Setlow, P., Eds.), pp. 185-2,0. American Soc. for Microbiology,Washington D.C. [7] Freese. E. , Freese, E.B., Allen, E.R. , Olembska-Beer, Z. Orrego, C., Varma, A. and Wabiko, H. (1985) Metabolic initiation of spore development, in Molecular Biology of Microbial Differentiation,pp. 194-202. AmericanSoc. for Microbiology, Washington,D.C. [8] Gottesman. S. (1984) Bacterial regulation: Global regulatory networks. Ann. Rev. Genet. 18, 415-441. [9] Freese, E. (1981) Initiation of bacterial sporulation, in Sporulation and G,.'rmination(Levinson,H.S., Sonenshein,
212 A.L. and Tripper, D.J., Eds.), pp. 1-12. American Soc. for Microbiology, Washington D.C. [10] Freese, E. and Heinze, J. (1984) Metabolic and geqetic control of bacterial sporulation, in The Bacterial Spore, vol. 2 (Hurst, A , Gould, G. and Dring, J., Eds.). pp. 101-172. Academic Press, London. [11] Freese, E. (1989) Control of differentiation by GTP. Nucleos. Nucleot. 8, 975-981. [12] Mach, H., Hecker, M. and Mach, F. (1988) Physiological studies on cAMP synthesis in Baecillus subtilis. FEMS Microbiol. Lett. 52, 189-192. [13] Ronson, C.W., Nixon, B.T. and Ausubel, F.M. (1987) Conserved domains in bacterial regulatory proteins that respond to environmental stimuli. Cell 49, 579-581. [14] Stock, J.B., Ninfa, A.J. and Stock, A.M. (1989) Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiol. Rev. 53, 450-490. [15] Bouret, R.B., Hess, J.F., Borkovich, V.A., Pakuta, A.A. and Simon, M.I. (1989) Protein phosphorylation in chemotaxis and two-component regulatory systems of bacteria. J. Biol. Chem. 264, 7085-7088 [16] Perego, M., Cole, S.P., Burbulys, D., Trach, K. and Hoch, J.A. (1989) Characterization of the gene for a protein kinase which phosphorylates the sporulation regulatory proteins SpoOA and SpoOF of Bacillus subtilis. J. Bacteriol. 171, 6187-6196. [17] Valle, F. and Ferrari, S. (1989) Subtilisin: a redundantly temporally regulated gene?, in Regulation of Procaryotic Development. Structural and Functional Analysis of Bacterial Sporulation and Germination (Smith, I., Slepecky, R.A. and Setlow, P., Eds.), pp. 131-146. American Soc. for Microbiology, W~si~ington D.C. [18] Guillen, N., Weinrauch, Y. and Dabn~u, D.A. (1989) Cloning and characterization of the regulatory Bacillus subtilis competence genes coma and comB. J. Bacteriol. 171, 5354-5361. [19] Trach, K. and Hoch, J.A. (1989) The Bacillus subtilis spoOB stage O sporulation operon encodes an essential GTP-binding protein. J. Bactc:iol. 171, 1362-1371. [20] Mitchell, C. and Vary, J.C. (1989) Proteins that interact with GTP during sporulation of Bacillus subtilis. J. Bacteriol. 171, 2915-2918. [21] Schlesinger, M.J., Ashburner, M. and Tissieres, A. (1982) Heat Shock: From Bacteria to Man. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. [22] Lindquist, S. (1986) The heat shock response. Ann. Rev. Biochem. 55, 1151-1191. [23] Neidhardt, F.C. and VanBogelen, R.A. (1987) Heat shock response, in Escherichia coil and Salmonella t)Thimurium: Cellular and Molecular Biology (Neidhardt, F.C., Ingraham, J.L., Low, K.B., Magasatfik, B., Schaechter, M. and Umbarger, H.E., Eds.), pp. 1334-1345, American Soc. for Microbiology, Washington, D.C. [24] Bochareva, E.S., Lissin, N.M. and Girshovich, A.S. (1988) Transient association of newly synthesized unfolded proteins with the heat shock groEL protein. Nature (London) 336, 254-256.
[25] Goloubinoff, P., Gatenby, A.A. and Lorimer, G.H. (1989) GroE heat shock proteins promote assembly of foreign prokaryotic ribulose bisphosphate carboxylase oligomers in Escherichia coli. Nature (London) 337, 44-46. [26] Kusukawa, N., Yura, T., Ueguchi, C., Akiyama, Y. and Ito, K. (1989) Effects of mutations in heat-shock genes groES and groEL on protein export in Escherichia coli. EMBO J. 8, 3517-352t. [27] Streips, U.N. and Polio, F.W. (1985) Heat shock proteins in Bacilli. J. Bacteriol. 162, 434-437. [28] Todd, J.A., Hubbard, T.J.P., Travers, A.A. and Ellar, D.J. (1985) Heat-shock proteins during growth and sporulation of Bacillus subtilis. FEBS Lett. 188, 209-214. [29] Richter, A. and Hecker, M. (1986) Heat-shock proteins in Bacillus subtilis: a two-dimensional e~.'ctrophoresis study. FEMS Microbiot. Lett. 36, 69-71. [30] Arnosti, D.N., Singer, V.L. and Chamberlin, M.J. (1986) Characterization of heat shock in Bacillus subtilis. J. Bacteriol. 168, 1243-1249. [31] Qoronfleh, M.U. and Streips, U.N. (1987) Initial sub-cellular localization of heat-shock proteins in Bacillus subtilis. FEMS Microbiol. Lett. 43, 373-377. [32] Fabisiewicz, A. and Piechowska, M. (1988) Heat-shock proteins in membrane vesicles of Bacillus subtilis. Acta Biochim. Polon. 35, 367-376. [33] Hecker, M. and Richter, A. (1987) Physiologische Untersucimngen zur Bildung von Hitzeschockproteinen in Bacillus subtiiis. J.Basic Microbiol. 27, 253-261. [34] Neidhardt, F.C., VanBogelen, R.A. and Vaughn, V. (1984) The genetics and regulation of heat-shock proteins. Ann. Rev. Genet. 18, 295-329. [35] Hecker, M., Richter, A., Schroeter, A., W~51fel, L. and Mach, F. (1987) Synthese von Hitzeschoekpr~,teinen nach einer Aminos~iure- und Sauerstofflimitation in Bacillus subtilis relA +- und relA-St~mmen. Z. Naturforschung 42c, 941-947. [36] Matin, A., Auger, E.A., Blum, P.H. and Schulz, J.E. (1989) Genetic basis of starvation survival in nondifferentiating bacteria. Ann. Rev. Microbiol. 43, 293-316. [37] Cashel, M. and Rudd, K.E. (1987) The stringent response, in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F.C., Ingraham, J.L., Low, K.B., Magasanik, B., Schaechter, M. and Umbarger, H.E., Eds.). pp. 1410-1438, American Soc. for Microbiology, Washington, D.C. [38] Hocker, M., Schroeter, A. and Mach, F. (1983) Replication of pBR322 DNA in stringent and relaxed strains of Escherichia coli. Mol. Gen. Genet. 190, 355-357. [39] Hecker, M. and Schroeter, A. (1984) 3H-Thymidin-inkorporation nach lsoleucinlimitation in stringent und relaxed kontrollierten St~immen vor~ Escherichia coli. Z. Allg. Mikrobiol. 24, 57-60. [40] Rokeach, L.A. and Zyskind, J.W. (1986) RNA terminating within the E. coli origin of replication: Stringent regulation and control by DnaA protein. Cell 46, 763-771. [41] Gallant, J.A. (1979) Stringent control in E. coli. Ann. Rev. Genet. 13, 393-415.
213 [42] Hecker, M., V~lker, U. and Heim, C. (1989) RelA-independent (p)ppGpp accumulation and heat shock protein induction after salt stress in Bacillus" subtilis. FEMS Microbiol. Le~,t. 58, 125-128. [43] Smith, 1., Paress, P., Cabane, K. and Dubnau, E. (1980) Genetics and physiology of the rel system of Bacillus subtilis. Mol. Gen. Genet. 178, 271-279. [44] . :;~, J, T Gallant, J., Shalit, P., Palmer, L. and Wehr, T. (1979) Regulatory nucleotides involved in the rel function of Ba~!lus subtilis. J. Bacteriol. 140, 671-679. [45] Lopez, J.M., Dromerick, A. and Freese, E. (1981) Response of guanosine 5"-triphosphate concentration to nutritional changes and its significance for Bacillus subtilis spon~,lation. J. Bacteriol. 146, 605-613. [46] Ogasawara, N., Moriya, S. and Yoshikawa, H. (1983) Structure and organization of rRNA operons at the region of replication origin of the B. subtilis chromosome. Nucleic Acids Res. 11, 6301-6318. [47] Seror, SA., Vannier, F., Levine, A. and Henckes, G. (1986) Stringent control of initiation of chromosomal replication in Bacillus subtilis. Nature (London) 321,709-710. [48] Ruppen, M.E. and Switzer, R.L. (1983) Involvement of the stringent response in degradation of glutamine phosphoribosylpyrophosphate amidotransferase in Bacillus subtilis. J. Bacteriol. 155, 56-63. [49] Grossman, A.D., Taylor, W.E., Burton, Z.F., Burgess, R.R. and Gross, C.A. (1985) Stringent response in Escherichia coil induces expression of heat shock proteins. J. Mol. Biol. 186, 357-365. [50] VanBogelen, R.A., Kelley, P.M. and Neidhardt, F.C. (1987) Differential induction of heat shock, SOS, and oxidation stress regulons and accumulation of nucleotides in Escherichia coli. J. Bacteriol. 169, 26-32. [51] Schnier, J. (1987) The synthesis of heat-shock proteins after a decrease in translational capacity in Escherichia coli. J. Gen. Microbiol. 133, 3151-3158. [52] Mitani, T. , Heinze, J.E. and Freese, E. (1977) Induction of sporulation in Bacillus subtilis by decoyinine and hadacidine. Biochem. Biophys. Res. Commun. 77, 11181125. [53] Killeen, K.P. and Nelson, D.R. (1988) Acceleration of starvation- and glycerol-induced myxospore formation by prior heat shock in Myxococcus xanthus. J. Bacteriol. 170, 520O-5207.
[54] Dowds, B.C.A., Murphy, P., McConnell, D.J. and Devine, K.M. (t987) Relationship among oxidative stress, growth cycle, and sporulation in Bacillus subtilis. J. Bacteriol. 169, 5771-5775. [55] Fabisiewicz, A. and Piechowska, M. (1988) Changes of sensitivity to heat shock during logarithmic growth of Bacillus subtilis. Acta. Biochim. Polon. 35, 207-217. [56] Grossman, A.D., Erickson, J.W. and Gross, C.A. (1984) The htpR gene product of Escherichia coli is a sigma factor for heat-shock promoters. Cell 38, 383-390. [57] Grossman, A.D., Straus, D.B., Walter, W.A. and Gross, C.A. (1987) 032 synthesis can regulate the synthesis of heat shock proteins in Escherichia coli. Genes Development 1, 179-184. [58] Straus, D.B., Walter, W.A. and Gross, C.A. (1987) The heat shock response of E. coli is regulated by changes in the concentration of o 32. Nature (London) 329, 348-351. [59] Erickson, J.W., Vaughn, V., Walter, W.A., Neidhardt, F.C. and Gross, C.A. (1987) Regulation of the promoters and transcripts of rpoH, the Escherichia coli heat shock regulatory gene. Genes Development 1,419-432. [60] Sussman, M.D. and Setlow, P. (1987) Nucleotide sequence of a Bacillus megaterium gene homologous to the dnaK gene of Escherichia coil Nucl. Acids IRes. 15, 3924. [61] Hearn~e, C.M. and Ellar, D.J. (1989) Nucleotide sequence of a Bacillus subtilis gene homologous to the dnaK gene of E_~cherichia coil Nuc!. Acids Res. 17, 8373. [62] Wetzstein, M. and Schumann, W. (1990) Nucleotide sequence of a Bacillus subtilis gene homologous to the grpE gene of E. coil located immediately upstream of the dnaK gene. Nucl. Acids Res. 18, 1289. [63] Wetzstein, M., Dedio, J. and Schumann, W. (1990) Complete nucleotide sequence of the Bacillus subtilis dnaK gene. Nucl. Acid3 Res. 18, 2172. [64] lmanaka, T. and Takagaki, K. (1988) Cloning in Bacillus subtilis of temperature-dependent promoter fragments from Bacillus stearothermophilus and Bacillus subtilis. FEMS Microbiol. Left. 52, 103-108. [65] Lopez, J.M. and Fortnagel, P. (1981) Nitrofurantoin prompts the stringent response in Bacillus subtilis. J. Gen. Microbiol. 126, 491-496.
197
FEMSEC 00294
General stress proteins in Bacillus subtilis Michael Hecker and U w e V~51ker Department of Biology, Ernst-M~oritz-Arndt University, GreifswaM, F.R,G.
Key words: Heat shock proteins; Stringent response; Adaptational network; Signalling
1. SUMMARY Bacillus cells frequently faced with various ad~ verse environmental factors in nature have-evolved different adaptational strategies. The induction of stress proteins is an essential component of this adaptational network. In Bacillus subtilis there are two groups of stress proteins. The first group is factor specific, whereas the second group is induced by growth restrictive conditions in general. The relationship between the stringent response and the induction of stress proteins is discussed.
2. I N T R O D U C T I O N - S I G N A L S A N D S I G N A L L I N G IN B A C I L L U S S U B T I L I S Bacteria spend most of their lifetime in a starving or nongrowing state [1,2]. The exponential growth typical of laboratory conditions is an exception in nature, whereas the transition from one transient state into another may be the rule. Cells of B. subtilis can reach a generation time of 20 to 30 min under optimal conditions using laboratory media. However, in their natural ecosystems, for example in the upper layers of soil. Bacillus cells have a mean generation time in the order of 50 to even 100 h. Furthermore, a considerable portion of the Bacillus population in soil is unable to
Correspondence to: Michael Hecker, Department of Biology,
Ernst-Moritz-Arndt University, 9200 Greifswald, F.R.G.
grow. These starving cells have to concentrate their cell physiology on survival. The capability for survival or even for growth under natural growth-limiting conditions needs special strategies which are of fundamental importance for microbial life in nature. The study of these survival strategies is a very useful concept for the understanding of microbiology in general [1-31. To analyse these survival strategies it is necessary to look for the environmental signals which have not o n ' j limited the bacterial growth in nature, but have also forced adaptational strategies in order to keep viability during stress. In Fig. 1 different environmental signals are sumrnarised which may be suggested to be important for the dialog between a Bacillus cell and its natural habitat. First and foremost there is starvation for energy or carbon sources, nitrogen or phosphorous sources etc., which are common signals for many other ecosystems too. A more typical environmental factor may be starvation for oxygen because B. subtilis is not able to generate energy solely by fermentation processes. Besides many other common signals like thermal or oxidative stress, salt stress should also be mentioned because desiccation occurs very frequently in soil [4]. During desiccation, osmotic stress caused by the increasing salt concentration occurs. The interaction with these growth-limiting factors is a central part of the physiology of a Bacillus cell. The well known process of sporulation should be mentioned first in this very complex
0168-6496/90/$03.50 © 1990 Federation of European MicrobiologicalS~':ieties
198
signalling
extracellulor signals
globalresponse oxy , I chem0taxls reSO~orl ] regLI/orl~~
(///~ limofitation
i:;o0 I.oo.u,.,,ooIII
~i~:~ion~
alamarts g:n, ~
iiias~!!!s:~ % ~
l n~r~rgo~n JrS:rinoglnet ' r¢gulati°n
i I} ~
~
Fig. 1. Growth limitingfactors and the adaptational network of B. subtilis.
adaptational network of a nongrowing cell. Hewever, there are m a n y alternative stationary phase reactions like stringent control, chemotaxis, cam-
petence, nitrogen, carbon or phosphorous regulation, etc. The information on these alternate adaptational reactions is rather restricted [5-7].
two-component intracellular(atormons)Signolsregu atorysystems
extracel[ular signas I
~~_~
02--~ limofitation C nut.ents N---=.P---t~
response
5po0A ~00~._% ~0o0~.E~or~- ~o~,oo Spo]IJ ~/ DegU
;.
%/ Fig. 2. Signallingin B. subtilis - a simplifiedand general view.
i99
This scenario is even more complicated as result of interactions and overlapping areas between these strategies in the network (Fig. 1). All these components constitute the so-called global response of a Bacillus cell to starvation. Thc-ze survival strategies are mainly realised at the level of gene expression. The gene expression program of a Bacillus cell is a reflection of the environment, it is determined by the extrace!lular signals [8]. The question arises: What is known on signalling in B. subtilis? The study of signal transduction is very important in order to understand the
7,0 '
~ i
control of gene expression in bacteria in general. A low GTP content may be an indicator for nutrient starvation in Bacillus and one of the most crucial cellular signals controlling the adaptational network (Fig. 2; [9-11]). Furthermore, cAMP is accumulated after starvation for oxygen or energy sources [12], but there is no information on the physiological role of cAMP in Bacillus. A central position in this signalling is occupied by the two-component regulatory systems [13-15]. ~ B. subtilis several two-component systems are involved in the dialog between the cell and the environment. The s p o l I J / s p o O A system controls
B..~ | G12
2E
6,0 I ~.
4P
"
5,5 i
pH
"J~" ~P "
"
7 60
•
°
°...~G9
.~--GIO 8..~.-Gll
F
~ "~--GIS .q..-.G20
l $ 58 Ko
~
Fig. 3. Synthesis of stress proteins in Bacillus subtilis 1 S 5 8 (relA ÷ ). Bacteria were labelled with "S-L-methionine before (A, control) and after imposition of the stress (B, heat stress, 50°C; C, heat stress, 52°C; D, stringent response induced by no~'alin; E, oxygen limitation; F, salt stress, 4% NaCI). Fluorograms of the corresponding two-dimensional polyacrylamide gels are presented. The different groups of stress proteins are marked with capital letters. H, heat specific stress proteins; G, general stress protei s; S, salt specific proteins; H/St, proteins induced by heat and starvation; H/S, proteins induced by heat and salt (for details see [4,29,35], see also Fig. 5).
200
different growth-limiting signals typical of the soil ecosystem trigger the production of a set of proteins which may confer a general protection of cellular life under stress conditions. The induction of this stress regulon with many overlapping areas to other stationary-phase responses might be an important component in the adaptational network. The well-known heat shock proteins are among these stress proteins.
many stationa~ phase reactions and sporulation. The de~S/degU system controls among other things the production of degradative enzymes, and the comP/comA system regulates competence [i6-18]. Unfortunately, some cardinal questions concerning signalling can not yet be answered. Such questions are: (i) What signals for starvation are recognised by these different sensor proteins in the twocomponent systems? (ii) Is a low GTP content directly involved in this sensing process? (iii) Are GTP-binding proteins important mediators iil signalling [19,20]? The elucidation of these problems awaits further investigation. An essential element in this adaptational network is the induction of the stress regulon. Quite
7,0
P R O D U C T I O N IN BACILLUS SUBTILIS All organisms, from bacteria to man, produce about I0, 20 or more heat shock proteins in response to heat stress. These proteins are of fundamental importance for cellular physiology in gen-
6.5
6,0
5,5
I
!
!
GI2
90,
H1 J
7s
H4
H2
-"
60
30
3. P H Y S I O L O G Y OF H E A T S H O C K P R O T E I N
. ..... . . . . . . .
':~'
H3
O f" "\"
:
j'- '
41~.'
~7,,
Fig. 3. (continued).
~ , ~r''G9
~
,p----Gi5
201
era!. The heat s,o,~,,'-'- response might be as ancient as cellular life itself [21-23]. Information on the basic func!ions of some heat shock proteins has been obwi:.:~!. They are involved in controlling intra- a:~,~ mtermolecular interactions of proteins [24-26]. Bacilt~ cells are able to accumulate several heat shock proteins in response to heat stress (Fig. 3, [27-30]). Many heat shock proteins are synthesised at 37 ° C, the "control" growth temperature, but at a lower rate. This might be because they also perform essential physiological functions at this temperature. However, other heat shock proteins (e.g. proteins numbered H1 and H2 in Fig. 3) can not be detected by 2D-ge! electrophoresis of extracts of cells grown at normal temperatures. As in the eukaryotes, the heat shock proteins can be grouped into proteins with low (10-20 kD) and
7,0
6.5
l
!
high (60-90 kD) relative molecular mass. Three of the heat shock proteins were found to be immunologically related to the Escherichia coli heat shock proteins DnaK, Lon and GroEL [30]. In addition to the cytoplasm, heat shock proteins were shown to be localised in the cytoplasmic membrane [31,32]o It is not in the scope of this review to give a detailed picture on different shift up- and shift down-experiments or on the kinetics of the synthesis of individual heat shock proteins [;3]. Only one aspect should be pointed out: The heat shock response is pronounced with increa~ing temperature. At 52°C the growth rate :,~ drastically diminished because the synthesis of vegetative proteins is inhibited. Under these conditions the heat shock proteins constitute a considerable portion of the proteins synthesised. The groEL gene product accounts for more than 50% of the
6,0
5,5
I
I
pH
C G12
90 -
I
.#/~2 HI
HL, H3
/.i" ~p~H5
75 o
X
4--O10 ~'-G11
H/St23
"~" H1521
30
j.-.HIS22 0 q~--Gl 4 •.L-.GI 5 j,.G13
.ISS8 52°C Fig. 3. (continued).
G20
~ ~=~G17
202
protein synthesising capacity at this temperature (Fig. 3C). Similar resulls were published by Neidhardt et al. for E. coli [23].
4. HEAT SHOCK PROTEINS A N D STRESS PROTEINS It is well known that several extracellular stimuli are able to enhance the synthesis of heat shock proteins [22,23,34]. Therefore the question arises, whether the heat shock proteins of B. subtilis indicated in Fig. 3 are specific for the heat shock response. Is their synthesis exclusively stimulated by heat stress or is the induction rather a response of the cell to the nongrowing state induced by heat stress?
ZO
oo!
To investigate this problem we measured the protein synthesis profile after different shifts from a growing to a nongrowing state. Growth-inhibiting conditions were induced by extracellular stimuli such as starvation for amino acids, glucose or oxygen or osmotic and oxidative stress which may be characteristic of the natural ecosystem of Bacillus (see Fig. 1). It is interesting to note that all growth-restrictive conditions tested so far induced or accelerated the synthesis of a set of proteins whose synthesis was also stimulated by heat stress (Fig. 4 and 5). However, some heat shock proteins (marked with H - heat specific) were not induced by these nongrowing conditions. These proteins were called specific heat shock proteins (H-group) which may exert a specific protection against heat damage.
6.5
6,0
i
i
5,5
pH
I - ...............................
G12
...
JJ
.e
HS
K..
b.~.- 09 'o 6(
,.---G11 .i---G16
3( .~--G15 ~20
Fig. 3. (continued).
203 The other group of proteins, induced by heat, ethanol, hydrogen peroxide, high osmotic pressure or by amino acid, glucose, or oxygen starvation, were called general stress proteins (G-group). These proteins were induced under nongrowing conditions regardless of the specific stress factor. They may provide a general protection of the cell under nongrowing conditions [29,35]. These proteins could exert a similar function as the pex-proteins in E. coli, which are believed to be involved in the maintenance of life in a starving state [36J. It should be mentioned that salt stress is an excellent inducer of general stress proteins. This is in keeping with the suggestion that salt st~'ess is an important environmental factor especially for soil-living bacteria [4]. Furthermore, it should be pointed out that all these extracellular signals in-
duce a set of specific prt~teins besides the general stress proteins (see Figs. 3 and 5, e.g. S - salt specific proteins).
5. STRINGENT RESPONSE A N D STRESS PROTEIN P R O D U C T I O N IN B A C I L L U S S U B TILLS Obviously quite different extracellular signals can activate the same or a similar set of stress genes m Bacillus subtilis. There might be an internal focusing signal which allows this type of overlapping control. Do all the extracelhilar signals analysed in our investigation trigger the same mechanism? We looked for elements which may mediate such signal focusing and we obtained
Fig. 3. (continued).
204
energy consuming process which may be superfluous in the starving cell, is an important reaction mediated by p p G p p [37]. Furthermore, the initiation of D N A replication seems to be stringently controlled [38-40]. This makes sense because the starving cell should be cell cycle arrested. In addition p p G p p is involved in the improvement of translational accuracy during amino acid starva-, tion [37,41]. We obtained preliminary results which indicate a relationship between the stringent response and stress protein induction in B. subtilis [29,35,42]. We found that all extracellular signals analysed in our studies led to the accumulation of ppGpp. This applies to amino acid and glucose starvation in a relA-dependent manner [43-45]. Furthermore, we found that oxygen starvation is also a
indications for the involvement of the stringent response. The bacterial response to the transition from a growing to a nongrowing state is achieved by an extremely complex metabolic and gene expression network (Fig. 1). One of the key elements in this network in bacteria is the ~tringent response, which is fairly well elucidated in E. coli. The stringent response may be very important in order to retain cell viability during metabolic stress [37]. Guanosinetetraphosphate (ppGpp) is an indicator for certain starvation conditions and is involved in the adaptation to the nongrowing state. This adaptation includes the reduction of nutrient-wasting processes characteristic of growth in order to preserve the limited nutrients for the maintenance of life. The prevention of ribosome synthesis, an
7,0
6,5
6,0
5,5
I
I
!
pH
~L
G12
90 75
60 oe~
'o
$24
0 . ~ - - G9
S2S
:i
~5
41~
30
¸
~.~
W•
G15
~i~~- :;:~ Fig. 3. (continued).
205
very good inducer of p p G p p accumulation in a relA-dependent mode [35]. In addition an alternative relA-independent mechanism of p p G p p accumulation by salt stress and probably by oxidative stress was observed (unpubl. results, [42]). The mechanism of this alteraative ppGpp-accumulation remains unclear. Our results indicate that the p p G p p dependent stringent control is a central defence reaction of the Bacillus ce!! under nongrowing conditions. p p G p p may act as a cellular indicator for unfavourable conditions in generai in B. subtilis (Fig. 6). However, information on the fzzn,°ticn ,~f p p G p p in B. subti/,is is rather limited, p p G p p is involved in the control of ribosome synthesis [46] and D N A synthesis [47] similar to E. coli. Furthermore, there are some results on the influence
7,O
9°i!
6,S
of p p G p p on different physiological reactions in Bacillus (stability of enzymes [48], inhibition of the inosine monophosphate dehydrogenase activity [45]). Concerning stress protein production, the question arises whether p p G p p is involved in the induction of stress proteins by different extracellular stress factors at normal temperature. There is a good correlation between p p G p p production and the induction of stress proteins (see Fig. 5). When p p G p p is accumulated the induction of general stress proteins occurs. However, at lower p p G p p concentrations (e.g. in the ~'elA mutant sta~ed for amino acids or oxygen) the induction of heat shock proteins is less pronounced (Fig. 4). Therefore we suggest that p p G p p is involved in the induction of general stress proteins at normal temperatures in B. subtilis. The
G,0
5,5
I
I
pH
15 D
¢'ft
!
C~
,
X
:E
GII o
,, .=..-GIG 2
IS58 C0
qr.,..,G20
Fig. 4. Stringent response and stress protein synthesis in B. subtilis ([35]; Mach et at., unpubl, data). Bacteria were labelled with 35S-L-methionine before (A, C) and after amino acid limitation (B, D) induced by the addition of nitrofurantoin [65]. A, B, IS58 (relA + ); C, D, IS56 (relA); for details see Figs. 3 and 5.
206 data indicate that an increase in the amount of p p G p p is a prerequisite for a maximal expression of genes encoding stress proteins (Fig. 5). The increased synthesis rate of stress proteins could be an essential component of the stringent response in Bacillus. For E. coli the results concerning the influence of p p G p p on the heat shock protein induction are conflicting [49-51]. For B. subtilis we would like to suggest two putative mechanisms of stress protein production: (i) a relA-independent mechanism, since heat shock proteins are induced also in the relA mutant (heat stress, salt stress, oxidative stress [29,33,42]; (ii) a relA-dependent mechanism during nutrient starvation. A high p p G p p content in the wild type is accompanied by a strong induction of stress proteins, but in the relA mutant the
L,
7,0
,O! il
stress response is weaker (Fig. 4; Mach et al. unpubl, data; [35]). However, there is neither clear evidence for a direct involvement of p p G p p in the induction of stress proteins nor do we know how p p G p p acts on gene expression in B. subtilis. One of the first reactions triggered by p p G p p in Bacillus is the decrease of the concentration of G T P [45]. The low G T P content may be a critical element in the signal route from starvation to the induction of several stationary phase phenomena, among them sporulation. It is tempting to speculate that GTP-binding Ras-like proteins recently detected in Bacillus are involved in this sensing process [19020]. One of the next steps in this signalling is the activation of the SpoOA protein (probably by phosphorylation), a protein belonging to the regulator class of the two-component
6,5
6,0
5,S
I
I
I
pH
G12 H3
f
75
HS
60
!
c~ x
45
22
IS58 oa-lim
Fig. 4.(continued).
207
regulatory systems (Fig. 2, [16]). There is good evidence that sporulation is induced by such a mechanism. On the other hand the synthesis of ribosomal R N A as an example of the "classical stringent response" (and probably many other reactions) is not regulated via tl~ds signal route, because the spoOA protein is not involved. Therefore there might be a spoOA-dependent and a spoOA-independent (see Fig. 6) mode of action of p p G p p in B. subtilis. Returning to stress proteins we suggest that the synthesis of these polypeptides is controlled in a spoOA-independent manner since stress proteins were induced also in the spoOA mutant (unpubl. results, [30]). Furthermore, a low G T P content does not seem to be involved because an experimental decrease of the G T P content by decoyinine
J 7.0
[52] did not trigger the induction of stress proteins (Mach et al., unpubl, data). In the literature there are some indications that a subset of heat shock genes is induced at the onset of sporulation. This seems to be true for Saccharomyces cerevisiae [22] as well as for prokaryotes (e.g. Myxococcus, see [53]). We measured the protein synthesis of B. subtilis during the transition to the stationary phase induced by starvation for glucose or amino acids. Both conditions trigger sporulation. Even in the beginning of the transient phase, general stress proteins were induced but specific heat shock proteins were not (Fig. 7). As already mentioned, the induction of general stress proteins by starvation is an early stationary phase event and not a sporulation event. The activation of the stress regulon does not de-
.6.5 ..
C
5,5
6,0
!
-
pH
I
~ G12
/
90
75 ~r
%! x
~r
j.--GI0 -.i---GlI
O
9!P "~H7"S22
30
"--'GI5 IS56 Co
"~-'G8
Fig. 4. (continued).
G20
208
~
7,0
6,5
5,5
6,0
pH
I
o'
' /
,!I
G12
'
~II~
~
H3
6
~ x
~4~ ~E
30
;22 IS56 aa-iim
"~Ga
Fig. 4. (continued).
General view of the induction
of stress
proteins
heat-specific stress proteins
by environmental
stress
fQctors special
general stress proteins
groups
salt specific stress proteins
treatment heat
relA ÷
heat
r¢tA
amino acid starvation 0 oxygen. limffatlon amino qcid starvation ×ygen m~tatton ~t salt stress
relA +
?
T J
J
'"
' 77~.
"
"
f
~
/
" "
relA*
re,. - Q
.
I
~
salt stress
Fig. 5. General scheme of the induction of stress proteins by environmental stress factors in B. subtilis: heat, 50°C; amino aclcl starvation, norvatin treatment; salt stress, 4% NaCI. II, strong induction; 6, induction; g& weak induction; 1:3, no induction (for nomenclature of proteins see Fig. 3, for details see [4,35,42]).
209 extrocellulor signals H202 salt stress ~ ~
heat stress
relAindependent
I I
limitation of oxygen aminoacids glucose
\\\
stress regulon
•
high temperature regulon
G20
relAdependent
i
l!
SpoOA-independent pathway
\
inhibitio~c,f r RNA-synthesis DNA-synthesis
I I ?
Spo0A- dependent
pathway
r" - - - J
l
GTP-binding 9 *',,-q I'o i ~ e " t_ ._~........ sensor
~
I
~
Spo0A* - - ~
I
regulator
sporulation
co,no=fence chemotaxis
Fig. 6. ppGpp, an alarmon involvedin signalling in B. subtilis (for details see text).
pend on sporulation, because spoOA mutants show the typical stress protein induction. Possibly, both strategies start with the same cellular signal for starvation. Then the signal transduction may be divided into at least two 16ute~ one leading to sporulation in a spoOA-dependent manner and the otker to the induction of stress proteins by a spoOA-independent mechanism. Nevertheless, initiation of sporulation and stress protein production occur at the same time. The stress proteins might be necessary in the structural stabilization of the sporulating cell [36], but the actual function of stress proteins in the starving cell remains a matter of speculation. Recent investigations suggest that the stress proteins may be involved in the development of stress tolerance in B. subtilis [54,55].
6. STRUCTURE A N D F U N C T I O N OF HEAT SHOCK GENES IN BACTERIA In E. coli the heat shock response has become one of the best known model systems for studying global control of gene expression [2 ~,34]. Sigma-32, the heat stress specific sigma factor was the first alternative sigma factor discovered in E. coli. Alternative promoters which allow a uniform regulation by the environmental signal "'heat stress" are a characteristic feature of heat shock genes in E. coli. The major sigma factor, sigma-70, is probably not able to recognise these alternative promoter structures (for review see [23]). Recently the mechanism of heat shock induction in E. coli has been elucidated. After a heat shock the concentration of sigma-32 transiently
210 increases about 10-fold. Sigma-32 now successfully competes with sigma-70 for ti~e c o m m o n core enzyme of RNA-polymerase. As a ;esult e 32 outcompetes 070 and the heat shock genes are transcribed [56-58]. As simple as tids mechanism seems to be, equally complicated is the control of the expression of rpoH which codes for sigma-32. A very complex regulation of gene exi~ression, acting at ~ranscriptional, posttranscriptioi~al and posttranslational levels, is involved [58,59]. However, to date there is only limited information available on the structure and function of
heat shock genes in Bacillus [60-64]. It is our aim to characterise heat shock genes in Bacillus in order to gain insights into this very fascinating class of genes. We are especially interested in the prolnoter structures, the key elements of the heat shock protein expression. We have cloned several promoter fragments using promoter probe vectors containing promoter-less genes. By an extensive screening program, about 2L) promoter-containing fragments were characterised, some of them seemed to be heat-inducible. These preselected transformants were further analysed by comparing
ill,
/~
5,5
!
I
pH
_air
f-
.....
6,0
I
90 75
9|ucos~ ttrnitdtion
0
65
6O
ie 1.5 2
_i i
I,,:
t
3~
#"
(9
* ",,-- G8
_•_ 90
G12..-...~
-
"~" ~
6..5
6,0
G20
55
pH
i
60I
21q)-' ' ""
'-""°
i, G,s
< ,I v -
-
Q, .
-
.
li--~',,
f d,5
._o,7~01il
~--G,3
"-
=--rW
Fig. 7. Stress protein induction in B. subtilis after exhaustion of glucose (Mach et al., unpubl, data). Bacteria were labelled with 35S-L-methionineduring exponential growth (1), in the transient phase (2) and 1 h after the entry into the stationary phase induced by the exhaustion ol glucose(3). Fluorograms of the corresponding two-dimensionalprotein gels are presented.
211 Promoter fragment l 0/ 8
CTGTCATTCTTGATTCAATGCGATCCTCTAGAGTAAAATCATTTT_GGAGGTG
10/48
TTTCTTCTATTGACAGAAACAGGAGAGAAI'AATATATTCTAATGTT_AACCT
CO-2H CACCCAAAATTGTCTTTACTTTCAGGCTGTCTGTTTTTATGATTAAAGCAGA Fig. 8. Putative str~wt~we~f heat regulated promoters of B. subtilis The putative 35 and 1~ rcgi~m.;~i~d the ~ta,-t i~u~i~6f transcription are underlined. The promoter fragments 10/8 and 10/48 were analysed in our laboratory (for further details see text). The sequenceof the fragment CO-2H was derived from tmanaka and Takagaki [64]. The starting point of transcription has not been determined for this promoter fragment.
the synthesis rates of the reporter enzyme in bacteria grown at 37°C and after imposition o | the heat stless using 3sS-L-methionine labelling. In some cases a 5- to 10-fold induction in response to heat stress could be demonstrated. This is in the range of heat-dependent promoters of E. colt [23,3~'o After sequencing and transcriptional start point analyses by the primer extension method (in cooperation with the group of P. Fortnagel in Hamb'arg) we gained preliminary insights into the structure of these heat-sensitive promoters (Fig. 8, ViSlker et al., in prep.). However, the results were surprising. The promoters we found look like vegetative promoters which may be utilised b y the vegetative sigma factor, o 43. Certainly it may be correct to presume that the mechanism of heat shock induction by alternative sigma factors has been conserved in bacteria. Do we have to take into consideration that the heat shock protein induction could be conserved in bacteria b u t the induction mechanism might be different? There are m a n y unsolved problems which need further investigation for their elucidation. I n conclusion it should be emphasised that: (i) Heat shock proteins in B. subtilis are interesting proteins ft'om an ecophysio|ogical point of view because the induction of stress proteins may be a very important adaptational strategy, in order to survive adverse environmental conditions. (it) The detaiied study of the molecular architecture of the heat shock/stress regulou in B. subtilis is very important for the understanding of global control of gene expression in B. subtilis in general.
ACKNOWLEDGEMENTS We would like to thank the Upjolm C o m p a n y for supplying the decoyinine and Mr. Stii!ke for critical reading of the manuscript.
REFERENCES [1] Starer,J.H.. Whittenbury.R. and Wimpenny,J.W.T. (Eds.) (1983) Microbes in their Natural Environment. Symposium 34. Societ7 General Microbiology, Cambridge UniversltyPress, C lmbridge. [2] Harder. W. and Dijkhuizen, D.E. (1983) Physiological responses to nutrient limitation. Ann. Rev. Microbiot. 37, 1-23.
{3] Hecker, M. and Babel, W. (Eds.) (1988) Physiologic der Mikroorganismen. VEB Gustav Fischer Verlag, Jena, Stuttgart. [4] Hecker, M., Heim, C, V~lker, U. and WrlfeL L. (1988) Induction of stress proteins by sodium chloride treatment in Bacillus subtilis. Arch. Microbiol. 150, 564-566. [5] Sonenshein,A.L. (1989) Metabolic regulation of sporulation and other stationar3,-phasephenomena, in Regulation of Procar3,'otic Development. Structural and Functional Analysisof Bacterial Sporulationand Germination (Smith, 1., Slepecky, R.A. and Setlow, P., Eds.). pp. 109-130. American Soc. for Microbiology,Washington D.C. [6] Smith, I (1989) Initiation of sporulation,in Regulation ot Procaryc ,,: Development. Structural and Functional Analysisof ~?~acterialSporulationand Germination (Smith, I., Slepecky, R.A. and Setlow, P., Eds.), pp. 185-2,0. American Soc. for Microbiology,Washington D.C. [7] Freese. E. , Freese, E.B., Allen, E.R. , Olembska-Beer, Z. Orrego, C., Varma, A. and Wabiko, H. (1985) Metabolic initiation of spore development, in Molecular Biology of Microbial Differentiation,pp. 194-202. AmericanSoc. for Microbiology, Washington,D.C. [8] Gottesman. S. (1984) Bacterial regulation: Global regulatory networks. Ann. Rev. Genet. 18, 415-441. [9] Freese, E. (1981) Initiation of bacterial sporulation, in Sporulation and G,.'rmination(Levinson,H.S., Sonenshein,
212 A.L. and Tripper, D.J., Eds.), pp. 1-12. American Soc. for Microbiology, Washington D.C. [10] Freese, E. and Heinze, J. (1984) Metabolic and geqetic control of bacterial sporulation, in The Bacterial Spore, vol. 2 (Hurst, A , Gould, G. and Dring, J., Eds.). pp. 101-172. Academic Press, London. [11] Freese, E. (1989) Control of differentiation by GTP. Nucleos. Nucleot. 8, 975-981. [12] Mach, H., Hecker, M. and Mach, F. (1988) Physiological studies on cAMP synthesis in Baecillus subtilis. FEMS Microbiol. Lett. 52, 189-192. [13] Ronson, C.W., Nixon, B.T. and Ausubel, F.M. (1987) Conserved domains in bacterial regulatory proteins that respond to environmental stimuli. Cell 49, 579-581. [14] Stock, J.B., Ninfa, A.J. and Stock, A.M. (1989) Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiol. Rev. 53, 450-490. [15] Bouret, R.B., Hess, J.F., Borkovich, V.A., Pakuta, A.A. and Simon, M.I. (1989) Protein phosphorylation in chemotaxis and two-component regulatory systems of bacteria. J. Biol. Chem. 264, 7085-7088 [16] Perego, M., Cole, S.P., Burbulys, D., Trach, K. and Hoch, J.A. (1989) Characterization of the gene for a protein kinase which phosphorylates the sporulation regulatory proteins SpoOA and SpoOF of Bacillus subtilis. J. Bacteriol. 171, 6187-6196. [17] Valle, F. and Ferrari, S. (1989) Subtilisin: a redundantly temporally regulated gene?, in Regulation of Procaryotic Development. Structural and Functional Analysis of Bacterial Sporulation and Germination (Smith, I., Slepecky, R.A. and Setlow, P., Eds.), pp. 131-146. American Soc. for Microbiology, W~si~ington D.C. [18] Guillen, N., Weinrauch, Y. and Dabn~u, D.A. (1989) Cloning and characterization of the regulatory Bacillus subtilis competence genes coma and comB. J. Bacteriol. 171, 5354-5361. [19] Trach, K. and Hoch, J.A. (1989) The Bacillus subtilis spoOB stage O sporulation operon encodes an essential GTP-binding protein. J. Bactc:iol. 171, 1362-1371. [20] Mitchell, C. and Vary, J.C. (1989) Proteins that interact with GTP during sporulation of Bacillus subtilis. J. Bacteriol. 171, 2915-2918. [21] Schlesinger, M.J., Ashburner, M. and Tissieres, A. (1982) Heat Shock: From Bacteria to Man. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. [22] Lindquist, S. (1986) The heat shock response. Ann. Rev. Biochem. 55, 1151-1191. [23] Neidhardt, F.C. and VanBogelen, R.A. (1987) Heat shock response, in Escherichia coil and Salmonella t)Thimurium: Cellular and Molecular Biology (Neidhardt, F.C., Ingraham, J.L., Low, K.B., Magasatfik, B., Schaechter, M. and Umbarger, H.E., Eds.), pp. 1334-1345, American Soc. for Microbiology, Washington, D.C. [24] Bochareva, E.S., Lissin, N.M. and Girshovich, A.S. (1988) Transient association of newly synthesized unfolded proteins with the heat shock groEL protein. Nature (London) 336, 254-256.
[25] Goloubinoff, P., Gatenby, A.A. and Lorimer, G.H. (1989) GroE heat shock proteins promote assembly of foreign prokaryotic ribulose bisphosphate carboxylase oligomers in Escherichia coli. Nature (London) 337, 44-46. [26] Kusukawa, N., Yura, T., Ueguchi, C., Akiyama, Y. and Ito, K. (1989) Effects of mutations in heat-shock genes groES and groEL on protein export in Escherichia coli. EMBO J. 8, 3517-352t. [27] Streips, U.N. and Polio, F.W. (1985) Heat shock proteins in Bacilli. J. Bacteriol. 162, 434-437. [28] Todd, J.A., Hubbard, T.J.P., Travers, A.A. and Ellar, D.J. (1985) Heat-shock proteins during growth and sporulation of Bacillus subtilis. FEBS Lett. 188, 209-214. [29] Richter, A. and Hecker, M. (1986) Heat-shock proteins in Bacillus subtilis: a two-dimensional e~.'ctrophoresis study. FEMS Microbiot. Lett. 36, 69-71. [30] Arnosti, D.N., Singer, V.L. and Chamberlin, M.J. (1986) Characterization of heat shock in Bacillus subtilis. J. Bacteriol. 168, 1243-1249. [31] Qoronfleh, M.U. and Streips, U.N. (1987) Initial sub-cellular localization of heat-shock proteins in Bacillus subtilis. FEMS Microbiol. Lett. 43, 373-377. [32] Fabisiewicz, A. and Piechowska, M. (1988) Heat-shock proteins in membrane vesicles of Bacillus subtilis. Acta Biochim. Polon. 35, 367-376. [33] Hecker, M. and Richter, A. (1987) Physiologische Untersucimngen zur Bildung von Hitzeschockproteinen in Bacillus subtiiis. J.Basic Microbiol. 27, 253-261. [34] Neidhardt, F.C., VanBogelen, R.A. and Vaughn, V. (1984) The genetics and regulation of heat-shock proteins. Ann. Rev. Genet. 18, 295-329. [35] Hecker, M., Richter, A., Schroeter, A., W~51fel, L. and Mach, F. (1987) Synthese von Hitzeschoekpr~,teinen nach einer Aminos~iure- und Sauerstofflimitation in Bacillus subtilis relA +- und relA-St~mmen. Z. Naturforschung 42c, 941-947. [36] Matin, A., Auger, E.A., Blum, P.H. and Schulz, J.E. (1989) Genetic basis of starvation survival in nondifferentiating bacteria. Ann. Rev. Microbiol. 43, 293-316. [37] Cashel, M. and Rudd, K.E. (1987) The stringent response, in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F.C., Ingraham, J.L., Low, K.B., Magasanik, B., Schaechter, M. and Umbarger, H.E., Eds.). pp. 1410-1438, American Soc. for Microbiology, Washington, D.C. [38] Hocker, M., Schroeter, A. and Mach, F. (1983) Replication of pBR322 DNA in stringent and relaxed strains of Escherichia coli. Mol. Gen. Genet. 190, 355-357. [39] Hecker, M. and Schroeter, A. (1984) 3H-Thymidin-inkorporation nach lsoleucinlimitation in stringent und relaxed kontrollierten St~immen vor~ Escherichia coli. Z. Allg. Mikrobiol. 24, 57-60. [40] Rokeach, L.A. and Zyskind, J.W. (1986) RNA terminating within the E. coli origin of replication: Stringent regulation and control by DnaA protein. Cell 46, 763-771. [41] Gallant, J.A. (1979) Stringent control in E. coli. Ann. Rev. Genet. 13, 393-415.
213 [42] Hecker, M., V~lker, U. and Heim, C. (1989) RelA-independent (p)ppGpp accumulation and heat shock protein induction after salt stress in Bacillus" subtilis. FEMS Microbiol. Le~,t. 58, 125-128. [43] Smith, 1., Paress, P., Cabane, K. and Dubnau, E. (1980) Genetics and physiology of the rel system of Bacillus subtilis. Mol. Gen. Genet. 178, 271-279. [44] . :;~, J, T Gallant, J., Shalit, P., Palmer, L. and Wehr, T. (1979) Regulatory nucleotides involved in the rel function of Ba~!lus subtilis. J. Bacteriol. 140, 671-679. [45] Lopez, J.M., Dromerick, A. and Freese, E. (1981) Response of guanosine 5"-triphosphate concentration to nutritional changes and its significance for Bacillus subtilis spon~,lation. J. Bacteriol. 146, 605-613. [46] Ogasawara, N., Moriya, S. and Yoshikawa, H. (1983) Structure and organization of rRNA operons at the region of replication origin of the B. subtilis chromosome. Nucleic Acids Res. 11, 6301-6318. [47] Seror, SA., Vannier, F., Levine, A. and Henckes, G. (1986) Stringent control of initiation of chromosomal replication in Bacillus subtilis. Nature (London) 321,709-710. [48] Ruppen, M.E. and Switzer, R.L. (1983) Involvement of the stringent response in degradation of glutamine phosphoribosylpyrophosphate amidotransferase in Bacillus subtilis. J. Bacteriol. 155, 56-63. [49] Grossman, A.D., Taylor, W.E., Burton, Z.F., Burgess, R.R. and Gross, C.A. (1985) Stringent response in Escherichia coil induces expression of heat shock proteins. J. Mol. Biol. 186, 357-365. [50] VanBogelen, R.A., Kelley, P.M. and Neidhardt, F.C. (1987) Differential induction of heat shock, SOS, and oxidation stress regulons and accumulation of nucleotides in Escherichia coli. J. Bacteriol. 169, 26-32. [51] Schnier, J. (1987) The synthesis of heat-shock proteins after a decrease in translational capacity in Escherichia coli. J. Gen. Microbiol. 133, 3151-3158. [52] Mitani, T. , Heinze, J.E. and Freese, E. (1977) Induction of sporulation in Bacillus subtilis by decoyinine and hadacidine. Biochem. Biophys. Res. Commun. 77, 11181125. [53] Killeen, K.P. and Nelson, D.R. (1988) Acceleration of starvation- and glycerol-induced myxospore formation by prior heat shock in Myxococcus xanthus. J. Bacteriol. 170, 520O-5207.
[54] Dowds, B.C.A., Murphy, P., McConnell, D.J. and Devine, K.M. (t987) Relationship among oxidative stress, growth cycle, and sporulation in Bacillus subtilis. J. Bacteriol. 169, 5771-5775. [55] Fabisiewicz, A. and Piechowska, M. (1988) Changes of sensitivity to heat shock during logarithmic growth of Bacillus subtilis. Acta. Biochim. Polon. 35, 207-217. [56] Grossman, A.D., Erickson, J.W. and Gross, C.A. (1984) The htpR gene product of Escherichia coli is a sigma factor for heat-shock promoters. Cell 38, 383-390. [57] Grossman, A.D., Straus, D.B., Walter, W.A. and Gross, C.A. (1987) 032 synthesis can regulate the synthesis of heat shock proteins in Escherichia coli. Genes Development 1, 179-184. [58] Straus, D.B., Walter, W.A. and Gross, C.A. (1987) The heat shock response of E. coli is regulated by changes in the concentration of o 32. Nature (London) 329, 348-351. [59] Erickson, J.W., Vaughn, V., Walter, W.A., Neidhardt, F.C. and Gross, C.A. (1987) Regulation of the promoters and transcripts of rpoH, the Escherichia coli heat shock regulatory gene. Genes Development 1,419-432. [60] Sussman, M.D. and Setlow, P. (1987) Nucleotide sequence of a Bacillus megaterium gene homologous to the dnaK gene of Escherichia coil Nucl. Acids IRes. 15, 3924. [61] Hearn~e, C.M. and Ellar, D.J. (1989) Nucleotide sequence of a Bacillus subtilis gene homologous to the dnaK gene of E_~cherichia coil Nuc!. Acids Res. 17, 8373. [62] Wetzstein, M. and Schumann, W. (1990) Nucleotide sequence of a Bacillus subtilis gene homologous to the grpE gene of E. coil located immediately upstream of the dnaK gene. Nucl. Acids Res. 18, 1289. [63] Wetzstein, M., Dedio, J. and Schumann, W. (1990) Complete nucleotide sequence of the Bacillus subtilis dnaK gene. Nucl. Acid3 Res. 18, 2172. [64] lmanaka, T. and Takagaki, K. (1988) Cloning in Bacillus subtilis of temperature-dependent promoter fragments from Bacillus stearothermophilus and Bacillus subtilis. FEMS Microbiol. Left. 52, 103-108. [65] Lopez, J.M. and Fortnagel, P. (1981) Nitrofurantoin prompts the stringent response in Bacillus subtilis. J. Gen. Microbiol. 126, 491-496.