- Email: [email protected]
Generation of 5 hiPSC lines derived from three unrelated idiopathic Parkinson disease patients and two unrelated healthy control individuals
Stem Cell Research 41 (2019) 101640
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of 5 hiPSC lines derived from three unrelated idiopathic Parkinson disease patients and two unrelated healthy control individuals Fabiano de Araújo Tofolia, Hsin Fen Chienb, Egberto Reis Barbosab, Lygia V. Pereiraa,
T
⁎
a
National Laboratory for Embryonic Stem Cells (LaNCE), Department of Genetics and Evolutionary Biology, Biosciences Institute, University of São Paulo, SP 05508-900, Brazil b Movement Disorders Clinic Division of Neurology, Hospital das Clínicas, Faculty of Medicine, Universidade de São Paulo (HC-FMUSP), Brazil
A B S T R A C T
We describe generation of human induced pluripotent stem cell (hiPSC) lines of three unrelated idiopathic late onset Parkinson disease patients and two healthy controls above 60 years of age without neurological diseases nor Ashkenazi ancestry. Human iPSC were derived from peripheral blood-erythroblasts using integration free episomal plasmids carrying four reprogramming factors OCT4, SOX2, c-MYC, KLF4 and BCL-XL. The hiPSC lines were characterized according to established criteria.
Resource table
Unique stem cell lines identifier
Alternative names of stem cell lines
Institution
Contact information of distributor Type of cell lines Origin Cell Source Clonality Method of reprogramming Multiline rationale
Gene modification Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance
⁎
LANCEi014-A LANCEi015-A LANCEi016-A LANCEi017-A LANCEi018-A iPS-38 (iPS-PD1) iPS-39 (iPS-PD2) iPS-40 (iPS-PD3) iPS-41 (iPS-CT1) iPS-42 (iPS-CT2) National Laboratory for Embryonic Stem Cells (LaNCE), Department of Genetics and Evolutionary Biology, Biosciences Institute, University of São Paulo, Brazil Lygia V. Pereira ([email protected]) Induced pluripotent stem cell (iPSC) Human Erythroblast (peripheral blood) Pool Non-integrating episomal plasmids 3 idiopathic late onset Parkinson disease patients and 2 healthy controls above 60 years without neurological diseases nor Ashkenazi Jewish ancestry. Congenital Not applicable Parkinson Disease (#168,600) Unknown Not applicable Not applicable
Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
Not applicable June 2015 Not applicable The project was carried out in accordance with the guidelines for research on human subjects, and approved by: the Ethics Committee of the University of São Paulo (USP-CEP) Nº 112/2010 human research) and 116/2010 animal research; Departmental Board of the Genetics Department and Evolutionary Biology of Biosciences Institute (BI) - USP Nº (Order Nº: 354–2011, Meeting: 399, Item Nº: 3.2, Date: 02.03.2011); and Brazilian National Committee of Ethics in Research (CONEP) Nº 071/2013, registry nº 16.899, process 25,000.069088–2012–57.
1. Resource utility Parkinson's disease (PD, MIM #168,600) is the second most common neurodegenerative disorder characterized by progressive neuronal loss of the dopaminergic neurons in the substantia nigra (Poewe et al., 2017). The hiPSC lines described here from three idiopathic patients and two controls will contribute to the understanding of the molecular mechanisms involved in PD. 2. Resource details Peripheral blood mononuclear cells (PBMNC) were collected from three unrelated individuals with late -onset PD as previously described (Chien et al., 2014). Patients were negative for G2019S, a predominant
Corresponding author. E-mail address: [email protected] (L.V. Pereira).
https://doi.org/10.1016/j.scr.2019.101640 Received 28 May 2019; Received in revised form 14 October 2019; Accepted 24 October 2019 Available online 04 November 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 41 (2019) 101640
F.d.A. Tofoli, et al.
Table 1 Summary of lines. iPSC line names
Abbreviation in figures
Gender
Age
Ethnicity
Genotype of locus
Disease
iPS-38 iPS-39 iPS-40 iPS-41 iPS-42
PD1 PD2 PD3 CT1 CT2
Female Male Male Female Female
74 70 62 65 59
European (Caucasian) African/ South American European (Caucasian) European (Caucasian) South American/ European
Unknown Unknown Unknown Not applicable Not applicable
Idiopathic Parkinson disease Idiopathic Parkinson disease Idiopathic Parkinson disease Healthy Healthy
mutation in the leucine-rich repeat kinase −2 gene (LRRK2) reported in individuals with autosomal dominant familial PD (Tables 2 and 3). Patients were also screened for mutations in the GBA gene a risk factor for PD. They were also negative for the 3 most common mutations in GBA in the Brazilian population (N370S, L444P and G377S) and for the E326K mutation, identified in PD patients in Brazil, and therefore were considered idiopathic PD patients (Fig S1D, Tables 2 and 3) (Spitz et al., 2008). PBMNC from two healthy unrelated controls above 60 years of age and without neurological diseases nor Ashkenazi Jewish ancestry were also collected and reprogrammed (Table 1). Samples were reprogrammed into hiPSC using 3 episomal non integrative episomal plasmids encoding human OCT4, SOX2, KLF4, cMYC and BCL-XL (Chou et al., 2015) (Table 2). iPSC colonies were identified based on morphology, pooled, expanded, characterized and cryopreserved. To confirm cell line identity, short tandem repeat (STR) analysis was performed in hiPSCs and the corresponding PBMNCs (archived at journal). Genomic integration of plasmids was evaluated by PCR amplification of vector-derived sequences (Fig 1C). Normal diploid karyotypes of the hiPSC lines were confirmed using SNP-array (Fig S1B). Pluripotency was confirmed by immunofluorescence for OCT4, SOX2 and SSEA4 (Fig. 1A, Tables 2 and 3) and flow cytometry for OCT4, SOX2, and NANOG (Fig. S1A, Tables 2 and 3). Mycoplasm tests showed all iPSC samples were free of contamination (Fig S1C, Table 2). Embryoid bodies (EB) formation assay was performed to verify the spontaneous differentiation into three germ layers. Differentiation capacity was confirmed by evaluation of the expression of markers of 3 germ layers at mRNA level by TaqMan Scorecard (Fig 1B) and RT-PCR
for TaqMan probes: NES (Ectodermal), DES (Mesodermal) and AFP (Endodermal) (data not show). Presence of GBA mutations N370S, L444P, G377S and E326K, and of LRRK2 mutation G2019S was analyzed by RFLP as described (Spitz et al., 2008; Chien et al., 2014) (Fig S1D). After DNA amplification by PCR, products were digested with the respective restriction enzymes and separated in agarose gel. Bands corresponding to mutant alleles (N370S: 90 and 16 bp; L444P: 554 and 193 bp; G377S: 64 and 42 bp; E326K: 166 and 135 bp; G2019S: 207 bp in red, Figure S1D) were detected in homozygote and heterozygote controls (Figure S1D). Normal alleles (N370S and G377S: 106 bp; L444P: 747 bp; E326K: 272 bp; G2019S: 228 and 101 bp; in blue, Figure S1D) were detected in heterozygote and normal (+/+) controls (Figure S1D). All PD and normal control samples analyzed showed only bands corresponding to normal alleles, confirming absence of the mutations tested (Figure S1D). 3. Materials and methods 3.1. GBA mutations and G2019S Parkinson mutation analyses Buccal swabs (mouth mucus) and peripheral blood samples were collected. Genomic DNA (gDNA) was extracted from buccal swabs according Spitz et al., 2008. The gDNA of iPCS were extract with QIAamp DNA Mini Kit (Qiagen, USA) according to manufactures instructions. The GBA mutations (N370S, L444P, G377S and E326K) were analyzed by RFLP as described Spitz et al., 2008 and G2019S according Chien et al., 2014) (Tables 2 and 3). After endonuclease digestion
Table 2 Characterization and validation. Classification
Test
Result
Data
Morphology
Photography
Normal ES-like morphology
Phenotype
Qualitative analysis: Immunofluorescence Quantitative analysis:Flow cytometry
Expression of pluripotency markers: OCT4, SSEA-4 and SOX2. All expressing.
Not shown but available with author Fig. 1 panel A
Genotype
All positive cells above 87% for pluripotency antigen markers: NANOG, OCT3/4 and SOX2. Not analyzed All passed
Fig. S1 panel A
Microsatellite PCR (mPCR) OR STR analysis
all loci matched,16 STRs analyzed: D8S1179, AMEL, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D19S433, D16S539, FGA, vWA, D2S1338, TPOX, D18S51, D5S818,
Archived at journal
Restriction fragment length polymorphism (RFLP) Sequencing Southern Blot OR WGS Mycoplasm Qualitative analysis: Embryoid body formation (RT-PCR) Quantitative analysis: TaqMan EB Scorecard HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping
All negative to: - GBA mutations: N370S, L444P, G377S, E326K LRRK2mutation: G2019S Not analyzed Not analyzed Mycoplasm performed by MycoScope PCR Assay Kit. All negative. all positive for gene expression of differentiation markers: NES (Ectodermal), DES(Mesodermal) and AFP (Endodermal) Performed in iPSC-derived EBs. Passed
Fig. S1 panel D
Not analyzed Not analyzed
Not analyzed
Not analyzed
Not analyzed
Karyotype (G-banding) and resolution SNP Array
Not analyzed Fig. S1 panel B
Identity
Mutation analysis
Microbiology and virology Differentiation potential
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Not analyzed HLA tissue typing
2
Not analyzed Not analyzed Figure S1 panel C Not shown but available with author Fig. 1 panel B
Stem Cell Research 41 (2019) 101640
F.d.A. Tofoli, et al.
Fig. 1. iPSC cell lines characterization.
at a 1:3 ratio when reaching 80% confluence (every 5–7 days).
(Table 3), the PCR products fragmented were analyzed using agarose gel (2% - L444P or 4% - N370S, G377S, E326K and G2019S) electrophoresis with negative and positives controls.
3.3. STR analyses Genomic DNA was extracted from PBMCs and hiPSCs using QiaAmp DNA Extraction Kit (Qiagen). To confirm the reprogrammed cells identity, STR genotyping analysis of hiPSCs and the corresponding PBMNCs were performed using 50 ng of genomic DNA amplified with Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) and AmpFlSTR® Identifiler® Plus PCR Amplification kit (Applied Biosystems) following manufacturer´s instructions. Sixteen STR loci (D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, AMEL, D5S818, FGA) were amplified and resulting fragments were analyzed with the GeneMapper® software (Applied Biosystems) (Archived at journal).
3.2. Reprogramming PBMC-derived erythroblasts Mononuclear cells (MNCs) were isolated from 16 ml of peripheral blood by Ficoll gradient (BD Vacutainer® CPT™ Cell Preparation Tube with Sodium Citrate - BD 362760) and cryoprezerved in 90% FBS (Thermo Fisher Scientific, USA) and 10% DMSO (Sigma Aldrich). Human iPSC lines were derived from erythroblasts with episomal vectors as described (Tofoli et al., 2016). Briefly, MNCs samples were thawed and were cultured with serum-free mononuclear cell (MNC) medium containing cytokines to select and expand erythroblasts in a humidified incubator at 37 °C, 5% CO2. Erytroblasts were transfected with plasmids MMK (expressing c-MYC and KLF4), MOS (expressing OCT4 and SOX2) and MBX (expressing only human BCL-XL) (Addgene) (Chou et al., 2015). After nucleoporation, cells were incubated for 24 h in suspension with MNC medium and 0.25 mM Sodium Butyrate (NaB, Sigma Aldrich). Cells were then seeded on Geltrex (Thermo Fisher Scientific) with MEF medium and FBS ES-Cell Qualified (ESQ, Thermo Fisher Scientific) plus bFGF (20 ng/ml - R&D Systems) overnight. MEF medium was changed to essential E8 medium with 0.25 mM NaB. Clones were pooled and cells were expanded for three passages. Cells were cryoprezerved in 90% FBS ES-Cell Qualified (ESQ, Thermo Fisher Scientific), 10% DMSO HybriMax (Sigma-Aldrich). Human iPSCs were thawed in Geltrex-coated 6-well plates with Essential E8 medium and 10 μM ROCK inhibitor (Y-27632). Subsequent passages were done using Versene cell dissociation reagent (Thermo Fisher Scientific), Gentle Cell Dissociation Reagent (Stem Cell Technologies) or Accutase (BD Biosciences) with Essential E8 medium and 10 μM Y-27632. Cells were split
3.4. Mycoplasm contamination Mycoplasm contamination tests were performed using the MycoScope PCR Detection kit (Genlantis, San Diego, CA) following manufacturer's recommendations. Positive (CT+) and negative (CT-) controls were included. All samples scored negative (Fig. S1C). 3.5. Episomal plasmid DNA integration analysis Absence of vector integration hiPSC lines was confirmed by PCR analysis of genomic DNA as described (Chou et al., 2015). Briefly, genomic DNA was extracted from cells at passage 5 using a QiaAmp DNA Extraction Kit (Qiagen). Primers for the Epstein–Barr nuclear antigen 1 (EBNA1) gene region of the pCEP4 vector were used to amplify 3
According Manufacturer
Mouse anti-NANOG-PE Conjugated
4 NES Length: 81 bp AFP Length: 82 bp DES Length: 86 bp GAPDH Length: 58 bp HPRT1 Length: 82 bp
TaqMan Probes Differentiation Markers (RT-PCR) House-Keeping Genes
GCCTTTGTCCTTACCCTCG/ACg AAA GTT ACg CAC CCA ATT
G377S Length: 106 bp
Hs00707120_s1 Hs00173490_m1 Hs01090875_m1 Hs03929097_g1 Hs02800695_m1
TTTTGATGCTTGACATAGTGGAC/CACATCTgAggTCAgTggTTA TC
ACAAATTAGCTGGGTGTGGC/TAAgCTCACACTggCCCTgC TGTGCAAGGTCCAGGATCAG/gAggTCTgCTTTgCAggAAg
GBA Exon 8 E326K Length: 301 bp
G2019S: Length: 329 bp
ACGAAAGTTACGCACCCAATT/TTA CCA TCA Agg ATC CTg
L444P Length: 747 bp
Parkinson mutations analysis (RFLP genotyping)
TTTAATACGATTGAGGGCGTCT/GGTTTTGAAGGATGCGATTAAG GCCTTTGTCCTTACCCTCG/ACg AAA GTT ACg CAC CCA ATT
EBNA1 Length: 244 bp N370S Length: 106 bp
Not Not Not Not Not
applicable applicable applicable applicable applicable
Sfe I
PvuII
Nested PCR BbsI or BpiI
NciI
Not applicable XhoI
Enzyme
Not Not Not Not Not
applicable applicable applicable applicable applicable
228 bp 101 bp
272 bp 29 bp 106 bp
747 bp
Not applicable 106 bp
Normal Length
166 bp 135 bp 64 bp 42 bp 207 bp 101 bp 21 bp Not applicable Not applicable Not applicable Not applicable Not applicable
Not applicable 90 bp 16 bp 554 bp 193 bp
Mutant Length
Millipore cat# MAB MAB4401, RRID: AB_2,167,852 StemGent cat# 09–0006, RRID: AB_1,512,169 Abcam cat# AB22572, RRID: AB_2,341,193 Thermofisher Scientific Cat# A11001, RRID: AB_2,534,069 Thermofisher Scientific Cat#A-12,012, RRID: AB_2,534,079 BD Biosciences Cat# 560,589, Human Pluripotent Stem Cell Transcription Factor Analysis Kit, RRID: AB_2,722,505 BD Biosciences Cat# 560,589, Human Pluripotent Stem Cell Transcription Factor Analysis Kit, RRID: AB_2,722,505 BD Biosciences Cat# 560,589, Human Pluripotent Stem Cell Transcription Factor Analysis Kit, RRID: AB_2,722,505
Company Cat # and RRID
Forward/Reverse primer (5′−3′)
According Manufacturer
Mouse anti-SOX2-Alexa 647 Conjugated
Target
1:100 1:100 1:100 1:500 1:500 According Manufacturer
Dilution
Mouse anti-OCT4 Mouse anti-SSEA4 Rabbit anti-SOX2 Alexa Fluor 488 Goat anti-mouse IgG (H + L) Alexa Fluor 594 Goat anti-rabbit IgG (H + L) Mouse anti-OCT3/4-PerCP-Cy5.5 Conjugated
Episomal plasmids (PCR) - MBX, MOS, MMK Plasmids GBA mutations analyses (RFLP genotyping)
Primers
Pluripotency markers (Flow Cytometry)
Secondary antibodies (immunocytochemistry)
Pluripotency markers (immunocytochemistry)
Antibodies used for immunocytochemistry/flow-cytometry Antibody
Table 3 Reagents details.
F.d.A. Tofoli, et al.
Stem Cell Research 41 (2019) 101640
Stem Cell Research 41 (2019) 101640
F.d.A. Tofoli, et al.
expression of markers of the three embryonic germ layers, confirming their pluripotency (Fig. 1B). Undifferentiated hiPSC were used as negative control (data available upon request).
hiPSC DNA. DNA from reprogramming plasmids were used as positive (CT+MBX, CT+MMK, CT+MOS) and water as negative (CT-) controls (Fig 1C). All cell lines scored negative for the presence of plasmid DNA (Fig 1C).
3.11. Embryoid body - RT-PCR 3.6. Analysis of genomic integrity (SNP array) SNP-array karyotyping of hiPSCs was performed by Life&Brain (Germany) using DNA from undifferentiated cells at passage 10 and the HumanOmniExpressExome v1.3 DNA Analysis BeadChip (Illumina) to confirm genomic integrity (Figure S1B). No aneuploidies, deletions/ insertions were detected. Note that this method does not detect balanced translocations.
Analysis of spontaneous differentiation in three germ layers was confirmed by RT-PCR. One ug of EB´s RNA were used for reverse transcriptase reactions using High Capacity cDNA kit (Life Technologies). Three pairs of primers were used to verify germ layers markers NES (Ectoderm), DES (Mesoderm) and AFP (Endoderm); and 2 to house-keeping genes GAPDH and HPRT1. PCR products were analyzed in 2% agarose gel (data available upon request).
3.7. Immunocytochemistry/Assessment of pluripotency (immunostaining)
3.12. Research ethics committee
Cells at passages 15 and 22 were fixed with 4% paraformaldehyde/ 4% sucrose, permeabilized with 0.5% Triton X100 and blocked with 2% BSA/0,2% Tween-20. Incubations with diluted primary antibodies (1:100) against OCT4, SOX2 and SSEA4 were performed for 1 h at 37 °C. Nuclei were stained with Hoeschst. Images were acquired with a confocal microscopy High Content Imaging InCell Analyzer 2200 (GE Healthcare Life Sciences) and analyzed with ImageJ software (https:// imagej.nih.gov/ij/) (Fig. 1A, scale bar 75 μm). Immunofluorescence for TRA-1–81, TRA-1-60, cMYC, SOX1 and SSEA3 was also performed (data available upon request).
The project was submitted to the Ethics Committee in Research of the University of São Paulo (USP-CEP) and approved for human research (Protocol: 112/2010). It was also approved by the Departmental Board of the Genetics Department and Evolutionary Biology of Biosciences Institute (BI) - USP (Order Nº: 354-2011, Meeting: 399, Item Nº: 3.2, Date: 02.03.2011; by CEP Hemorio (Project No. 251/ 11,Date:03/15/2011); and by Brazilian National Committee of Ethics in Research (CONEP) - 071/2013, registry nº 16.899, process 25000.069088-2012-57. Acknowledgements
3.8. Flow cytometry This work was supported by: Fundação de Amparo à Pesquisa do Estado de São Paulo (2013/08135-2; 2014/25487-3); Conselho Nacional de Desenvolvimento Científico e Tecnológico Departamento de Ciência e Tecnologia do Ministério da Saúde (CNPq/MS/DECIT); Banco Nacional de Desenvolvimento Econômico e Social (BNDES); Financiadora de Estudos e Projetos (FINEP); and Sanofi/Genzyme Corporation (Gaucher Generation 2010 grant program, GZ-201110731). We are grateful to Linzhao Cheng and Sarah Dowey for iPSC reprogramming support; Mariana Morato Marques, Raquel Serafian, Juliana Borsoi Sant´ana and Luis Ernesto Farinha for assistance with iPSC characterization.
Reprogrammed cells were harvested by Accutase, fixed/permeabilized according to BD Cytofix/Cytoperm kit (BD Pharmingen™), and then labeled using Human Pluripotent Stem Cell Transcription Factor Analysis Kit (BD Biosciences) according to the manufacturer's instructions. Cells were incubated with human monoclonal antibodies specific to OCT3/4-PerCP-Cy5.5 and SOX2-Alexa647 and NANOG-PE pluripotency markers (Table 3) and corresponding isotype controls. Fifty thousand events were acquired in BD Accuri C6 flow cytometer using the kit template. Cells were gated on light scatter properties and analyzed using BD Accuri C6 software (BD Biosciences) (Fig S1A). 3.9. Embryoid body - in vitro differentiation
Supplementary materials To demonstrate spontaneous in vitro differentiation, hiPSC were grown to 70–80% confluence. Colony fragments were harvested by dispase (Thermo Fisher Scientific cat. n. 17105-032) and transferred to non-tissue culture treated 6-well plates coated with 1% agarose with Essential E8 medium. At day 5, embryoid bodies (EBs) were transferred to a 6-well plate coated with 0.1% gelatin, and cultured for 16 days in differentiation medium (DMEM, 20% FBS ESQ, 2 mM L-glutamax, MEM-NEAA 2 mM, 0.1 mM β-mercaptoethanol, 1% HEPES, 1% Sodium piruvate. 1% penicillin-streptomicin (Thermo Fisher Scientific).
Supplementary material associated with this article can be found, in the online version, at 10.1016/j.scr.2019.101640. References Chien, H.F., Figueiredo, T.R., Hollaender, M.A., Tofoli, F., Takada, L.T., Pereira, L., da, V., Barbosa, E.R., 2014. Frequency of the LRRK2 G2019S mutation in late-onset sporadic patients with Parkinson's disease. Arq. Neuropsiquiatr. 72, 356–359. Chou, B.-.K., Gu, H., Gao, Y., Dowey, S.N., Wang, Y., Shi, J., Li, Y., Ye, Z., Cheng, T., Cheng, L., 2015. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl. Med. 4, 320–332. https://doi.org/10.5966/ sctm.2014-0214. Poewe, W., Seppi, K., Tanner, C.M., Halliday, G.M., Brundin, P., Volkmann, J., Schrag, A.-.E., Lang, A.E., 2017. Parkinson disease. Nat. Rev. Dis. Prim. 3, 17013. https://doi. org/10.1038/nrdp.2017.13. Spitz, M., Rozenberg, R., Pereira, L., da, V., Reis Barbosa, E., 2008. Association between Parkinson's disease and glucocerebrosidase mutations in Brazil. Parkinsonism Relat. Disord. 14, 58–62. https://doi.org/10.1016/j.parkreldis.2007.06.010. Tofoli, F.A., Dasso, M., Morato-Marques, M., Nunes, K., Pereira, L.A., da Silva, G.S., Fonseca, S.A.S., Costas, R.M., Santos, H.C., da Costa Pereira, A., Lotufo, P.A., Bensenor, I.M., Meyer, D., Pereira, L.V., 2016. Increasing the genetic admixture of available lines of human pluripotent stem cells. Sci. Rep. 6, 34699. https://doi.org/ 10.1038/srep34699.
3.10. Embryoid body - TaqMan hPSC scorecard Differentiated cells were harvested with Trizol and RNA extraction was performed using RNeasy kit (Qiagen) followed by DNaseI treatment. One µg of RNA was used for subsequent reverse transcriptase reactions using High Capacity cDNA kit (Life Technologies). Pluripotency and trilineage differentiation potential was assessed using the TaqMan® hPSC Scorecard™ kit 384 wells (cat nº A15872) following manufacturer's instructions and run on a StepOne Plus System (Thermo Fisher Scientific). Data analysis was performed using the cloud the TaqMan® hPSC Scorecard analysis software. All samples presented high
5
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of 5 hiPSC lines derived from three unrelated idiopathic Parkinson disease patients and two unrelated healthy control individuals Fabiano de Araújo Tofolia, Hsin Fen Chienb, Egberto Reis Barbosab, Lygia V. Pereiraa,
T
⁎
a
National Laboratory for Embryonic Stem Cells (LaNCE), Department of Genetics and Evolutionary Biology, Biosciences Institute, University of São Paulo, SP 05508-900, Brazil b Movement Disorders Clinic Division of Neurology, Hospital das Clínicas, Faculty of Medicine, Universidade de São Paulo (HC-FMUSP), Brazil
A B S T R A C T
We describe generation of human induced pluripotent stem cell (hiPSC) lines of three unrelated idiopathic late onset Parkinson disease patients and two healthy controls above 60 years of age without neurological diseases nor Ashkenazi ancestry. Human iPSC were derived from peripheral blood-erythroblasts using integration free episomal plasmids carrying four reprogramming factors OCT4, SOX2, c-MYC, KLF4 and BCL-XL. The hiPSC lines were characterized according to established criteria.
Resource table
Unique stem cell lines identifier
Alternative names of stem cell lines
Institution
Contact information of distributor Type of cell lines Origin Cell Source Clonality Method of reprogramming Multiline rationale
Gene modification Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance
⁎
LANCEi014-A LANCEi015-A LANCEi016-A LANCEi017-A LANCEi018-A iPS-38 (iPS-PD1) iPS-39 (iPS-PD2) iPS-40 (iPS-PD3) iPS-41 (iPS-CT1) iPS-42 (iPS-CT2) National Laboratory for Embryonic Stem Cells (LaNCE), Department of Genetics and Evolutionary Biology, Biosciences Institute, University of São Paulo, Brazil Lygia V. Pereira ([email protected]) Induced pluripotent stem cell (iPSC) Human Erythroblast (peripheral blood) Pool Non-integrating episomal plasmids 3 idiopathic late onset Parkinson disease patients and 2 healthy controls above 60 years without neurological diseases nor Ashkenazi Jewish ancestry. Congenital Not applicable Parkinson Disease (#168,600) Unknown Not applicable Not applicable
Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
Not applicable June 2015 Not applicable The project was carried out in accordance with the guidelines for research on human subjects, and approved by: the Ethics Committee of the University of São Paulo (USP-CEP) Nº 112/2010 human research) and 116/2010 animal research; Departmental Board of the Genetics Department and Evolutionary Biology of Biosciences Institute (BI) - USP Nº (Order Nº: 354–2011, Meeting: 399, Item Nº: 3.2, Date: 02.03.2011); and Brazilian National Committee of Ethics in Research (CONEP) Nº 071/2013, registry nº 16.899, process 25,000.069088–2012–57.
1. Resource utility Parkinson's disease (PD, MIM #168,600) is the second most common neurodegenerative disorder characterized by progressive neuronal loss of the dopaminergic neurons in the substantia nigra (Poewe et al., 2017). The hiPSC lines described here from three idiopathic patients and two controls will contribute to the understanding of the molecular mechanisms involved in PD. 2. Resource details Peripheral blood mononuclear cells (PBMNC) were collected from three unrelated individuals with late -onset PD as previously described (Chien et al., 2014). Patients were negative for G2019S, a predominant
Corresponding author. E-mail address: [email protected] (L.V. Pereira).
https://doi.org/10.1016/j.scr.2019.101640 Received 28 May 2019; Received in revised form 14 October 2019; Accepted 24 October 2019 Available online 04 November 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 41 (2019) 101640
F.d.A. Tofoli, et al.
Table 1 Summary of lines. iPSC line names
Abbreviation in figures
Gender
Age
Ethnicity
Genotype of locus
Disease
iPS-38 iPS-39 iPS-40 iPS-41 iPS-42
PD1 PD2 PD3 CT1 CT2
Female Male Male Female Female
74 70 62 65 59
European (Caucasian) African/ South American European (Caucasian) European (Caucasian) South American/ European
Unknown Unknown Unknown Not applicable Not applicable
Idiopathic Parkinson disease Idiopathic Parkinson disease Idiopathic Parkinson disease Healthy Healthy
mutation in the leucine-rich repeat kinase −2 gene (LRRK2) reported in individuals with autosomal dominant familial PD (Tables 2 and 3). Patients were also screened for mutations in the GBA gene a risk factor for PD. They were also negative for the 3 most common mutations in GBA in the Brazilian population (N370S, L444P and G377S) and for the E326K mutation, identified in PD patients in Brazil, and therefore were considered idiopathic PD patients (Fig S1D, Tables 2 and 3) (Spitz et al., 2008). PBMNC from two healthy unrelated controls above 60 years of age and without neurological diseases nor Ashkenazi Jewish ancestry were also collected and reprogrammed (Table 1). Samples were reprogrammed into hiPSC using 3 episomal non integrative episomal plasmids encoding human OCT4, SOX2, KLF4, cMYC and BCL-XL (Chou et al., 2015) (Table 2). iPSC colonies were identified based on morphology, pooled, expanded, characterized and cryopreserved. To confirm cell line identity, short tandem repeat (STR) analysis was performed in hiPSCs and the corresponding PBMNCs (archived at journal). Genomic integration of plasmids was evaluated by PCR amplification of vector-derived sequences (Fig 1C). Normal diploid karyotypes of the hiPSC lines were confirmed using SNP-array (Fig S1B). Pluripotency was confirmed by immunofluorescence for OCT4, SOX2 and SSEA4 (Fig. 1A, Tables 2 and 3) and flow cytometry for OCT4, SOX2, and NANOG (Fig. S1A, Tables 2 and 3). Mycoplasm tests showed all iPSC samples were free of contamination (Fig S1C, Table 2). Embryoid bodies (EB) formation assay was performed to verify the spontaneous differentiation into three germ layers. Differentiation capacity was confirmed by evaluation of the expression of markers of 3 germ layers at mRNA level by TaqMan Scorecard (Fig 1B) and RT-PCR
for TaqMan probes: NES (Ectodermal), DES (Mesodermal) and AFP (Endodermal) (data not show). Presence of GBA mutations N370S, L444P, G377S and E326K, and of LRRK2 mutation G2019S was analyzed by RFLP as described (Spitz et al., 2008; Chien et al., 2014) (Fig S1D). After DNA amplification by PCR, products were digested with the respective restriction enzymes and separated in agarose gel. Bands corresponding to mutant alleles (N370S: 90 and 16 bp; L444P: 554 and 193 bp; G377S: 64 and 42 bp; E326K: 166 and 135 bp; G2019S: 207 bp in red, Figure S1D) were detected in homozygote and heterozygote controls (Figure S1D). Normal alleles (N370S and G377S: 106 bp; L444P: 747 bp; E326K: 272 bp; G2019S: 228 and 101 bp; in blue, Figure S1D) were detected in heterozygote and normal (+/+) controls (Figure S1D). All PD and normal control samples analyzed showed only bands corresponding to normal alleles, confirming absence of the mutations tested (Figure S1D). 3. Materials and methods 3.1. GBA mutations and G2019S Parkinson mutation analyses Buccal swabs (mouth mucus) and peripheral blood samples were collected. Genomic DNA (gDNA) was extracted from buccal swabs according Spitz et al., 2008. The gDNA of iPCS were extract with QIAamp DNA Mini Kit (Qiagen, USA) according to manufactures instructions. The GBA mutations (N370S, L444P, G377S and E326K) were analyzed by RFLP as described Spitz et al., 2008 and G2019S according Chien et al., 2014) (Tables 2 and 3). After endonuclease digestion
Table 2 Characterization and validation. Classification
Test
Result
Data
Morphology
Photography
Normal ES-like morphology
Phenotype
Qualitative analysis: Immunofluorescence Quantitative analysis:Flow cytometry
Expression of pluripotency markers: OCT4, SSEA-4 and SOX2. All expressing.
Not shown but available with author Fig. 1 panel A
Genotype
All positive cells above 87% for pluripotency antigen markers: NANOG, OCT3/4 and SOX2. Not analyzed All passed
Fig. S1 panel A
Microsatellite PCR (mPCR) OR STR analysis
all loci matched,16 STRs analyzed: D8S1179, AMEL, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D19S433, D16S539, FGA, vWA, D2S1338, TPOX, D18S51, D5S818,
Archived at journal
Restriction fragment length polymorphism (RFLP) Sequencing Southern Blot OR WGS Mycoplasm Qualitative analysis: Embryoid body formation (RT-PCR) Quantitative analysis: TaqMan EB Scorecard HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping
All negative to: - GBA mutations: N370S, L444P, G377S, E326K LRRK2mutation: G2019S Not analyzed Not analyzed Mycoplasm performed by MycoScope PCR Assay Kit. All negative. all positive for gene expression of differentiation markers: NES (Ectodermal), DES(Mesodermal) and AFP (Endodermal) Performed in iPSC-derived EBs. Passed
Fig. S1 panel D
Not analyzed Not analyzed
Not analyzed
Not analyzed
Not analyzed
Karyotype (G-banding) and resolution SNP Array
Not analyzed Fig. S1 panel B
Identity
Mutation analysis
Microbiology and virology Differentiation potential
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Not analyzed HLA tissue typing
2
Not analyzed Not analyzed Figure S1 panel C Not shown but available with author Fig. 1 panel B
Stem Cell Research 41 (2019) 101640
F.d.A. Tofoli, et al.
Fig. 1. iPSC cell lines characterization.
at a 1:3 ratio when reaching 80% confluence (every 5–7 days).
(Table 3), the PCR products fragmented were analyzed using agarose gel (2% - L444P or 4% - N370S, G377S, E326K and G2019S) electrophoresis with negative and positives controls.
3.3. STR analyses Genomic DNA was extracted from PBMCs and hiPSCs using QiaAmp DNA Extraction Kit (Qiagen). To confirm the reprogrammed cells identity, STR genotyping analysis of hiPSCs and the corresponding PBMNCs were performed using 50 ng of genomic DNA amplified with Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) and AmpFlSTR® Identifiler® Plus PCR Amplification kit (Applied Biosystems) following manufacturer´s instructions. Sixteen STR loci (D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, AMEL, D5S818, FGA) were amplified and resulting fragments were analyzed with the GeneMapper® software (Applied Biosystems) (Archived at journal).
3.2. Reprogramming PBMC-derived erythroblasts Mononuclear cells (MNCs) were isolated from 16 ml of peripheral blood by Ficoll gradient (BD Vacutainer® CPT™ Cell Preparation Tube with Sodium Citrate - BD 362760) and cryoprezerved in 90% FBS (Thermo Fisher Scientific, USA) and 10% DMSO (Sigma Aldrich). Human iPSC lines were derived from erythroblasts with episomal vectors as described (Tofoli et al., 2016). Briefly, MNCs samples were thawed and were cultured with serum-free mononuclear cell (MNC) medium containing cytokines to select and expand erythroblasts in a humidified incubator at 37 °C, 5% CO2. Erytroblasts were transfected with plasmids MMK (expressing c-MYC and KLF4), MOS (expressing OCT4 and SOX2) and MBX (expressing only human BCL-XL) (Addgene) (Chou et al., 2015). After nucleoporation, cells were incubated for 24 h in suspension with MNC medium and 0.25 mM Sodium Butyrate (NaB, Sigma Aldrich). Cells were then seeded on Geltrex (Thermo Fisher Scientific) with MEF medium and FBS ES-Cell Qualified (ESQ, Thermo Fisher Scientific) plus bFGF (20 ng/ml - R&D Systems) overnight. MEF medium was changed to essential E8 medium with 0.25 mM NaB. Clones were pooled and cells were expanded for three passages. Cells were cryoprezerved in 90% FBS ES-Cell Qualified (ESQ, Thermo Fisher Scientific), 10% DMSO HybriMax (Sigma-Aldrich). Human iPSCs were thawed in Geltrex-coated 6-well plates with Essential E8 medium and 10 μM ROCK inhibitor (Y-27632). Subsequent passages were done using Versene cell dissociation reagent (Thermo Fisher Scientific), Gentle Cell Dissociation Reagent (Stem Cell Technologies) or Accutase (BD Biosciences) with Essential E8 medium and 10 μM Y-27632. Cells were split
3.4. Mycoplasm contamination Mycoplasm contamination tests were performed using the MycoScope PCR Detection kit (Genlantis, San Diego, CA) following manufacturer's recommendations. Positive (CT+) and negative (CT-) controls were included. All samples scored negative (Fig. S1C). 3.5. Episomal plasmid DNA integration analysis Absence of vector integration hiPSC lines was confirmed by PCR analysis of genomic DNA as described (Chou et al., 2015). Briefly, genomic DNA was extracted from cells at passage 5 using a QiaAmp DNA Extraction Kit (Qiagen). Primers for the Epstein–Barr nuclear antigen 1 (EBNA1) gene region of the pCEP4 vector were used to amplify 3
According Manufacturer
Mouse anti-NANOG-PE Conjugated
4 NES Length: 81 bp AFP Length: 82 bp DES Length: 86 bp GAPDH Length: 58 bp HPRT1 Length: 82 bp
TaqMan Probes Differentiation Markers (RT-PCR) House-Keeping Genes
GCCTTTGTCCTTACCCTCG/ACg AAA GTT ACg CAC CCA ATT
G377S Length: 106 bp
Hs00707120_s1 Hs00173490_m1 Hs01090875_m1 Hs03929097_g1 Hs02800695_m1
TTTTGATGCTTGACATAGTGGAC/CACATCTgAggTCAgTggTTA TC
ACAAATTAGCTGGGTGTGGC/TAAgCTCACACTggCCCTgC TGTGCAAGGTCCAGGATCAG/gAggTCTgCTTTgCAggAAg
GBA Exon 8 E326K Length: 301 bp
G2019S: Length: 329 bp
ACGAAAGTTACGCACCCAATT/TTA CCA TCA Agg ATC CTg
L444P Length: 747 bp
Parkinson mutations analysis (RFLP genotyping)
TTTAATACGATTGAGGGCGTCT/GGTTTTGAAGGATGCGATTAAG GCCTTTGTCCTTACCCTCG/ACg AAA GTT ACg CAC CCA ATT
EBNA1 Length: 244 bp N370S Length: 106 bp
Not Not Not Not Not
applicable applicable applicable applicable applicable
Sfe I
PvuII
Nested PCR BbsI or BpiI
NciI
Not applicable XhoI
Enzyme
Not Not Not Not Not
applicable applicable applicable applicable applicable
228 bp 101 bp
272 bp 29 bp 106 bp
747 bp
Not applicable 106 bp
Normal Length
166 bp 135 bp 64 bp 42 bp 207 bp 101 bp 21 bp Not applicable Not applicable Not applicable Not applicable Not applicable
Not applicable 90 bp 16 bp 554 bp 193 bp
Mutant Length
Millipore cat# MAB MAB4401, RRID: AB_2,167,852 StemGent cat# 09–0006, RRID: AB_1,512,169 Abcam cat# AB22572, RRID: AB_2,341,193 Thermofisher Scientific Cat# A11001, RRID: AB_2,534,069 Thermofisher Scientific Cat#A-12,012, RRID: AB_2,534,079 BD Biosciences Cat# 560,589, Human Pluripotent Stem Cell Transcription Factor Analysis Kit, RRID: AB_2,722,505 BD Biosciences Cat# 560,589, Human Pluripotent Stem Cell Transcription Factor Analysis Kit, RRID: AB_2,722,505 BD Biosciences Cat# 560,589, Human Pluripotent Stem Cell Transcription Factor Analysis Kit, RRID: AB_2,722,505
Company Cat # and RRID
Forward/Reverse primer (5′−3′)
According Manufacturer
Mouse anti-SOX2-Alexa 647 Conjugated
Target
1:100 1:100 1:100 1:500 1:500 According Manufacturer
Dilution
Mouse anti-OCT4 Mouse anti-SSEA4 Rabbit anti-SOX2 Alexa Fluor 488 Goat anti-mouse IgG (H + L) Alexa Fluor 594 Goat anti-rabbit IgG (H + L) Mouse anti-OCT3/4-PerCP-Cy5.5 Conjugated
Episomal plasmids (PCR) - MBX, MOS, MMK Plasmids GBA mutations analyses (RFLP genotyping)
Primers
Pluripotency markers (Flow Cytometry)
Secondary antibodies (immunocytochemistry)
Pluripotency markers (immunocytochemistry)
Antibodies used for immunocytochemistry/flow-cytometry Antibody
Table 3 Reagents details.
F.d.A. Tofoli, et al.
Stem Cell Research 41 (2019) 101640
Stem Cell Research 41 (2019) 101640
F.d.A. Tofoli, et al.
expression of markers of the three embryonic germ layers, confirming their pluripotency (Fig. 1B). Undifferentiated hiPSC were used as negative control (data available upon request).
hiPSC DNA. DNA from reprogramming plasmids were used as positive (CT+MBX, CT+MMK, CT+MOS) and water as negative (CT-) controls (Fig 1C). All cell lines scored negative for the presence of plasmid DNA (Fig 1C).
3.11. Embryoid body - RT-PCR 3.6. Analysis of genomic integrity (SNP array) SNP-array karyotyping of hiPSCs was performed by Life&Brain (Germany) using DNA from undifferentiated cells at passage 10 and the HumanOmniExpressExome v1.3 DNA Analysis BeadChip (Illumina) to confirm genomic integrity (Figure S1B). No aneuploidies, deletions/ insertions were detected. Note that this method does not detect balanced translocations.
Analysis of spontaneous differentiation in three germ layers was confirmed by RT-PCR. One ug of EB´s RNA were used for reverse transcriptase reactions using High Capacity cDNA kit (Life Technologies). Three pairs of primers were used to verify germ layers markers NES (Ectoderm), DES (Mesoderm) and AFP (Endoderm); and 2 to house-keeping genes GAPDH and HPRT1. PCR products were analyzed in 2% agarose gel (data available upon request).
3.7. Immunocytochemistry/Assessment of pluripotency (immunostaining)
3.12. Research ethics committee
Cells at passages 15 and 22 were fixed with 4% paraformaldehyde/ 4% sucrose, permeabilized with 0.5% Triton X100 and blocked with 2% BSA/0,2% Tween-20. Incubations with diluted primary antibodies (1:100) against OCT4, SOX2 and SSEA4 were performed for 1 h at 37 °C. Nuclei were stained with Hoeschst. Images were acquired with a confocal microscopy High Content Imaging InCell Analyzer 2200 (GE Healthcare Life Sciences) and analyzed with ImageJ software (https:// imagej.nih.gov/ij/) (Fig. 1A, scale bar 75 μm). Immunofluorescence for TRA-1–81, TRA-1-60, cMYC, SOX1 and SSEA3 was also performed (data available upon request).
The project was submitted to the Ethics Committee in Research of the University of São Paulo (USP-CEP) and approved for human research (Protocol: 112/2010). It was also approved by the Departmental Board of the Genetics Department and Evolutionary Biology of Biosciences Institute (BI) - USP (Order Nº: 354-2011, Meeting: 399, Item Nº: 3.2, Date: 02.03.2011; by CEP Hemorio (Project No. 251/ 11,Date:03/15/2011); and by Brazilian National Committee of Ethics in Research (CONEP) - 071/2013, registry nº 16.899, process 25000.069088-2012-57. Acknowledgements
3.8. Flow cytometry This work was supported by: Fundação de Amparo à Pesquisa do Estado de São Paulo (2013/08135-2; 2014/25487-3); Conselho Nacional de Desenvolvimento Científico e Tecnológico Departamento de Ciência e Tecnologia do Ministério da Saúde (CNPq/MS/DECIT); Banco Nacional de Desenvolvimento Econômico e Social (BNDES); Financiadora de Estudos e Projetos (FINEP); and Sanofi/Genzyme Corporation (Gaucher Generation 2010 grant program, GZ-201110731). We are grateful to Linzhao Cheng and Sarah Dowey for iPSC reprogramming support; Mariana Morato Marques, Raquel Serafian, Juliana Borsoi Sant´ana and Luis Ernesto Farinha for assistance with iPSC characterization.
Reprogrammed cells were harvested by Accutase, fixed/permeabilized according to BD Cytofix/Cytoperm kit (BD Pharmingen™), and then labeled using Human Pluripotent Stem Cell Transcription Factor Analysis Kit (BD Biosciences) according to the manufacturer's instructions. Cells were incubated with human monoclonal antibodies specific to OCT3/4-PerCP-Cy5.5 and SOX2-Alexa647 and NANOG-PE pluripotency markers (Table 3) and corresponding isotype controls. Fifty thousand events were acquired in BD Accuri C6 flow cytometer using the kit template. Cells were gated on light scatter properties and analyzed using BD Accuri C6 software (BD Biosciences) (Fig S1A). 3.9. Embryoid body - in vitro differentiation
Supplementary materials To demonstrate spontaneous in vitro differentiation, hiPSC were grown to 70–80% confluence. Colony fragments were harvested by dispase (Thermo Fisher Scientific cat. n. 17105-032) and transferred to non-tissue culture treated 6-well plates coated with 1% agarose with Essential E8 medium. At day 5, embryoid bodies (EBs) were transferred to a 6-well plate coated with 0.1% gelatin, and cultured for 16 days in differentiation medium (DMEM, 20% FBS ESQ, 2 mM L-glutamax, MEM-NEAA 2 mM, 0.1 mM β-mercaptoethanol, 1% HEPES, 1% Sodium piruvate. 1% penicillin-streptomicin (Thermo Fisher Scientific).
Supplementary material associated with this article can be found, in the online version, at 10.1016/j.scr.2019.101640. References Chien, H.F., Figueiredo, T.R., Hollaender, M.A., Tofoli, F., Takada, L.T., Pereira, L., da, V., Barbosa, E.R., 2014. Frequency of the LRRK2 G2019S mutation in late-onset sporadic patients with Parkinson's disease. Arq. Neuropsiquiatr. 72, 356–359. Chou, B.-.K., Gu, H., Gao, Y., Dowey, S.N., Wang, Y., Shi, J., Li, Y., Ye, Z., Cheng, T., Cheng, L., 2015. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl. Med. 4, 320–332. https://doi.org/10.5966/ sctm.2014-0214. Poewe, W., Seppi, K., Tanner, C.M., Halliday, G.M., Brundin, P., Volkmann, J., Schrag, A.-.E., Lang, A.E., 2017. Parkinson disease. Nat. Rev. Dis. Prim. 3, 17013. https://doi. org/10.1038/nrdp.2017.13. Spitz, M., Rozenberg, R., Pereira, L., da, V., Reis Barbosa, E., 2008. Association between Parkinson's disease and glucocerebrosidase mutations in Brazil. Parkinsonism Relat. Disord. 14, 58–62. https://doi.org/10.1016/j.parkreldis.2007.06.010. Tofoli, F.A., Dasso, M., Morato-Marques, M., Nunes, K., Pereira, L.A., da Silva, G.S., Fonseca, S.A.S., Costas, R.M., Santos, H.C., da Costa Pereira, A., Lotufo, P.A., Bensenor, I.M., Meyer, D., Pereira, L.V., 2016. Increasing the genetic admixture of available lines of human pluripotent stem cells. Sci. Rep. 6, 34699. https://doi.org/ 10.1038/srep34699.
3.10. Embryoid body - TaqMan hPSC scorecard Differentiated cells were harvested with Trizol and RNA extraction was performed using RNeasy kit (Qiagen) followed by DNaseI treatment. One µg of RNA was used for subsequent reverse transcriptase reactions using High Capacity cDNA kit (Life Technologies). Pluripotency and trilineage differentiation potential was assessed using the TaqMan® hPSC Scorecard™ kit 384 wells (cat nº A15872) following manufacturer's instructions and run on a StepOne Plus System (Thermo Fisher Scientific). Data analysis was performed using the cloud the TaqMan® hPSC Scorecard analysis software. All samples presented high
5