- Email: [email protected]
Generation and characterization of a human induced pluripotent stem cell (iPSC) line (HEBHMUi001-A) from a sporadic Parkinson's disease patient
Stem Cell Research 36 (2019) 101417
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation and characterization of a human induced pluripotent stem cell (iPSC) line (HEBHMUi001-A) from a sporadic Parkinson's disease patient
T
⁎
Jun Maa,b,c, ,1, Ruiyun Guoa,1, Yongzhou Songa,d, Jing Zhange, Baofeng Fenga, Asiamah Ernest Amponsaha, Desheng Konga, Jingjing Hea, Wei Zhanga, Aijing Liua,d, Lin Weia, ⁎ Sanbing Shena,f, Timothy O'Briena,f, Huixian Cuia,b,c, a
Hebei Medical University-National University of Ireland Galway Stem Cell Research Center, Hebei Medical University, Hebei Province 050017, China Hebei Research Center for Stem Cell Medical Translational Engineering, Hebei Province 050017, China c Human Anatomy Department, Hebei Medical University, Hebei Province 050017, China d Second Affiliated Hospital of Hebei Medical University, China e The Fourth Hospital of Shijiazhuang, China f Regenerative Medicine Institute, National University of Ireland Galway, Galway, Ireland b
A B S T R A C T
We generated a human induced pluripotent stem cell (iPSC) line from the skin fibroblasts of a 62-year-old female patient clinically diagnosed with sporadic Parkinson's disease (PD). The generated iPSCs maintained their normal karyotype, expressed pluripotency stem cell markers, and were demonstrated to be capable of differentiating into cells representative of the three embryonic germ layers. The generated line could be used for PD modeling in order to understand the mechanisms that influence the disorder.
Resource table
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality method of reprogramming Genetic modification Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance
HEBHMUi001-A PDSHB-002
Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
Hebei Medical University, Shijiazhuang, China Jun Ma, [email protected] iPSC Human Age of patient at onset: 62 Sex of patient: female Ethnicity: N/A Skin fibroblasts Clonal Sendai virus mediated delivery of OCT3/4, SOX2, c-MYC and KLF4 No No Parkinson's disease (PD) N/A N/A N/A
N/A June 2018 https://hpscreg.eu/cell-line/HEBHMUi001-A http://kjc.hebmu.edu.cn/ Ethics Committee of Hebei Medical University approval has been obtained, HEBHMU-20190016
Resource utility Sporadic PD is a kind of neurodegenerative disease (Pajarillo et al., 2018), but PD's brain samples are difficult to acquire for research (Lebedeva and Lagarkova, 2018). The generated iPSC line can be utilized for in vitro disease modeling to study the mechanisms underlying Parkinson's disease onset and progression. Resource details A human induced pluripotent stem cell (iPSC) line was generated by reprogramming fibroblasts cultured from a skin biopsy of a patient with a sporadic form of PD (PDSHB-002, female, 62) through introduction of
⁎
Corresponding authors at: Hebei Medical University-National University of Ireland Galway Stem Cell Research Center, Hebei Medical University, Hebei Research Center for Stem Cell Medical Translational Engineering, Hebei Province 050017, China. E-mail address: [email protected] (H. Cui). 1 These authors contribute equally. https://doi.org/10.1016/j.scr.2019.101417 Received 17 January 2019; Received in revised form 2 March 2019; Accepted 6 March 2019 Available online 07 March 2019 1873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 36 (2019) 101417
J. Ma, et al.
Fig. 1. Characterization of HEBHMUi001-A iPSC cell line.
2
Stem Cell Research 36 (2019) 101417
J. Ma, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Normal Positive for pluripotency markers: NANOG, OCT4, SOX2, SSEA4, TRA-1-60, TRA-1-81 SOX2:88.1%, OCT4:87.2%,SSEA4:94.6%, TRA-1-60: 93.9% 46XX, Band resolution: 400–500 21 loci tested, all matched
Fig. 1A Fig. 1D
Genotype Identity
Photography Microscopy Qualitative analysis Immunocytochemistry Quantitative analysis Flow cytometry Karyotype (G-banding) STR analysis
Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential
N/A Mycoplasma Embryoid body formation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
N/A Mycoplasma testing by MycoSensor PCR Assay Kit. Negative Expression of TuJ (ectoderm), SMA (mesoderm) and AFP (endoderm) in iPSC-derived EBs N/A N/A N/A
Fig. 1G Fig. 1B Available with the authors N/A Fig. 1C Fig. 1E N/A N/A N/A
Mix (Sigma) after which RT-PCR was performed using a 2720 Thermal Cycler (Applied Biosystems). The cycling parameters were set as follows: 2 min at 95 °C, then 30 cycles of denaturation at 95 °C for 15 s, followed by annealing at 62 °C for SeV primers, or at 64 °C for SeVKLF4, SeV-MYC primer for 20 s, and elongation at 72 °C for 30 s. Cycles were followed by a final elongation step of 3 min at 72 °C. PCR products were resolved on 2% agarose gel and visualized with SYBR® Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific).
OCT3/4, SOX2, c-MYC and KLF4 factors using CytoTuneTM-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific). Here, one of the clones, PDSHB-002a, was further isolated and characterized (Fig. 1 and Table 1). The iPSC clones displayed typical pluripotent stem cell morphology (Fig. 1A), G-banding analysis showed a normal euploid karyotype was maintained in iPSCs (Fig. 1B), and the expanded clones were confirmed to be negative for mycoplasma (Fig. 1C). Immunofluorescent staining (Fig. 1D) and flow cytometry (Fig. 1G) revealed that the iPSCs expressed high levels of pluripotency associated markers SOX2, OCT4, NANOG, SSEA4, Tra-1-60 and Tra-1-81. Absence of viral transgenes in expanded clones was confirmed by RT-PCR after passage 12 (Fig. 1F). The pluripotency was demonstrated in vitro by embryoid body (EB)-based differentiation to endodermal, mesodermal and ectodermal cell lineages, such as ectoderm marker beta-III-tubulin (TuJ), mesoderm marker smooth muscle actin (SMA) and endoderm marker alpha-fetoprotein (AFP) (Fig. 1E). Genetic fingerprinting showed matched genetic identity of PDSHB-002a line to parental fibroblasts by using Short tandem repeat (STR) detection (available with the authors).
Embryoid body (EB) formation Embryoid bodies (EBs) were generated using AggreWell 800 24-well Plate (Stemcell Technologies) according to the manufacturer's instructions. Briefly, iPSCs were detached using Gentle Cell Dissociation Reagent and resuspended in EB medium which is composed of 80% DMEM/F12 (Life Technologies), 20% knock out serum, 1% L-glutamine, 1% nonessential amino acids (NEAA), 1% penicillin-streptomycin, 0.2% beta-mercaptoethanol (50 mM) supplemented with 10 μM Rock Inhibitor (Sigma) on AggreWell 800 24-well Plate with 1 × 106 cells per 2 mL EB medium per well, and incubating at 37 °C with 5% CO2 for 24 h. The medium was half changed at day 2. At day 4, the aggregated EBs were gently aspirated using a serological pipette, and the EB suspension was passed through a 37 μm-strainer. The strainer was then inverted and washed with 2 mL of EB medium, collecting nearly 300 EBs into a conical tube. About 40–50 EBs were subsequently plated and cultivated on 0.1% gelatine-covered 24-well plate (Sigma-Aldrich) in 2 mL of EB medium per well for additional 2–3 weeks, and medium changed every other day. Thereafter, EBs were then seeded onto a 0.1% gelatin-coated 96-well plate (Greiner Bio-One) in DMEM media containing 10% fetal bovine serum and 1% penicillin-streptomycin for subsequent spontaneous differentiation, with media changes every 2 days. After 2 weeks, the cells were fixed and stained for three germlayer markers as described in Table 2.
Materials and methods Reprogramming of skin fibroblasts The skin biopsy sample was collected from a 62-year-old female patient with a confirmed sporadic form of PD. The biopsy was cut mechanically into pieces and then seeded onto a 6-well-plate in fibroblast medium consisted of DMEM (Life Technologies) supplemented with 10% FBS (Life Technologies) and 1 × penicillin-streptomycin (Life Technologies). After 10–14 days, human skin fibroblasts began to migrate out from the tissue, and could be passaged. Fibroblasts were expanded in fibroblast medium and then reprogrammed using CytoTuneTM-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Six days after transduction, 2 × 104 cells were harvested using Accutase Solution (Sigma) and seeded onto Geltrex hESC-qualified Basement Membrane Matrix (Thermo Fisher) coated well of a six-well-plate in Essential 8™ Medium (Gibco). On day 21–28, single colonies were picked and seeded on a Geltrex-coated 24-well plate. A week after, four to six separate clones were randomly selected for further expansion. Cells were passaged every 4–6 days splitting in the ratio 1:4, using Gentle Cell Dissociation Reagent (Stemcell Technologies) and incubating at 37 °C in 5% CO2 atmosphere.
Immunocytochemistry Cells were fixed in 4% paraformaldehyde (PFA, Santa Cruz) for 10–15 min at room temperature (RT) and washed twice with PBS before being permeabilized with 0.3% Triton X-100 in PBS for 10 min, and then blocked with 5% bovine serum albumin (BSA) for 30 min at RT. After incubation with primary antibodies diluted with DPBS (Table 2) overnight at 4 °C, the cells were washed twice and incubated with the appropriate secondary antibody for 1 h at RT in the dark (Table 2). Finally, cell nuclei were stained with Hoechst33258 (1 μg/ml, Life Technologies) at RT for 5 min, washed twice, then visualized and images captured using an inverted fluorescence microscope Nikon ECLIPSE TE2000-U (Nikon, Japan).
RNA extraction and RT-PCR Total RNA was isolated from iPSCs using the RNeasy Mini Kit (Qiagen) according to manufacturer's Instructions. Complementary DNA (cDNA) was synthesized using Ready ScriptTM cDNA Synthesis 3
Stem Cell Research 36 (2019) 101417
J. Ma, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry
Pluripotency markers Pluripotency markers Pluripotency markers Pluripotency markers Pluripotency markers Pluripotency markers Pluripotency markers Pluripotency markers Differentiation markers Differentiation markers Differentiation markers Secondary antibodies Secondary antibodies Secondary antibodies Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Rabbit anti-SOX2 Rabbit anti-NANOG Rabbit anti-OCT4 Mouse anti-SSEA4 Mouse anti-Tra- 1-60 Mouse anti-Tra- 1-81 Mouse IgG, Isotype Control Rabbit IgG, Isotype Control Rabbit anti-β-III TUBULIN (TUJ) Mouse anti-SMA Rabbit anti-AFP Alexa 555 Donkey anti-mouse IgG Alexa 488 Donkey anti-rabbit IgG Alexa 488 Donkey anti-Mouse IgG Alexa 555 Donkey anti-rabbit IgG
1/200 1/200 1/200 1/200 1/200 1/200 1/200 1/200 1/500 1/200 1/200 1:500 1:500 1:500 1:500
Abcam cat# ab97959, RRID: AB_2341193 Abcam Cat# ab21624, RRID: AB_446437 Abcam Cat# ab18976, RRID:AB_444714 Abcam Cat# ab16287, RRID:AB_778073 Abcam Cat# ab16288, RRID:AB_778563 Abcam Cat# ab16289, RRID:AB_2165986 Abcam Cat# ab37355, RRID:AB_2665484 Abcam Cat# ab37415, RRID:AB_2631996 Abcam Cat# T2200, RRID:AB_10704920 Dako Cat# M0851, RRID:AB_2223500 GeneTex Cat# GTX72748, RRID:AB_374821 Thermo Fisher Scientific, Cat# A31570, RRID: AB_2536180 Thermo Fisher Scientific Cat# A-21206, RRID: AB_2535792 Thermo Fisher Scientific Cat# R37114, RRID:AB_2556542 Thermo Fisher Scientific Cat# A-31572, RRID:AB_162543
Primers Target
Forward/Reverse primer (5′-3′)
Sendai virus detection (RT-PCR)
SeV (181 bp)
Sendai virus detection (RT-PCR)
KOS (528 bp)
Sendai virus detection (RT-PCR)
KLF4 (181 bp)
Sendai virus detection (RT-PCR)
c-MYC (410 bp)
House-keeping gene (RT-PCR)
GAPDH (112 bp)
GGATCACTAGGTGATATCGAGC ACCAGACAAGAGTTTAAGAGATATGTATC ATGCACCGCTACGACGTGAGCGC ACCTTGACAATCCTGATGTGG TTCCTGCATGCCAGAGGAGCCC AATGTATCGAAGGTGCTCAA TAACTGACTAGCAGGCTTGTCG TCCACATACAGTCCTGGATGATGATG AACCATGAGAAGTATGACAAC CTTCCACGATACCAAAGTT
with 1.5 mg/ml Proteinase K. DNA fingerprinting was performed by STR profiling service at the Forensic Department of Hebei Medical University, Hebei, China.
Flow cytometry iPSCs were dissociated using Gentle cell Dissociation Reagent. For nuclear staining, cells were permeabilized with cold methanol for 20 min on ice. The cells were then incubated 30 min at room temperature with the primary antibodies against OCT4 (Abcam), SOX2 (Abcam), Tra-1-60 (Abcam), SSEA4 (Abcam), and isotype controls (Abcam) diluted with DPBS, following with a 30-min incubation of Alexa fluor Donkey-anti-Mouse or Rabbit 555 nm (Thermo Fisher Scientific) at room temperature. Finally, the cells were analyzed with a BD FACS Aria flow cytometer (BD Biosciences), and FACS data were evaluated using FlowJo software (FlowJo, LLC).
Mycoplasma detection Absence of mycoplasma contamination was confirmed by the RTPCR method using MycoSensor PCR Assay Kit (MycoSensor PCR Assay Kit, Agilent Technologies). Acknowledgments This research was supported by Hebei Medical University, and funded by Natural Science Foundation of China (81801278) and China Scholarship Council (201608130015). We appreciate the assistance from Second Affiliated Hospital of Hebei Medical University.
Karyotype analysis Following preparation of the iPSC for karyotype analysis, twenty metaphase spreads were counted and stained using standard G-banding procedures at 300–400 band resolution. Karyotyping was performed on the iPSCs averagely after 11 passages in the Department of Clinical Human Genetic Centre in the Fourth Hospital of Shijiazhuang.
References Lebedeva, O.S., Lagarkova, M.A., 2018 Sep. Pluripotent stem cells for modelling and cell therapy of Parkinson's disease. Biochemistry (Mosc) 83 (9), 1046–1056. Pajarillo, E., Rizor, A., Lee, J., Aschner, M., Lee, E., 2018 Nov. 24. The role of posttranslational modifications of α-synuclein and LRRK2 in Parkinson's disease: potential contributions of environmental factors. Biochim. Biophys. Acta Mol. basis Dis. https://doi.org/10.1016/j.bbadis.2018.11.017. (pii: S0925-4439(18)30478-2, Epub ahead of print).
DNA fingerprinting Genomic DNA was extracted from fibroblasts and iPSCs using conventional lysis buffer composed of 100 mM Tris (pH 8.0), 200 mM NaCl, 5 mM EDTA and 0.2% SDS in distilled autoclaved water supplemented
4
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation and characterization of a human induced pluripotent stem cell (iPSC) line (HEBHMUi001-A) from a sporadic Parkinson's disease patient
T
⁎
Jun Maa,b,c, ,1, Ruiyun Guoa,1, Yongzhou Songa,d, Jing Zhange, Baofeng Fenga, Asiamah Ernest Amponsaha, Desheng Konga, Jingjing Hea, Wei Zhanga, Aijing Liua,d, Lin Weia, ⁎ Sanbing Shena,f, Timothy O'Briena,f, Huixian Cuia,b,c, a
Hebei Medical University-National University of Ireland Galway Stem Cell Research Center, Hebei Medical University, Hebei Province 050017, China Hebei Research Center for Stem Cell Medical Translational Engineering, Hebei Province 050017, China c Human Anatomy Department, Hebei Medical University, Hebei Province 050017, China d Second Affiliated Hospital of Hebei Medical University, China e The Fourth Hospital of Shijiazhuang, China f Regenerative Medicine Institute, National University of Ireland Galway, Galway, Ireland b
A B S T R A C T
We generated a human induced pluripotent stem cell (iPSC) line from the skin fibroblasts of a 62-year-old female patient clinically diagnosed with sporadic Parkinson's disease (PD). The generated iPSCs maintained their normal karyotype, expressed pluripotency stem cell markers, and were demonstrated to be capable of differentiating into cells representative of the three embryonic germ layers. The generated line could be used for PD modeling in order to understand the mechanisms that influence the disorder.
Resource table
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality method of reprogramming Genetic modification Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance
HEBHMUi001-A PDSHB-002
Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
Hebei Medical University, Shijiazhuang, China Jun Ma, [email protected] iPSC Human Age of patient at onset: 62 Sex of patient: female Ethnicity: N/A Skin fibroblasts Clonal Sendai virus mediated delivery of OCT3/4, SOX2, c-MYC and KLF4 No No Parkinson's disease (PD) N/A N/A N/A
N/A June 2018 https://hpscreg.eu/cell-line/HEBHMUi001-A http://kjc.hebmu.edu.cn/ Ethics Committee of Hebei Medical University approval has been obtained, HEBHMU-20190016
Resource utility Sporadic PD is a kind of neurodegenerative disease (Pajarillo et al., 2018), but PD's brain samples are difficult to acquire for research (Lebedeva and Lagarkova, 2018). The generated iPSC line can be utilized for in vitro disease modeling to study the mechanisms underlying Parkinson's disease onset and progression. Resource details A human induced pluripotent stem cell (iPSC) line was generated by reprogramming fibroblasts cultured from a skin biopsy of a patient with a sporadic form of PD (PDSHB-002, female, 62) through introduction of
⁎
Corresponding authors at: Hebei Medical University-National University of Ireland Galway Stem Cell Research Center, Hebei Medical University, Hebei Research Center for Stem Cell Medical Translational Engineering, Hebei Province 050017, China. E-mail address: [email protected] (H. Cui). 1 These authors contribute equally. https://doi.org/10.1016/j.scr.2019.101417 Received 17 January 2019; Received in revised form 2 March 2019; Accepted 6 March 2019 Available online 07 March 2019 1873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 36 (2019) 101417
J. Ma, et al.
Fig. 1. Characterization of HEBHMUi001-A iPSC cell line.
2
Stem Cell Research 36 (2019) 101417
J. Ma, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Normal Positive for pluripotency markers: NANOG, OCT4, SOX2, SSEA4, TRA-1-60, TRA-1-81 SOX2:88.1%, OCT4:87.2%,SSEA4:94.6%, TRA-1-60: 93.9% 46XX, Band resolution: 400–500 21 loci tested, all matched
Fig. 1A Fig. 1D
Genotype Identity
Photography Microscopy Qualitative analysis Immunocytochemistry Quantitative analysis Flow cytometry Karyotype (G-banding) STR analysis
Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential
N/A Mycoplasma Embryoid body formation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
N/A Mycoplasma testing by MycoSensor PCR Assay Kit. Negative Expression of TuJ (ectoderm), SMA (mesoderm) and AFP (endoderm) in iPSC-derived EBs N/A N/A N/A
Fig. 1G Fig. 1B Available with the authors N/A Fig. 1C Fig. 1E N/A N/A N/A
Mix (Sigma) after which RT-PCR was performed using a 2720 Thermal Cycler (Applied Biosystems). The cycling parameters were set as follows: 2 min at 95 °C, then 30 cycles of denaturation at 95 °C for 15 s, followed by annealing at 62 °C for SeV primers, or at 64 °C for SeVKLF4, SeV-MYC primer for 20 s, and elongation at 72 °C for 30 s. Cycles were followed by a final elongation step of 3 min at 72 °C. PCR products were resolved on 2% agarose gel and visualized with SYBR® Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific).
OCT3/4, SOX2, c-MYC and KLF4 factors using CytoTuneTM-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific). Here, one of the clones, PDSHB-002a, was further isolated and characterized (Fig. 1 and Table 1). The iPSC clones displayed typical pluripotent stem cell morphology (Fig. 1A), G-banding analysis showed a normal euploid karyotype was maintained in iPSCs (Fig. 1B), and the expanded clones were confirmed to be negative for mycoplasma (Fig. 1C). Immunofluorescent staining (Fig. 1D) and flow cytometry (Fig. 1G) revealed that the iPSCs expressed high levels of pluripotency associated markers SOX2, OCT4, NANOG, SSEA4, Tra-1-60 and Tra-1-81. Absence of viral transgenes in expanded clones was confirmed by RT-PCR after passage 12 (Fig. 1F). The pluripotency was demonstrated in vitro by embryoid body (EB)-based differentiation to endodermal, mesodermal and ectodermal cell lineages, such as ectoderm marker beta-III-tubulin (TuJ), mesoderm marker smooth muscle actin (SMA) and endoderm marker alpha-fetoprotein (AFP) (Fig. 1E). Genetic fingerprinting showed matched genetic identity of PDSHB-002a line to parental fibroblasts by using Short tandem repeat (STR) detection (available with the authors).
Embryoid body (EB) formation Embryoid bodies (EBs) were generated using AggreWell 800 24-well Plate (Stemcell Technologies) according to the manufacturer's instructions. Briefly, iPSCs were detached using Gentle Cell Dissociation Reagent and resuspended in EB medium which is composed of 80% DMEM/F12 (Life Technologies), 20% knock out serum, 1% L-glutamine, 1% nonessential amino acids (NEAA), 1% penicillin-streptomycin, 0.2% beta-mercaptoethanol (50 mM) supplemented with 10 μM Rock Inhibitor (Sigma) on AggreWell 800 24-well Plate with 1 × 106 cells per 2 mL EB medium per well, and incubating at 37 °C with 5% CO2 for 24 h. The medium was half changed at day 2. At day 4, the aggregated EBs were gently aspirated using a serological pipette, and the EB suspension was passed through a 37 μm-strainer. The strainer was then inverted and washed with 2 mL of EB medium, collecting nearly 300 EBs into a conical tube. About 40–50 EBs were subsequently plated and cultivated on 0.1% gelatine-covered 24-well plate (Sigma-Aldrich) in 2 mL of EB medium per well for additional 2–3 weeks, and medium changed every other day. Thereafter, EBs were then seeded onto a 0.1% gelatin-coated 96-well plate (Greiner Bio-One) in DMEM media containing 10% fetal bovine serum and 1% penicillin-streptomycin for subsequent spontaneous differentiation, with media changes every 2 days. After 2 weeks, the cells were fixed and stained for three germlayer markers as described in Table 2.
Materials and methods Reprogramming of skin fibroblasts The skin biopsy sample was collected from a 62-year-old female patient with a confirmed sporadic form of PD. The biopsy was cut mechanically into pieces and then seeded onto a 6-well-plate in fibroblast medium consisted of DMEM (Life Technologies) supplemented with 10% FBS (Life Technologies) and 1 × penicillin-streptomycin (Life Technologies). After 10–14 days, human skin fibroblasts began to migrate out from the tissue, and could be passaged. Fibroblasts were expanded in fibroblast medium and then reprogrammed using CytoTuneTM-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Six days after transduction, 2 × 104 cells were harvested using Accutase Solution (Sigma) and seeded onto Geltrex hESC-qualified Basement Membrane Matrix (Thermo Fisher) coated well of a six-well-plate in Essential 8™ Medium (Gibco). On day 21–28, single colonies were picked and seeded on a Geltrex-coated 24-well plate. A week after, four to six separate clones were randomly selected for further expansion. Cells were passaged every 4–6 days splitting in the ratio 1:4, using Gentle Cell Dissociation Reagent (Stemcell Technologies) and incubating at 37 °C in 5% CO2 atmosphere.
Immunocytochemistry Cells were fixed in 4% paraformaldehyde (PFA, Santa Cruz) for 10–15 min at room temperature (RT) and washed twice with PBS before being permeabilized with 0.3% Triton X-100 in PBS for 10 min, and then blocked with 5% bovine serum albumin (BSA) for 30 min at RT. After incubation with primary antibodies diluted with DPBS (Table 2) overnight at 4 °C, the cells were washed twice and incubated with the appropriate secondary antibody for 1 h at RT in the dark (Table 2). Finally, cell nuclei were stained with Hoechst33258 (1 μg/ml, Life Technologies) at RT for 5 min, washed twice, then visualized and images captured using an inverted fluorescence microscope Nikon ECLIPSE TE2000-U (Nikon, Japan).
RNA extraction and RT-PCR Total RNA was isolated from iPSCs using the RNeasy Mini Kit (Qiagen) according to manufacturer's Instructions. Complementary DNA (cDNA) was synthesized using Ready ScriptTM cDNA Synthesis 3
Stem Cell Research 36 (2019) 101417
J. Ma, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry
Pluripotency markers Pluripotency markers Pluripotency markers Pluripotency markers Pluripotency markers Pluripotency markers Pluripotency markers Pluripotency markers Differentiation markers Differentiation markers Differentiation markers Secondary antibodies Secondary antibodies Secondary antibodies Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Rabbit anti-SOX2 Rabbit anti-NANOG Rabbit anti-OCT4 Mouse anti-SSEA4 Mouse anti-Tra- 1-60 Mouse anti-Tra- 1-81 Mouse IgG, Isotype Control Rabbit IgG, Isotype Control Rabbit anti-β-III TUBULIN (TUJ) Mouse anti-SMA Rabbit anti-AFP Alexa 555 Donkey anti-mouse IgG Alexa 488 Donkey anti-rabbit IgG Alexa 488 Donkey anti-Mouse IgG Alexa 555 Donkey anti-rabbit IgG
1/200 1/200 1/200 1/200 1/200 1/200 1/200 1/200 1/500 1/200 1/200 1:500 1:500 1:500 1:500
Abcam cat# ab97959, RRID: AB_2341193 Abcam Cat# ab21624, RRID: AB_446437 Abcam Cat# ab18976, RRID:AB_444714 Abcam Cat# ab16287, RRID:AB_778073 Abcam Cat# ab16288, RRID:AB_778563 Abcam Cat# ab16289, RRID:AB_2165986 Abcam Cat# ab37355, RRID:AB_2665484 Abcam Cat# ab37415, RRID:AB_2631996 Abcam Cat# T2200, RRID:AB_10704920 Dako Cat# M0851, RRID:AB_2223500 GeneTex Cat# GTX72748, RRID:AB_374821 Thermo Fisher Scientific, Cat# A31570, RRID: AB_2536180 Thermo Fisher Scientific Cat# A-21206, RRID: AB_2535792 Thermo Fisher Scientific Cat# R37114, RRID:AB_2556542 Thermo Fisher Scientific Cat# A-31572, RRID:AB_162543
Primers Target
Forward/Reverse primer (5′-3′)
Sendai virus detection (RT-PCR)
SeV (181 bp)
Sendai virus detection (RT-PCR)
KOS (528 bp)
Sendai virus detection (RT-PCR)
KLF4 (181 bp)
Sendai virus detection (RT-PCR)
c-MYC (410 bp)
House-keeping gene (RT-PCR)
GAPDH (112 bp)
GGATCACTAGGTGATATCGAGC ACCAGACAAGAGTTTAAGAGATATGTATC ATGCACCGCTACGACGTGAGCGC ACCTTGACAATCCTGATGTGG TTCCTGCATGCCAGAGGAGCCC AATGTATCGAAGGTGCTCAA TAACTGACTAGCAGGCTTGTCG TCCACATACAGTCCTGGATGATGATG AACCATGAGAAGTATGACAAC CTTCCACGATACCAAAGTT
with 1.5 mg/ml Proteinase K. DNA fingerprinting was performed by STR profiling service at the Forensic Department of Hebei Medical University, Hebei, China.
Flow cytometry iPSCs were dissociated using Gentle cell Dissociation Reagent. For nuclear staining, cells were permeabilized with cold methanol for 20 min on ice. The cells were then incubated 30 min at room temperature with the primary antibodies against OCT4 (Abcam), SOX2 (Abcam), Tra-1-60 (Abcam), SSEA4 (Abcam), and isotype controls (Abcam) diluted with DPBS, following with a 30-min incubation of Alexa fluor Donkey-anti-Mouse or Rabbit 555 nm (Thermo Fisher Scientific) at room temperature. Finally, the cells were analyzed with a BD FACS Aria flow cytometer (BD Biosciences), and FACS data were evaluated using FlowJo software (FlowJo, LLC).
Mycoplasma detection Absence of mycoplasma contamination was confirmed by the RTPCR method using MycoSensor PCR Assay Kit (MycoSensor PCR Assay Kit, Agilent Technologies). Acknowledgments This research was supported by Hebei Medical University, and funded by Natural Science Foundation of China (81801278) and China Scholarship Council (201608130015). We appreciate the assistance from Second Affiliated Hospital of Hebei Medical University.
Karyotype analysis Following preparation of the iPSC for karyotype analysis, twenty metaphase spreads were counted and stained using standard G-banding procedures at 300–400 band resolution. Karyotyping was performed on the iPSCs averagely after 11 passages in the Department of Clinical Human Genetic Centre in the Fourth Hospital of Shijiazhuang.
References Lebedeva, O.S., Lagarkova, M.A., 2018 Sep. Pluripotent stem cells for modelling and cell therapy of Parkinson's disease. Biochemistry (Mosc) 83 (9), 1046–1056. Pajarillo, E., Rizor, A., Lee, J., Aschner, M., Lee, E., 2018 Nov. 24. The role of posttranslational modifications of α-synuclein and LRRK2 in Parkinson's disease: potential contributions of environmental factors. Biochim. Biophys. Acta Mol. basis Dis. https://doi.org/10.1016/j.bbadis.2018.11.017. (pii: S0925-4439(18)30478-2, Epub ahead of print).
DNA fingerprinting Genomic DNA was extracted from fibroblasts and iPSCs using conventional lysis buffer composed of 100 mM Tris (pH 8.0), 200 mM NaCl, 5 mM EDTA and 0.2% SDS in distilled autoclaved water supplemented
4