Generation and characterization of recombinant bivalent fusion protein r-Cpib for immunotherapy against Clostridium perfringens beta and iota toxemia

Molecular Immunology 70 (2016) 140–148

Contents lists available at ScienceDirect

Molecular Immunology journal homepage: www.elsevier.com/locate/molimm

Generation and characterization of recombinant bivalent fusion protein r-Cpib for immunotherapy against Clostridium perfringens beta and iota toxemia Das Shreya, Saugata Majumder, Joseph J. Kingston ∗ , Harsh V. Batra Division of Microbiology, Defence Food Research Laboratory, Siddartha Nagar, Mysore 570011, India

a r t i c l e

i n f o

Article history: Received 17 September 2015 Received in revised form 30 November 2015 Accepted 1 December 2015 Keywords: Bivalent fusion protein r-Cpib Clostridium perfringens beta toxin Iota toxin Immuno therapy Toxin neutralization

a b s t r a c t Clostridium perfringens beta (CPB) and iota (CPI) toxaemias result in some of the most lethal forms of haemorrhagic and necrotic enteritis and sudden death syndrome affecting especially neonates. While CPB enterotoxemia is one of the most common forms of clostridial enterotoxemia, CPI enterotoxemia though putatively considered to be rare is an emerging cause of concern. The similarities in clinical manifestation, gross and histopathology findings of both types of toxaemias coupled to the infrequency of CPI toxaemia might lead to symptomatic misidentification with Type C resulting in therapeutic failure due to habitual administration of CPB anti-toxin which is ineffective against CPI. Therefore in the present study, to generate a composite anti-toxin capable of neutralizing both toxaemias, a novel bivalent chimera rCpib was constructed by splicing the non-toxic C terminal binding regions of CPB and CPI, via a flexible glycine linker (G4 S) by overlap-extension PCR. The fusion protein was characterized for its therapeutic abilities toward CPI and CPB toxin neutralizations. The r-Cpib was found to be non-toxic and could competitively inhibit binding of CPB to host cell receptors thereby reducing its cytotoxicity. Immunization of mice with r-Cpib generated specific antibodies capable of neutralizing the above toxaemias both in vitro and in vivo. Caco-2 cells exposed to a mixture of anti-r-Cpib sera and native CPI or CPB, displayed significantly superior protection against the respective toxins while passive challenge of mice with a similar mixture resulted in 83 and 91% protection against CPI and CPB respectively. Alternatively, mice exposed to a mixture of sham sera and native toxins died within 2–3 days. This work thus demonstrates r-Cpib as a novel bivalent fusion protein capable of efficient immunotherapy against C. perfringens CPI and CPB toxaemia. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Clostridium perfringens a normal inhabitant of the gastrointestinal tract of humans and most animals causes severe enteric infections like enteritis and enterotoxemia by rapid bacterial proliferation and toxin secretion due to intestinal pH changes brought about by sudden alterations in diet (Uzal and Songer, 2008). The pathogen is classified into 5 toxinotypes (A-E) depending on the type of toxin produced (alpha, beta, epsilon, and iota). The type C strains cause fatal haemorrhagic or necrotic enteritis common among a wide range of animals especially neonates (Uzal and Songer, 2008). Alternatively, Type E enterotoxemia though initially considered rare has been held responsible for almost 50% of fatal

∗ Corresponding author. Fax: +91 821 2473468. E-mail address: [email protected] (J.J. Kingston). http://dx.doi.org/10.1016/j.molimm.2015.12.001 0161-5890/© 2015 Elsevier Ltd. All rights reserved.

haemmorhagic enteritis syndromes reported in calves and is an emerging cause of concern (Songer and Miskimmins, 2004; ELMoez et al., 2013). Beta toxin (CPB) is regarded as a major virulence factor for both C. perfringens type C and type B strains (while epsilon toxin also exerts a synergistic effect in type B strains) and results in fatal hemorrhagic enteritis in almost all livestock, ‘Sudden Death Syndrome” in lambs (Struck), hemorrhagic diarrhea in piglets and Pigbel in humans (Songer, 1996; Uzal, 2004). CPB being sensitive to trypsin, the infection is predominantly restricted to infants due to the trypsin inhibitory activity of the colostrum and individuals with low intestinal trypsin or presence of trypsin inhibitors in the intestine (McClane et al., 2004; Vidal et al., 2008). This 35 k Da necrotizing toxin binds to endothelial cells, oligomerizes and forms pores leading to swelling and cell lysis (Miyashiro et al., 2009). Death results either due to intestinal damage and/or due to toxaemia by seepage of toxin from intestine into blood circulation

S. Das et al. / Molecular Immunology 70 (2016) 140–148

within 48 h from the appearance of initial symptoms (Nagahama et al., 2003). Type E enterotoxemia occurs primarily due to iota toxin (CPI) resulting in diarrhea, haemorrhagic enteritis, abomastis and sudden death in calves, lambs, rabbits and adult cows (McClane et al., 2004). CPI is a binary toxin consisting of a 47 k Da enzymatic component (Ia) and a 80 k Da binding component (Ib) which are not covalently linked. Once activated by trypsin, Ib binds to specific cell surface receptors, heptamerises and internalizes Ia into the cell by receptor mediated endocytosis (Marvaud et al., 2001). Inside the cell Ia results in ADP-ribosylation of actin monomers therefore preventing the formation of actin filaments required for cytoskeletal structure, consequently leading to cell rounding and death. In certain cases, Ib heptamers form pores in the cell membrane resulting in loss of ions and therefore cell death (Marvaud et al., 2001; Knapp et al., 2014). The similarities in clinical presentation (haemorrhagic enteritis and sudden death) and intestinal gross and histopathology findings upon necropsy of both Type C and Type E enterotoxemias might make it difficult for veterinarians to differentiate between the two infections (Songer and Miskimmins, 2004; Uzal and Songer, 2008). Furthermore, the infrequency/rarity of Type E enterotoxemia might lead to symptomatic misidentification with Type C resulting in therapeutic failure due to habitual administration of Type C antitoxin which is ineffective against CPI (Songer and Miskimmins, 2004). Considering the above circumstances, concurrent detection and immunotherapy against both CPB and CPI, if achieved, would help in proper management of cases. Recombinant anti-toxins and sub-unit vaccines against various C. perfringens toxins particularly alpha and epsilon toxins have been studied in detail and have been proved to be efficient in neutralizing the corresponding toxaemias (Cooper et al., 2009; Hoang et al., 2008; Chandran et al., 2010; Souza et al., 2010; Masahiro et al., 2003). However, in spite of the imperative role played by CPB and CPI in veterinary enterotoxemia, vaccines/anti-toxins against both have not been paid much attention. The present Type C veterinary and human vaccines are tailored from crude toxoids (Alpha-CDTM manufactured by Boehringer Ingelheim Vetmedica Inc., US Vet No.124), bacterins (Vision CD by Merk Animal Health, U.S. Vet Lic. No. 165A) or formalin inactivated ammonium sulphate precipitated culture supernatants and therefore contain other unnecessary components having disadvantages (Walker et al., 1979; Springer and Selbitz, 1999; Fisher et al., 2006). Furthermore, the ineffectivity of these CPB neutralizing anti-toxins and toxoid vaccines toward CPI and absence of CPI antitoxins have made CPI enterotoxemia an emerging issue of concern (Songer and Miskimmins, 2004; El-Moez et al., 2013). Therefore, in the present study, an attempt was made to generate a novel bivalent chimera by splicing the non-toxic C terminal binding regions of CPB and CPI, via overlap-extension PCR. The antibodies against the resultant chimeric protein were characterized for its CPB and CPI concurrent detection and protection capabilities.

2. Materials and methods 2.1. Animals Female 4–6 week old Specific-Pathogen-Free (SPF) BALB/c mice were acquired from Central Animal Facility, Defence Food Research Laboratory (D.F.R.L.), Mysore, India. The mice had access to food and water ad libitum and were adapted to laboratory conditions for one week before the experiments. All animal experiments in this study have been approved and performed in accordance with guidelines of Institutional Animal Ethical Committee, D.F.R.L., Mysore.

141

2.2. Bacterial strains, Cell lines and media A total of 5 C. perfringens Type C, 5 type E, 1 type A strains isolated from food, animal faeces or soil, 1 C. sporogenes strain from soil and 3 standard strains were used in the present study (Table 1). C. perfringens strains were maintained at 37 ◦ C in Reinforced Clostridial Broth. Escherichia coli DH5␣ and E. coli BL21(DE3) hosts (Invitrogen, Bangalore, India) used for cloning and expression were maintained on Luria Bertani agar/broth with necessary antibiotics. All the bacterial media were procured from Himedia, India. Caco-2 cell line was procured from National Centre for Cell Science, Pune, India. Cells were grown in Dulbecco’s Modified Eagle’s medium (DMEM) with 10% FBS, 50 units/ml penicillin, and 50 ␮g/ml streptomycin. The cells were maintained at 37 ◦ C in 5% CO2 . All the cell culture media, reagents and chemicals were purchased from Sigma–Aldrich (India), unless mentioned otherwise. 2.3. DNA, plasmid and crude native toxin extraction Genomic DNA from C. perfringens DFRCP 1 and DFRCP25 was extracted following Marmur’s (1961) protocol. For cloning experiments, pRSET A vector (Invitrogen, Bangalore, India) was used. Plasmid DNA from E. coli cells was isolated using Gen-Elute plasmid extraction kit (Sigma, Bangalore, India). Crude, wild type CPB was extracted as per Sakurai and Fujii (1987) whereas CPI was extracted according to Stiles and Wilkins (1986). Purified proteins were sterilized by 0.2 ␮m filtration and frozen in aliquots at −70 ◦ C before their use in in vitro and in vivo studies. 2.4. Construction of cpib chimeric gene All the gene sequences were retrieved from NCBI database and primers were custom synthesized from Sigma– Aldrich, Bangalore. The cpi and cpb gene fragments were spliced via a flexible glycine linker by overlap extension PCR as depicted in Fig. 1. Briefly, gene fragments spanning 1396 to 1998 bp and 759–1264 bp regions of cpi (Genbank X73562) and cpb (Genbank L13198) were PCR amplified with CPIB F + CPIB R and CPB F + CPB R primer sets respectively. In a subsequent PCR, the PCR amplicons of the previous step were modified by adding glycine linker overhangs to the 3 and 5 ends of cpi and cpb amplicons by CPIB R GLY AND CPB F GLY primers respectively followed by splicing of modified cpi and cpb (equimolar ratios) through a single primer free PCR. The spliced gene Cpib was later amplified with extreme most primers CPIN CLON F and CPB CLON R to incorporate Xho1 and Hind III restriction cites at the 5 and 3 end of the chimeric gene respectively. Except the fusion PCR, all other PCRs (Mastercycler Pro, Eppenndorf, Germany) were kept in 20 ␮l reaction volume comprising 1X pfu PCR buffer (with 2.5 mmol l−1 MgSO4 ), 0.2 mmol dNTP mix, primers 10 pmol l−1 and 1 unit pfu polymerase (Fermentas, New Delhi India). The PCRs were carried out for 30 cycles at 94 ◦ C for 1 min denaturation, 54 ◦ C for 1 min annealing and 72 ◦ C for 1 min extension with an initial denaturation of 94 ◦ C for 10 min and a final extension of 72 ◦ C for 10 min. The fusion PCR was carried out in 30 ␮l reaction volume containing 100 ng of modified cpb and cpi gene fragments each, 1X pfu PCR buffer (with 2.5 mmol l−1 MgSO4), 0.2 mmol dNTP mix and 1 unit pfu polymerase. The PCR conditions were denaturation at 94 ◦ C for 5 mins, annealing at 56 ◦ C for 1 min and extension at 72 ◦ C for 20 min. All PCR amplicons were analyzed in 1% agarose gel with ethidium bromide staining and visualized under UV–transillumination. All primers for the above PCRs are listed in Table 2. 2.5. Cloning, expression and purification of r-Cpib The chimeric gene cpib was cloned, expressed and purified as per laboratory manual by Sambrook et.al, 1989. Briefly, recombi-

142

S. Das et al. / Molecular Immunology 70 (2016) 140–148

Table 1 List of bacterial strains used in the study. S.no

Name

Toxins present

Source

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

C. perfringens DFRCP 1 C. perfringens DFRCP 3 C. perfringens DFRCP 7 C. perfringens DFRCP 12 C. perfringens DFRCP 19 C. perfringens DFRCP 25 C. perfringens DFRCP 35 C. perfringens DFRCP 47 C. perfringens DFRCP 55 C. perfringens DFRCP 62 C. perfringens DFRCP 23 C. sporogenes DFRCS 04 C. difficle ATCC 9689 B. cereus ATCC 14579 B. anthracis Sterne Strain

Beta Beta Beta Beta Beta Iota Iota Iota Iota Iota Alpha, Enterotoxin Hemorrhagic toxin Enterotoxin A and B Enterotoxin Edema and lethal toxin

Soil, Mysore Chicken, Mysore Chicken, Mysore Cattle feces, Mysore Cattle feces, Mysore Soil, Mysore Soil, Mysore Cattle feces, Mysore Mutton, Mysore Chicken, Mysore Cattle Faeces, Mysore Soil isolate, DFRL, Mysore ATCC ATCC DFRL, Mysore

Fig. 1. Construction and expression of r-Cpib (A) Schematic representation of construction of r-cpib gene through splicing by overlap extension PCR (OE-PCR). (B) Coomassie blue stained 12% SDS-PAGE of whole cell lysates of uninduced and IPTG induced E. coli cells bearing pRSET A–r-cpib plasmid. M-Marker, UI-Uninduced clone, I-Induced clone, P- Purified r-Cpib protein. (C) Western blot to confirm the expression of r-Cpib. P- Purified r-Cpib protein, M-Marker.

Table 2 List of primers used in the study. Primer

Sequence

No. of bases

Size (bp)

CPIB F CPIB R CPIB R GLY CPB F CPB R CPBF GLY CPIB CLON F CPB CLON R

5 GCTATTCAATGGGAAAAAAAGG 3 5 ATCAAGACTGTTTACAATAGAAG3 5 AGATCCTCCTCCTCCATCAAGACTGTTTACAATAGAAG3 5 GATAGTATTCCTAAAAATACAATT3 5 GCTAGCCTGGAATAGACTTGTCCTA3 5 GGAGGAGGAGGATCTGATAGTATTCCTAAAAATACAATT 3 5 GTCCCTCGAGGCTATTCAATGGGAAAAAAAGG3 5 AAGCTTGCTAGCCTGGAATAGACTTGTCCTA3

22 23 38 24 25 39 32 31

602

nant pRSET A-cpib plasmid was constructed by ligating chimeric gene Cpib and pRSET A vector individually restricted with Xho I/EcoRI. Competent E. coli BL21(DE3) cells transformed with the recombinant plasmid were PCR screened (using universal T7 forward and reverse universal primers) followed by re-inoculation of positive clones into fresh LB broth and incubation at 37 ◦ C till 0.6

473

1120

O.D. Cells were induced with 1 mM IPTG and harvested after 5 h by centrifuging at 7800 rpm for 15 min (Centrifuge 5430R, Eppendorf, Bangalore, India). Expression of the recombinant clones were examined with 12% SDS PAGE and the recombinant protein r-Cpib was purified under native conditions by Immobilized Metal Affinity Chromatography using Ni-NTA Agarose column (Qiagen, Banga-

S. Das et al. / Molecular Immunology 70 (2016) 140–148

143

Fig. 2. Membrane binding capacity of r-Cpib. (A) Coomassie blue stained 12% SDS-PAGE of r-Cpib treated Caco-2 cell supernatant of (Lane 1); Naïve Caco-2 cell pellet (Lane 2); r-Cpib treated Caco-2 cell pellet (Lane 3); purified r-Cpib (lane 4). (B) Membrane binding kinetics of r-Cpib. Residual r-Cpib in supernatant of recombinant protein treated Caco-2 cells (1 × 105 cells/well), was identified by Indirect ELISA using anti-His antibody and developed with OPD-H2 O2 . The absorbance at 492 nm was plotted against incubation time. The experiment was repeated in triplicate. (C) Competitive inhibition of cytotoxicity of native iota and beta toxins by r-Cpib. Different concentrations of recombinant protein (ranging from 0 to 100 ␮g) from stock solution of 1 mg/ml concentration were mixed with 100 ␮l of native iota and beta toxin (1C.U.) and incubated incubated for 2 h at 37 ◦ C with 5% CO2 . The percentage cell death in each treatment was measured by MTT based, in vitro toxicology assay kit (Sigma, Bangalore, India), following manufacturer’s instructions. Cells treated with PBS were considered as negative control.

lore, India) according to supplier’s protocol. The concentration of purified r-Cpib was quantified by Lowry’s method against known BSA standards and the protein was stored at -20 ◦ C until further applications.

2.6. Membrane binding assay The membrane binding capacity of r-Cpib was evaluated on Caco-2 cells. Caco-2 (1 × 105 cells/well) treated with 100 ␮l of rCpib (100 ␮g) in sterile PBS was incubated at 37 ◦ C for 6 h and centrifuged at 2500 rpm for 5 min. The presence of r-Cpib in the pellet or the supernatant of both cell lines was analysed by SDSPAGE. Also the amount of r-Cpib bound to the membranes during incubation was evaluated by indirect ELISA using hyperimmune polysera against the remaining r-Cpib in the supernatant at every 1 h intervals during the incubation time.

2.7. Competitive inhibition of cytotoxicity The ability of r-Cpib to bind competitively to Caco-2 cells in comparison to native CPI and CPB was measured indirectly by Caco2 cell cytotoxicity assay. Briefly, Caco-2 (1 × 105 cells/well) were exposed to concoctions of 0-100 ␮g of r-Cpib (from stock solution of 1 mg/ml concentration) with 100 ␮l of native CPI and CPB (1C.U.) and incubated for 2 h at 37 ◦ C with 5% CO2 . Post incubation, the percentage cell death in each treatment was measured by MTT based, in vitro toxicology assay kit (Sigma, Bangalore, India), following manufacturer’s instructions. Cells treated with PBS were considered as negative control. 2.8. Immunization schedule A group of 6 mice received sub-cutaneous (s.c.) injection of 30 ␮g r-Cpib in100 ␮l of Freund’s complete adjuvant (primary immunization) or 100 ␮l of Freund incomplete adjuvant (for booster immunizations), at 2 week intervals, for a total of 3 doses.

144

S. Das et al. / Molecular Immunology 70 (2016) 140–148

Fig. 3. Determination of r-Cpib induced anti-r-Cpib antibodies in immunized BALB/c mice. (A) Sera was collected on 0th, 14th, 28th and 42nd day from 6 r-Cpib immunized mice and total anti-r-Cpib antibodies evoked by r-Cpib immunization were assessed by indirect ELISA and end point titers were plotted. (B) Determination of CPB and CPI specific serum IgG titers in the 42nd day (1:1000th dilution) anti-r-Cpib sera. The experiments were performed in triplicates and the data are represented in mean ± SD.

Sham-immune group (n = 6) received similar volume of 1× sterile PBS (pH 7.4 ± 0.2) with adjuvant as per the above schedule. One week after each immunization, blood samples were drawn through retro-orbital plexus and the sera were collected and stored in -20 ◦ C until further use. 2.9. Indirect ELISA Reactivity of sham immune sera and anti-r-Cpib polysera with rCpib was evaluated by indirect ELISA. Briefly, each microtiter well (Maxisorp, Nunc, India) was coated with 100 ␮l of 10 ␮g ml−1 rCpib solution in coating buffer (Carbonate- bicarbonate buffer, pH 9.6). The wells were blocked with 3% BSA in 1X PBS (pH 7.4) at room temperature for 3 h. Two-fold serially diluted test sera in PBS was added to each well and incubated at 37 ◦ C for 1 h. The wells were washed thoroughly for 3 times with PBST (PBS + 0.05% Tween 20), to remove unbound antibodies and later incubated with HRP labeled polyvalent IgG antibody (Dako, Glostrup, Denmark) for 1 h at 37 ◦ C in darkness. The plate was developed with O-phenylenediamine dihydrochloride substrate with 0.04% H2 O2 . Absorbance was measured three times at a wavelength of 492 nm in 1 min intervals (Infinite M200 PRO; Tecan, Grodig, Austria). End-point titres were

Fig. 4. Reactivity of the r-Cpib hyperimmune antisera with native form of wildtype toxins by Dot-ELISA. Methanol-chloroform extracted culture supernatants of C. perfringens type C isolates DFRCP1, DFRCP3, DFRCP7 and DFRCP12, DFRCP19 (Lanes 1, 2, 3, 4 and 5 respectively); B. cereus ATCC 14579 (Lane 6); C. sporogenes ATCC 15579 (Lane 7); C. difficile ATCC 9689 (Lane 8); DFRCP 23 (Lane 9); B. anthracis Sterne (Lane 10); Positive control: r-Cpib (Lane 11); Negative control: PBS (Lanes 12&18), C. perfringens type E isolates DFRCP 25, DFRCP 35, DFRCP 47, DFRCP 55, DFRCP62 (Lanes 13, 14, 15, 16 and 17 respectively).

determined as the maximum antibody dilution whose mean O.D. was twice more than the mean O.D. value of control sera. 2.10 Dot ELISA

Fig. 5. Reactivity of the r-Cpib hyperimmune antisera with wild-type toxins. (A) Western blot analysis of CPB toxin from culture supernatants of C. perfringens type C isolates DFRCP1, DFRCP3, DFRCP7, DFRCP12 and DFRCP19 (Lanes 1, 2, 3, 4 and 5 respectively); B. cereus ATCC 14579 (Lane 6); C. sporogenes DFRCS 04 (Lane 7); C. difficile ATCC 9689 (Lane 8); DFRCP 23 (Lane 9); B. anthracis Sterne (Lane 10). (B) Western blot analysis of CPI toxin from culture supernatants of C. perfringens type E isolates DFRCP25, DFRCP35, DFRCP47, DFRCP55 and DFRCP62 (Lanes 1, 2, 3, 4 and 5 respectively); B. cereus ATCC 14579 (Lane 6); C. sporogenes DFRCS 04 (Lane 7); C. difficile ATCC 9689 (Lane 8); DFRCP 23 (Lane 9); B. anthracis Sterne (Lane 10).

S. Das et al. / Molecular Immunology 70 (2016) 140–148

145

MTT reagent in a fully confluent well by one. In the present study one C.U. was evaluated to be 50 ␮g/ml for CPB and CPI respectively. 2.12. In-vivo toxin neutralization assay

Fig. 6. Anti-cytolytic property of r-Cpae hyperimmune antisera demonstrated by Toxin Neutralization assay. Different concentrations of native CPI and CPB (C.U.) were incubated in equal volumes of 2 fold diluted anti-r-Cpib sera in saline (pH 7.4) or PBS for 1 h. All dilutions were added to 1 × 105 Caco-2 cells/well and after 4 h incubation, cell viability was determined by MTT assay. The mean percentage viability of Caco-2 cells ± SD was plotted against toxin concentration (C.U.).

For in vivo toxin neutralization assay, 0.25 ml two-fold diluted complement inactivated anti-r-Cpib sera was incubated with equal volumes of 5× LD100 dose of CPI and CPB in PBS and incubated for 1 h at 37 ◦ C. The above mixtures were administered to 2 different groups of naïve female BALB/c mice (n = 12 per group) via intra-peritoneal route (i.p.). Control groups of mice (n = 12) received toxins incubated in the sera from sham-immunized mice. The animals were monitored for morbidity and mortality for 15 days post challenge and the survival percentage in each group was represented by Kaplan–Meier Graph. The LD100 value was defined as the smallest dilution of toxin in 0.5 ml volume causing 100% lethality of mice (n = 10) within 24 h post injection. In our study, one LD100 value was found equivalent to 5.8 × 104 C.U./kg and 5 × 104 C.U./kg mouse weight for CPI and CPB, respectively. 3. Results

Methanol-chloroform extracts of culture supernatants of C. perfringens Type C, E strains, other bacterial isolates and r-Cpib (10 ␮l each) were spotted on to nitrocellulose membrane (Pall, Bangalore, India), dried and blocked with 5% skimmed milk for 30 min at 45 ◦ C. The membrane was washed thrice with PBST (PBS + 0.05% Tween 20), followed by probing with r-Cpib polysera (1/1000 diluted) for 30 min at 37 ◦ C. Unbound antibodies were washed with PBST thrice and the membrane was incubated with HRP labeled polyvalent IgG antibody (Dako, Glostrup, Denmark) for 30 min at 37 ◦ C in darkness. Finally, the membrane was washed with PBST thrice and developed with diaminobenzidene tetrahydrochloride and 0.4% H2 O2. 2.10. SDS PAGE and Western Blotting Protein samples were mixed with lysis buffer (4% w/v, SDS and 5% v/v ␤-mercaptoethanol), boiled for 5 min and analyzed by 12% SDS-PAGE in Mini PROTEAN Tetra Cell system (Bio-Rad, Hercules, CA), followed by staining in Coomassie Blue R250 for visualization. In some experiments, proteins from PAGE were transferred onto a Nitrocellulose membrane (Pall, Bangalore, India) using Mini PROTEAN Blotting system (Bio-Rad). The membranes were blocked in 5% skimmed milk for 2 h and later probed with anti r-Cpib polysera for 1 h at 37 ◦ C. The bound antibody was detected by incubating with HRP conjugated polyvalent Ig antibody (Dako) at 37 ◦ C for 1 h followed by developing with 3,3 ,5,5 -Diaminobenzidine tetrahydrochloride substrate (in 0.4% H2 O2 ). 2.11. Toxin neutralization assay The CPI and CPB neutralizing capacity of the anti r-Cpib polysera was evaluated as a function of toxin induced cytoxicity on Caco-2cells. Briefly, cells were seeded at a concentration of 1 × 105 cells/well in DMEM containing 10% FBS and appropriate antibiotics. Two fold diluted, complement inactivated, 42nd day anti r-Cpib and sham immune polysera in sterile Hanks PBS (pH 7.2) were preincubated with equal volumes of different cytotoxic units (C.U.) of crude CPI or CPB for 1 h at 37 ◦ C. Caco-2 cell monolayers were then treated with 100 ␮l mixtures of anti-r-Cpib polysera and CPB/CPI and further incubated for 4 h at 37 ◦ C under 5% CO2 . After incubation, the percentage cell viability in each treatment was measured by MTT based, in vitro toxicology assay kit (Sigma, Bangalore, India), following manufacturer’s instructions. One C.U. was considered to be the amount of toxin required to increase the absorbance of the

3.1. Construction, cloning, expression and purification of r-Cpib The r-Cpib chimera (1.12 kb) encoding 466–665 and 143–311 amino acid regions of CPI and CPB respectively was constructed by splicing the two amplicons following SOE-PCR strategy (Fig. 1A) using the primers mentioned in Table 2. The chimeric gene was cloned in E. coli BL21(DE3) and the integrity of the cloned gene in the recombinant plasmid pRSET A-r-Cpib was confirmed by sequencing. The recombinant clones were induced with 1 mM IPTG and the expression of 6X histidine tagged r-Cpib fusion protein in E. coli BL21(DE3) was confirmed by 12% SDS-PAGE analysis. The relative size of r-Cpib was in agreement with the predicted size of 42 k Da (Fig. 1B). The soluble recombinant protein was purified by immobilized metal affinity chromatography under native conditions and a concentration of 1 mg/ml r-Cpib protein was obtained and stored at −20 ◦ C until further use. 3.2. Characterization of r-Cpib 3.2.1. Toxicity The r-Cpib was found to be non-toxic in vitro as Caco-2 cells exposed to the recombinant protein did not result in any cell damage or death (Data not shown). Further, mice exposed to rCpib immunizations remained completely healthy and exhibited no signs of distress, thereby confirming the non toxicity of fusion protein in vivo. 3.2.2. Membrane binding capacity and competitive inhibition of cytotoxicity The ability of r-Cpib to bind to Caco-2 cell membranes was demonstrated by SDS PAGE analysis, wherein naïve cells and those exposed to r-Cpib showed similar protein profiles with the exception of a 42 k Da band in r-Cpib treated cells which corresponded exactly to that of purified r-Cpib (Fig. 2A). Indirect ELISA with antir-Cpib polysera for the residual recombinant protein in the supernatant of r-Cpib treated cell lines at every 1/2 h interval revealed that r-Cpib bound to Caco-2 cell membranes progressively within 2 h (Fig. 2B). Owing to the fact that r-Cpib encompasses the binding regions of CPB and CPI we next aimed to evaluate whether r-Cpib competitively inhibits the binding of native CPB and CPI to Caco2 cell membranes. For this Caco-2 cell cytotoxicity was evaluated after exposure of Caco-2 cells with mixtures containing different ratios of r-Cpib with constant concentrations of CPI and CPB respectively. No significant decrease in cell death% was observed in case of

146

S. Das et al. / Molecular Immunology 70 (2016) 140–148

Caco-2 cells treated with concoctions of r-Cpib and CPI as compared to cells treated with CPI alone (Fig. 2C). Alternatively, a progressive decrease in cell death percentage was observed with increasing concentrations of r-Cpib in the r-Cpib–CPB mixtures whereas maximum cell death was observed in cells incubated with native CPB alone (Fig. 2D). 3.2.3. Immunogenicity of r-Cpib The r-Cpib immunized BALB/c mice demonstrated a significant and progressive induction of anti-r-Cpib antibodies. Post final booster of the chimera, the end-point titres reached a final of 1: 32,000 (antilog 4.458 ± 0.3098) with comparable IgG serum titres against CPB and CPI respectively thereby demonstrating very minimal antigenic competion between the two counterparts of the chimera. In contrast, the sham immune sera did not exhibit any r-Cpib specific immunoglobulins (Fig. 3A and B). The abilty of anti-r-Cpib sera to detect wild forms of CPB and CPI was evaluated by Dot ELISA and Western blot. Proteins from culture supernatants of C. perfringens type C, type E and other bacterial isolates listed in Table. 1 were concentrated by methanolchloroform extraction and were divided into 2 equal aliquots each. One aliquot from each isolate was employed in Dot ELISA while the other aliquot was used in Western blot analysis with anti-r-Cpib hyperimmune serum as the primary antibody in both the cases. Our results demonstrated that anti-r-Cpib antibodies specifically detected both the CPB and CPI toxins in Dot ELISA alongwith the recombinant protein r-Cpib (Fig. 4) that was used as positive control. Western blot analysis revealed lucid bands at 94 k Da (CPI) and 35 k Da (CPB) for CPI and CPB positive isolates respectively (Fig. 5A and B). Our results clearly demonstrated that anti-r-Cpib sera reacted specifically with CPB and CPI without any cross-reactivity with other bacterial strains (Fig. 4, Fig. 5A and B). 3.2.4. In vitro and in vivo toxin neutralization ability of anti-r-Cpib antibodies The ability of anti-r-Cpib sera to neutralize native CPB and CPI in vitro was evaluated as a function of toxin induced cell death. Caco-2 cells incubated with sham immune sera and CPB (4.0 C.U.) resulted in 99.98% cell death whereas cells incubated with anti-r-Cpib sera and CPB resulted in only 18.78% cell death. Alternatively, 91.29% death of Caco-2 cells was observed within 2 h on incubation with sham immune sera and CPI (4.0C.U.) whereas only 11.52% cell death was observed in cells exposed to a concoction of anti-r-Cpib sera and CPI (Fig. 6). The in vivo correlates of CPI and CPB neutralization by anti-rCpib antibodies were evaluated by passive immunization studies. Majority of the animals injected with CPI or CPB along with antir-Cpib sera survived up to 15 days (10/12 for CPI and 11/12 for CPB challenge respectively), whereas all the control mice (12/12) injected with CPI or CPB along with sham immune serum succumbed to toxin challenge within 48 h (Fig. 7). The difference in the survival percentages between r-Cpib immunized and control mice was statistically significant (P**). These observations ascertained that anti-r-Cpib sera can efficiently neutralize wild type CPI and CPB under in-vitro and in-vivo conditions. 4. Discussion CPB enterotoxemia is the most common disease affecting majority of livestock mainly neonates resulting in various fatal clinical manifestations including haemorrhagic diarhhea and sudden death. On the other hand, CPI has been reported in 30% healthy and diarrheic calves and is linked with almost 50% of fatal haemorrhagic enteritis syndromes (Songer and Miskimmins, 2004) and 9% sudden death of calves (Miyashiro et al., 2009; Ferrarezi et al., 2008). Considerable percentage of CPI positive strains have also

Fig. 7. Passive protection of mice against CPI and CPB toxemia. Two groups of 4–6 week-old female BALB/c mice (n = 12 per group) were injected i.p. with CPB or CPI mixtures in anti-r-Cpib sera as described in Materials and Methods. Control groups of mice (n = 12) received CPB or CPI toxins incubated in the sera from sham-immunized mice. The animals were observed for the next 15 days for their mortality rates. Protective efficacy of r-Cpib subunit vaccine was calculated using Kaplan–Meier’s method to compare percentage survival curve. ßN- native beta toxin (CPB), Ib- native iota toxin (CPI).

been reported from other animals viz. goats,deer and peccaries, thus indicating that CPI can be potentially dangerous to animals of any age. In order to manage widespread prevalence and fatality of CPB and CPI toxaemias, development of a composite prophylactic/therapeutic intervention employing antigenic domains from both the toxins could be an appropriate strategy. Prophylactic/therapeutic intervention against multiple toxins involves administration of either a mixed-antigen cocktail (Zeng et al., 2011) or a single protein scaffold encompassing the immunogenic components from these toxins (Kolli et al., 2006; Uppalapati et al., 2014; Shreya et al., 2015). The fusion proteins have the advantage of eliciting better immunogenicity as well as elude the chances of antigenic competition observed in mixed antigen cocktails (Singh et al., 2014). Possible stearic hindrances anticipated from the individual components in fusion protein can be avoided by spacing/intercalation of the individual domains with flexible glycine linkers (Singh et al., 2014; Shreya et al., 2015). In the present approach r-Cpib chimera was constructed by rationally choosing C-terminal amino acid regions of CPB and CPI and splicing them together with a G4S linker by SOE PCR. Based on structure-functional studies it has been reported that C terminus 256–276 residues of CPB are homologous and functionally similar to 245–267 residues in C terminal binding region of staphylococal alpha haemolysin (Nagahama et al., 2003). The Tyr-266 and Leu268 in CPB are essential for membrane binding while mutation of 182 and 197th residues of CPB generates a non toxic protein capable of preventing CPB toxicity in mice (Serges et al., 2006). Therefore, the region between 143 and 311 amino acid residues (in C terminus) of CPB that includes the presumptive binding region and functional sites was chosen as one of the r-Cpib components. On the other hand, the C-terminal 466–665 residue of Ib has been confirmed to be responsible for membrane binding (Marvaud et al., 2001) and hence was chosen as the C terminal region of r-Cpib chimeric protein. The r-Cpib fusion protein was found to be highly immunogenic and it generated high titre r-Cpib specific circulating antibodies upon immunization. The fact that anti r-Cpib antibodies lucidly reacted with the native toxins and produced 35 k Da and 94 k Da bands for CPB and CPI respectively in Western blot not only confirmed the maintenance of the native epitopic structures in the fusion protein but also illustrated the ability of the antibodies to differentiately detect CPB and CPI. Furthermore, the ability of both

S. Das et al. / Molecular Immunology 70 (2016) 140–148

CPI and CPB regions of r-Cpib to elicit similar antibody response (Fig. 3B) proved the absence of antigenic competition seen in cocktail vaccines elsewhere (Hunt et al., 1994; Singh et al., 2014) and suggests that immunization with r-Cpib would be a composite immunotherapy against both the toxins. Non-toxicity to host cells and ability to neutralize the targeted toxins are the prime attributes of an efficient imunotherapeutic molecule. The fusion protein was found to be completely safe and non-toxic since it could bind to intestinal epithelial cells (Caco-2) without causing cell damage in accordance with our expectation as it was devoid of the enzymatic (Ia) component of CPI and the pore forming N-terminal region of CPB. This led us to further investigate whether r-Cpib was capable of directly competing with CPB/CPI to reduce their cytotoxicity. The fusion protein directly inhibited CPB toxicity while could not inhibit CPI induced cytotoxicity. This could possibly be due to the ability of r-Cpib to compete with the CPB receptors rather than the CPI receptors in Caco-2 cells. This made us to speculate that fusion protein r-Cpib binds to cell receptors via its CPB component and not the CPI component that could be unavailable for receptor binding during protein folding. In addition, ability of the fusion protein to bind to host cells increases the exposure time of r-Cpib to the host immune system thereby generating a strong humoral immune response. Antitoxin (antibody) therapy being the prevalent method for treating most bacterial toxaemias (Mayers et al., 2001; Keller and Stiehm, 2000; Hoang et al., 2008; Chandran et al., 2010), we evaluated the ability of anti-r-Cpib antibodies to neutralize CPI and CPB toxaemias. Caco-2 cells exposed to anti-r-Cpib serum and CPI or CPB concoction, resulted in significantly higher protection against the respective toxins and mice administered with similar concoctions exhibited reduced signs of distress with majority (83–91%) of them survived the observation period. Previous studies by Bai et al. (2006) and Zeng et al. (2011), wherein whole CPB was used in the sub unit vaccine design resulted in 91% and 93% survival of mice upon challenge with 2 × LD100 dose of CPB pre-incubated with anti ␣-␤ and CPAB2B1 antibodies respectively. Alternatively, in the present study the anti-r-Cpib antibodies could effectively neutralize 5 × LD100 doses of CPB resulting in a survival of 91% of animals. The present study therefore provides proof that incorporation of 143–311 amino acid residues of CPB containing the crucial amino acids responsible for binding (Tyr-266 and Leu-268) and toxicity (182 and 197th amino acids) is sufficient in generating protection against CPB thereby negating the use of entire CPB in therapy design. Furthermore, the ability of anti-r-Cpib sera to effectively neutralize CPI toxaemia both in in vitro cytotoxicity assays and in vivo mouse lethality assays, not only makes this the first report of a therapeutic entity for neutralizing CPI toxaemia but also confirms the efficacy of the selected region of CPI as an immunogen for efficient therapy design. The perplexity in initiating appropriate antibody therapy associated with CPI and CPB enterotoxemias could be efficiently overcome by the r-Cpib antibodies as it could neutralize both the toxins. Altogether, the non toxicity of r-Cpib, ability to competitively bind to Caco-2 cells in comparison to CPB coupled to its ability to generate highly specific hyperimmune sera capable of concurrent detection and neutralization of both CPB and CPI not only makes r-Cpib antibodies a highly proficient therapeutic entity against CPB and CPI toxaemia but also lays scope for further work to be undertaken to develop r-Cpib as an effective vaccine candidate against CPB and CPI toxaemias.

Acknowledgements S.D. is funded by Junior Research Fellowship from Defence Research and Development Organization, India. S.M. is supported

147

by Junior Research Scholarship of Lady Tata Memorial Trust, India. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molimm.2015. 12.001.

References Bai 1, J.N., Zhang, Y., Zhao, B.H., 2006. Cloning of alpha-beta fusion gene from Clostridium perfringens and its expression. World J. Gastroenterol. 12, 1229–1234. Chandran, D., Naidu, S.S., Sugumar, P., Rani, G.S., Vijayan, S.P., Mathur, D., et al., 2010. Development of a recombinant epsilon toxoid vaccine against enterotoxemia and its use as a combination vaccine with live attenuated sheep pox virus against enterotoxemia and sheep pox. Clin. Vaccine Immunol., 1013–1016. Cooper, K.K., Trinh, H.T., Songer, J.G., 2009. Immunization with recombinant alpha toxin partially protects broiler chicks against experimental challenge with Clostridium perfringens. Vet. Microbiol., 92–97. EL-Moez, S.I.A., Ata, N.S., Zaki, M.S., 2013. Bacterial causes of sudden death in farm animals. Life Sci. J. 10, 1. Ferrarezi, M.C., Cardoso, T.C., Dutra, I.S., 2008. Genotyping of Clostridium perfringens isolated from calves with neonatal diarrhoea. Anaerobe 328e, 31. Fisher, D.J., Fernandez, M.E., Sayeed, S., Poon, R., Adams, V., Rood, J.I., McClane, B.A., 2006. Dissecting the contributions of Clostridium perfringens type C toxins to lethality in the mouse intravenous injection model. Infect. Immun., 5200–5210. Hoang, T.H., Hong, H.A., Clark, G.C., Titball, R.W., Cutting, S.M., 2008. Recombinant Bacillus subtilis expressing the Clostridium perfringens alpha toxoid is a candidate orally delivered vaccine against necrotic enteritis. Infect. Immun., 5257–5265. Hunt, J.D., Jackson, D.C., Brown, L.E., Wood, P.R., Stewart, D.J., 1994. Antigenic competition in a multivalent foot rot vaccine. Vaccine 125, 457–464. Keller, M.A., Stiehm, E.R., 2000. Passive immunity in prevention and treatment of infectious diseases. Clin. Microbiol. Rev. 134, 602–614. Knapp, O., Maier, E., Waltenberger, E., Mazuet, C., Benz, R., Popoff, M.R., 2014. Residues involved in the pore-forming activity of the Clostridium perfringens iota toxin. Cell Microbiol., http://dx.doi.org/10.1111/cmi.12366. Kolli, R., Khanam, S., Jain, M., Ganju, L., Ram, M.S., Khanna, N., Swaminathan, S., 2006. A synthetic dengue virus antigen elicits enhanced antibody titers when linked to, but not mixed with, mycobacterium tuberculosis HSP70 domain II. Vaccine, 4716–4726. Marvaud, J.C., Smith,T, Hale, M.L., Popoff, M.R., Smith, L.A., Stiles, B.G., 2001. Clostridium perfringens iota-toxin: mapping of receptor binding and Ia docking domains on Ib. Infect. Immun. 69, 2435–2441. Masahiro, N., Shinya, H., Shinsuke, M., Jun, S., 2003. Biological activities and pore formation of Clostridium perfringens beta toxin in HL 60Cells. J. Biol. Chem. 1454, 36934–36941. Mayers, C.N., Holley, J.L., Brooks, T., 2001. Antitoxin therapy for botulinum intoxication. Rev. Med. Microbiol. 12 (1), 29–37. McClane, B.A., Uzal, F.A.M., Fernandez, M.A., Lyerly, D., Wilkins, T.D., 2004. Prokaryotes, 698–752. Miyashiro, S., Baldassi, L., Nassar, A.F.C., 2009. Genotyping of Clostridium perfringens associated with sudden death in cattle. J. Venom. Anim. Toxins Incl. Trop. Dis. 15 (3), 491e7. Nagahama, M., Kihara, A., Miyawaki, T., Mukai, M., Sakaguchi, Y., Ochi, S., Sakurai, J., 1999. Clostridium perfringens beta-toxin is sensitive to thiol-group modification but does not require a thiol group for lethal activity. Biochim. Biophys. Acta 1454, 97–105. Nagahama, M., Hayashi, S., Morimitsu, S., Sakurai, J., 2003. Biological activities and pore formation of Clostridium perfringens beta toxin in HL 60 cells. J. Biol. Chem. 278, 36934–36941. Sakurai, J., Fujii, Y., 1987. Purification and characterization of Clostridium perfringens beta toxin. Toxicon 25, 1301–1310. Shreya, D., Uppalapati, S.R., Kingston, J.J., Sripathy, M.H., Batra, H.V., 2015. Immunization with recombinant bivalent chimera r-Cpae confers protection against alpha toxin and enterotoxin of Clostridium perfringens type A in murine model. Mol. Immunol. 65, 51–57. Singh, A.K., Kingston, J.J., Murali, H.S., Batra, H.V., 2014. A recombinant bivalentfusion protein rVE confers active and passive protection against Yersinia enterocolitica infection in mice. Vaccine 32 (11), 1233–1239. Stiles, B.G., Wilkins, T.D., 1986. Purification and characterization of Clostridium perfringens iota toxin: dependence on two nonlinked proteins for biological activity. Infect. Immun. 54, 683–688. Songer, J.G., Miskimmins, D.W., 2004. Clostridium perfringens type E enteritis in calves: two cases and a brief review of the literature. Anaerobe 10, 239–242. Songer, J.G., 1996. Clostridial enteric diseases of domestic animals. Clin. Microbiol. Rev. 9, 216–234.

148

S. Das et al. / Molecular Immunology 70 (2016) 140–148

Souza, A.M., Reis, J.K., Assis, R.A., Horta, C.C., Siqueira, F.F., Facchin, S., et al., 2010. Molecular cloning and expression of epsilon toxin from Clostridium perfringens type D and tests of animal immunization. Genet. Mol. Res., 266–276. Springer, S., Selbitz, H.J., 1999. The control of necrotic enteritis in sucking piglets by means of a Clostridium perfringens toxoid vaccine. FEMS Immunol. Med. Microbiol. 24, 333–336. Uppalapati, S.R., Kingston, J.J., Murali, H.S., Batra, H.V., 2014. Heterologous protection against alpha toxins of Clostridium perfringens and Staphylococcus aureus induced by binding domain recombinant chimeric protein. Vaccine 32, 3075–3081. Uzal, F.A., Songer, J.G., 2008. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. J. Vet. Diagn. Invest. 20, 253–265.

Uzal, F.A., 2004. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. Anaerobe 10, 135–143. Vidal, J.E., McClane, B.A., Saputo, J., Parker, J., Uzal, F.A., 2008. Effects of Clostridium perfringens beta–toxin on the rabbit small intestine and colon. Infect. Immun. 76, 4396–4404. Walker, P.D., Foster, W.H., Knight, P.A., Freestone, D.S., Lawrence, G., 1979. Development, preparation and safety testing of a Clostridium welchii type C toxoid. I. Preliminary observations in man in Papua New Guinea. J. Biol. Stand., 315–323. Zeng, J., Deng, G., Wang, J., Zhou, J., Liu, X., Xie, Q., Wang, Y., 2011. Potential protective immunogenicity of recombinant Clostridium perfringens a-b2-b1 fusion toxin in mice, sows and cows. Vaccine 29, 5459–5466.