- Email: [email protected]
Cas9 editing
Stem Cell Research 39 (2019) 101494
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of a FMR1 homozygous knockout human embryonic stem cell line (WAe009-A-16) by CRISPR/Cas9 editing Subhajit Giria, Meera Purushottamb, Biju Viswanathb, Ravi S. Muddashettya, a b
T
⁎
Institute for Stem Cell Science and Regenerative Medicine (INSTEM), Bengaluru, India Molecular genetics and ADBS laboratory, Department of Psychiatry, National Institute of Mental Health and Neuro Sciences (NIMHANS), Bengaluru, India
A B S T R A C T
Mutations in FMR1 gene is the cause of Fragile X Syndrome (FXS) leading inherited cause of intellectual disability and autism spectrum disorders. FMR1 gene encodes Fragile X Mental Retardation Protein (FMRP) which is a RNA binding protein and play important role in synaptic plasticity and translational regulation in neurons. We have generated a homozygous FMR1 knockout (FMR1-KO) hESC line using CRISPR/Cas9 based genome editing. It created a homozygous 280 nucleotide deletion at exon1, removing the start codon. This FMR1-KO cell line maintains stem cell like morphology, pluripotency, normal karyotype and ability to in-vitro differentiation.
Resource utility Here, we have generated a homozygous FMR1 knock-out human embryonic stem cell (hESC) line. This is an in-vitro hESC model and differentiated neurons from it will provide opportunity to study the biological roles of FMRP towards neuronal development, synaptic plasticity, synaptic signalling and regulation of activity mediated protein synthesis in human stem cell model. Resource details Fragile X-syndrome (FXS) is caused by expansion of CGG trinucleotide repeats at 5′ UTR of FMR1 gene and leads to epigenetic silencing and complete loss of FMRP expression (Verkerk et al., 1991). FMRP, a polyribosome-associated RNA binding protein, plays a central role in neuronal development and synaptic plasticity through multifaceted regulatory function for mRNA translation (D'Souza et al., 2018; Muddashetty et al., 2007). To provide a robust and well characterized in-vitro cell model to scientific community, we have created a homozygous FMR1-KO hESC line in female background (H9, 46, XX) by using the CRISPR/Cas9 gene editing targeting FMR1 exon 1 (Fig. 1A, the Cas9/sgRNA target sequence is indicated by red color followed by PAM sequence in blue color, the start codon ATG is indicated as increased font size). The H9 hESCs were nucleofected with lentiCRISPRv.2 (Addgene 52,961) containing a sgRNA sequence targeting exon 1 of FMR1 gene. Positively transfected cells were selected against puromycin treatment. The puromycin resistant single cell derived clones were picked up and
⁎
expanded. Genomic DNA was isolated from each clones and genotyping was done using PCR followed by Sanger sequencing with primer pair amplifying exon 1 and flanking sequences (listed in Table 2). Among several edited clones, we have identified one clone having 280 nucleotides deletion at exon 1 removing the start codon and the entire 5’ UTR (Fig. 1B, Supplementary Fig. 1). The deletion is confirmed by TOPO-TA cloning of the PCR fragment flanking the entire deletion region followed by Sanger sequencing which is displayed using CRISP-ID algorithm (Dehairs et al., 2016) to annotate the nucleotide position spanning the entire deletion. This FMR1-KO cell line (H9-FMR1−/− (C93) and mentioned henceforth as C93) was expanded for further characterization and validation (Table 1). The successful knock-out of FMR1 was validated by immunoblotting for FMRP in triplicate at different passage numbers (P14, P15 and P17), where the C93 ESCs were devoid of FMRP protein at cellular level (Fig. 1C). Immunoblotting for FMRP was done The C93 cells preserve the characteristic tightly packaged hESC morphology (Fig. 1D) and express high level of pluripotency markers evidenced by immunostaining for OCT4, NANOG and SSEA-4 (Fig. 1E, scale bar 50 μm). Genomic integrity was confirmed by G-banding karyotype analysis and shown that C93 has a normal female karyotype (Fig. 1F). Expression of pluripotency genes (OCT4, NANOG, SOX2 and GDF3) has been analyzed by qRT-PCR. The expressions of these genes are comparable to the parental H9 cell line except for SOX2, which shows a higher expression in C93 cells (Fig. 1G, error bar indicates ± SEM, n = 3). This observation was previously reported where SOX2 was over-expressed in Fmr1 knock-down mouse ESCs (Khalfallah et al., 2017) hence it could be an effect of absence of FMRP, SOX2 mRNA expression or stability.
Corresponding author at: Institute for Stem Cell Science and Regenerative Medicine, GKVK Post, Bellary Road, Bengaluru 560065, India. E-mail address: [email protected] (R.S. Muddashetty).
https://doi.org/10.1016/j.scr.2019.101494 Received 27 March 2019; Received in revised form 5 June 2019; Accepted 26 June 2019 Available online 28 June 2019 1873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 39 (2019) 101494
S. Giri, et al.
Fig. 1. Generation and functional characterization of FMR1 homozygous knockout embryonic stem cell line WAe009-A-16.
2
Stem Cell Research 39 (2019) 101494
S. Giri, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Microbiology and virology
Photography Immunocytochemistry Quantitative analysis Immunocytochemistry counting, RT-qPCR Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis Sequencing Southern Blot OR WGS Mycoplasma
Fig. 1 panel D Fig. 1 panel E Fig. 1 panel E Fig. 1 panel G Fig. 1 panel F N/A Submitted in archive with journal Fig. 1 panel B N/A Fig. 1 panel H
Differentiation potential
Embryoid body formation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Normal OCT4, NANOG, SSEA-4 positive 97% (958 out of 993 cells) positive for OCT4 96% (859 out of 896 cells) positive for NANOG 46 XX, Resolution 450–500 N/A 10/10 sites matched Homozygous deletion for 280 bp in FMR1 exon1 N/A Mycoplasma testing by luminescence. Negative for mycoplasma Expression of three germ layer markers genes – Ectoderm: SOX1, PAX6 Endoderm: FOXA2 Mesoderm: MSX1, TBXT N/A N/A N/A
Genotype Identity Mutation analysis (IF APPLICABLE)
Fig. 1 panel I
N/A N/A N/A
transfection with mTeSR1 supplemented with 0.5 μg/ml of puromycin (Sigma). Puromycin selection was continued for 72 h with everyday media change and then the single cell derived colonies were expanded for another 8 days. Colonies were manually picked up and seeded in 96well culture dish (Corning) and cultured until confluency. Each colony was passaged to make duplicate, where one batch was maintained and another was subjected to genotyping.
Targeted Sanger sequencing was done for the occurrence of any mutation/indel at potential non-specific target sites and confirmed to be negative (Supplementary Fig. 2). Luminescence based mycoplasma detection assay confirmed that C93 cell line is devoid of any mycoplasma infection (Fig. 1H). Cell type identity was validated by CODIS specified STR analysis for 10 loci (archived with journal). The ability for in-vitro differentiation of C93 was done by embryoid body (EB) formation followed by expression analysis of three germ layer markers (SOX1, PAX6 for ectoderm; FOXA2 for endoderm and MSX1, TBXT for mesoderm) carried out by qRT-PCR and compared with expression levels of the same transcripts in H9 hESC (Fig. 1I). It has also been shown that most of the differentiation markers expression is significantly upregulated (2-way ANOVA with Sidak's test, * - p < .05, ** - p < .01, **** - p < .0001, ns - p > .05). In summary, we have generated an FMR1 homozygous knockout hESC cell line, which preserved normal karyotype and full pluripotency with the ability to differentiate to three germ layers. This cell line will be a valuable resource to study the biological importance of FMRP at cellular level.
Genotyping and sequence analysis Genomic DNA was extracted from each colony using 50 μl of QuickExtract™ DNA Extraction Solution (Lucigen) for each well of 96well plate following manufacturer's protocol. PCR was done for genotyping using Taq DNA polymerase (Qiagen) with Q-solution and 2.5% glycerol as PCR additive with a condition of 7 min hot-start and 68 °C – 58 °C touch-down at 2 °C ramp down. Purified PCR amplicons were sequenced using BigDye® Terminator v3.1 sequencing kit (Applied Biosystems) and 3130XL Genetic Analyser (Applied Biosystems). Sequence chromatograms were viewed and analyzed with SnapGene Viewer (GSL Biotech) software. Primer sequences used for PCR and sequencing are provided in Table 2.
Materials and methods Cell culture
Mycoplasma detection The human embryonic stem cell line H9 was cultured on Matrigel (Corning) coated plates (Corning) using mTeSR1 media (StemCell Technologies) under standard condition (37 °C, humidified air with 5% CO2). At around 80% confluency, cells were split for next passage using Collagenase-Trypsin-KOSR (CTK) solution.
Standard testing for mycoplasma detection was done using MycoAlert™ Mycoplasma Detection Kit (Lonza) following the manufacturer's protocol. Luminescence ratio < 1 was considered as negative for mycoplasma infection.
Gene editing with CRISPR/Cas9 methodology
Karyotyping and STR analysis
CRISPR sgRNA were designed using ‘CCTop’ online server (https:// crispr.cos.uni-heidelberg.de/), targeting the start codon of FMR1 gene (NG_007529.2). Synthesized sgRNA was cloned into lentiCRISPRv.2 plasmid containing SpCas9-P2A-Puromycin and U6-driven sgRNA cassette. The successful sgRNA/Cas9 construct was purified by EndoFree® Plasmid Maxi Kit (Qiagen). The H9 cells were dissociated as single cell using Accutase® solution (Sigma) and 0.8 million cells were nucleofected with 3 μg of sgRNA/Cas9 plasmid. Nucleofection was done using P3 Primary Cell 4D-Nucleofector® X Kit (Lonza) and Amaxa® 4DNucleofector® (Lonza) following the manufacturer's protocol. Immediately after nucleofection, cells were plated on matrigel coated 6well culture plate with a density of 135,000 cells/well using prewarmed mTeSR1 media with 10 μM ROCK-inhibitor (Y-27632) (Sigma). After 24 h, cells were subjected to puromycin selection for positive
The G-banding karyotyping was performed at Anand Diagnostic Laboratory Services, Bangalore. At least, 20 metaphase chromosome spreads were analyzed with a G-band resolution of 450–550 and the results were reported by experienced cytogeneticist. The H9 and WAe009-A-16 cell line were authenticated by STR analysis for the AMEL, CSF1PO, D13S317, D16S539, D21S11, D5S818, D7S820, TH01, TPOX and vWA loci. Immunocytochemistry and western blot Cells were grown on matrigel coated glass coverslips in a 12-well culture dish and fixed with 4% PFA solution, permeabilized, blocked and incubated with antibodies (listed in Table 2). Nuclear counterstaining was done with DAPI (Sigma) and Mowiol® 4–88 solution 3
Stem Cell Research 39 (2019) 101494
S. Giri, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
FMRP (Western Blot) α-Tubulin (Western Blot) Pluripotency markers (Immunofluorescence) Pluripotency markers (Immunofluorescence) Pluripotency markers (Immunofluorescence) Secondary antibodies Secondary antibodies Secondary antibodies Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Rabbit anti-FMRP Mouse anti-α tubulin Mouse anti-OCT-3/4 (C10) Rabbit anti-NANOG Mouse anti-SSEA-4 Goat anti-Mouse IgG (H + L) HRP conjugated Goat anti-Rabbit IgG Alexa Fluor 488 goat anti-mouse IgG (H + L) Alexa Fluor 555 goat anti-rabbit IgG (H + L)
1:1000 1: 5000 1:500 1: 500 1: 250 1: 5000 1: 5000 1: 500 1: 500
Abcam Cat# ab17722, RRID:AB_2278530 Sigma-Aldrich Cat# T9026, RRID:AB_477593 Santa Cruz Biotechnology Cat# sc-5279, RRID:AB_628051 PeproTech Cat# 500-P236-100μg, RRID:AB_1268274 BioLegend Cat# 330401, RRID:AB_1089209 Thermo Fisher Scientific Cat# 31430, RRID:AB_228307 Sigma-Aldrich Cat# A0545, RRID:AB_257896 Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069 Thermo Fisher Scientific Cat# A27039, RRID:AB_2536100
Primers
Pluripotency Markers (qPCR) Pluripotency Markers (qPCR) Pluripotency Markers (qPCR) Pluripotency Markers (qPCR) Differentiation Markers (qPCR) Differentiation Markers (qPCR) Differentiation Markers (qPCR) Differentiation Markers (qPCR) Differentiation Markers (qPCR) House-Keeping Genes (qPCR) FMR1-exon1-sgRNA Targeted mutation analysis/sequencing Non-specific target site 1 (PCR/sequencing) Non-specific target site 2 (PCR/sequencing) Non-specific target site 3 (PCR/sequencing) Non-specific target site 4 (PCR/sequencing) Non-specific target site 5 (PCR/sequencing) Non-specific target site 6 (PCR/sequencing)
Target
Forward/Reverse primer (5′-3′)
OCT4 NANOG SOX2 GDF3 SOX1 PAX6 FOXA2 MSX1 TBXT GAPDH FMR1 exon 1 FMR1 exon1 ESAM C19orf45 COL6A3 SCN5A SLC2A11 SYNCRIP
CCCCAGGGCCCCATTTTGGTACC/ACCTCAGTTTGAATGCATGGGAGAGC AAAGAATCTTCACCTATGCC/GAAGGAAGAGGAGAGACAGT TTCACATGTCCAGCACTACCAGA/TCACATGTGTGAGAGGGGCAGTGTGC TGACCATCTCCCTCAACAGC/TACCCACACCCACACTCATC AATACTGGAGACGAACGCCG/CCTCTCGCCTCGTTTTGACT CTGAGGAATCAGAGAAGACAGGC/ATGGAGCCAGATGTGAAGGAGG GAACACCACTACGCCTTCAAC/AGTGCATCACCTGTTCGTAGGC TCCGCAAACACAAGACGA/ACTGCTTCTGGCGGAACTT TATGAGCCTCGAATCCACATAGT/CCTCGTTCTGATAAGCAGTCAC GCTCAGACACCATGGGGAAGG/GGAATTTGCCATGGGTGGAATC CACCGAGAGAAGATGGAGGAGCTGG/AAACCCAGCTCCTCCATCTTCTCTC CCAAACCAAACCAAACCAAAC/TGTGCATTCCTGAATTTACCC GCTCCGTGAATGTGCAAGAC/CTTCCCCAGCCACAGTGT GAAAGGCTAAATCCCACCCC/GAGGAGCCAAAGAAGGAGG GGATACCCACGAAGAAATTCCA/AGAGCATTTCCTTCTAGCCCC CTCCTACGAGCCCATCACC/GGCTGGTTTGTGACTGACTG GGCAGAGAGAGAGACACACA/CAGCTCCCAGTCCCGATG GCGGGAGAGAGAAAGAGAGG/CCAGCTCACTCCACAATGTC
markers, random hexamer and SuperScript™ III Reverse Transcriptase (Invitrogen) in a 20 μl reaction volume. qPCR was done using 1 μl of cDNA sample and TB Green™ Premix Ex Taq™ (TaKaRa) on a CFX384™ Real-Time PCR Detection Systems (BioRad).
(Sigma) was used as mounting media. Images were acquired with IX73 Fluorescence microscope (Olympus). Images were processed and analyzed with ImageJ software. For western blot, 350 μl of cell lysis buffer (50 mM Tris-Cl, 150 mM NaCl, 5 mM MgCl2, 1% NP-40, 1 mM DTT and 1× Protease inhibitor) was used for each cell line cultured in 35 mm culture dish. Cell lysates were centrifuged at 12000g for 30 min at 4 °C and collected in a fresh tube. Protein samples from 25 μl of cell lysates were separated by SDSPAGE, transferred onto PVDF membrane (Milipore) and probed with antibodies indicated in Table 2. Images were acquired with Amersham™ Imager 600 (GE Healthcare) and analyzed with ImageJ software.
Key resources table
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Embryoid body (EB) formation and in-vito differentiation assay The EB formation was performed following the previously reported protocol (Wei et al., 2018) with slight modification. In brief, cell colonies were cut into small square pieces by mechanical dissection and scraped off from the plate. The small colonies were grown in suspension culture using EB media [Knock-out DMEM (Gibco), 20% KOSR (Sigma), 2 mM GlutaMax (Gibco), 1% PenStrep (Gibco), 0.1 mM NEAA (Gibco) and 0.1 mM β-Mercaptoethanol] for 7 days. The spheroid shaped EBs was transferred to matrigel coated plates and cultured for another 7 days. Total RNA from each sample was isolated followed by expression analysis of three germ layer markers was done by qRT-PCR.
Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank
RNA isolation and qPCR analysis Total RNA from each cell line was isolated using RNeasy® Mini kit (Qiagen) following manufacturer's protocol, cDNA was synthesized using 2 μg of RNA samples for pluripotency markers and 1 μg of RNA samples from C93 EBs and C93 ESCs were used for differentiation 4
WAe009-A-16/INSTEMe010-A-16 H9-FMR1−/−(C93) Institute for Stem Cell Science and Regenerative Medicine Ravi S. Muddashetty; [email protected] Human Embryonic Stem Cell (hESC) hESC line H9 (WA09) from WiCell Institute Age: Blastocyst stage Sex: Female (46, XX) Ethnicity if known: N/A Blastocysts Clonal N/A Yes Induced mutation Fragile X Syndrome (FXS) FMR1/Xq27.3 CRISPR/Cas9 N/A N/A January 2019 N/A
Stem Cell Research 39 (2019) 101494
S. Giri, et al. Ethical approval
Cell lines used following the institutional ethical guidelines. H9 cells were received from WiCell Institute (Agreement No. 17-W0082).
References Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J.V., 2016. CRISP-ID: decoding CRISPR mediated indels by sanger sequencing. Sci. Rep. 6, 28973. https://doi.org/10.1038/ srep28973. D'Souza, M.N., Gowda, N.K.C., Tiwari, V., Babu, R.O., Anand, P., Dastidar, S.G., Singh, R., James, O.G., Selvaraj, B., Pal, R., Ramesh, A., Chattarji, S., Chandran, S., Gulyani, A., Palakodeti, D., Muddashetty, R.S., 2018. FMRP interacts with C/D box snoRNA in the nucleus and regulates ribosomal RNA methylation. iScience 9, 399–411. https://doi. org/10.1016/j.isci.2018.11.007. Khalfallah, O., Jarjat, M., Davidovic, L., Nottet, N., Cestèle, S., Mantegazza, M., Bardoni, B., 2017. Depletion of the fragile X mental retardation protein in embryonic stem cells alters the kinetics of neurogenesis. Stem Cells 35, 374–385. https://doi.org/10. 1002/stem.2505. Muddashetty, R.S., Kelić, S., Gross, C., Xu, M., Bassell, G.J., 2007. Dysregulated metabotropic glutamate receptor-dependent translation of AMPA receptor and postsynaptic density-95 mRNAs at synapses in a mouse model of fragile X syndrome. J. Neurosci. 27, 5338–5348. https://doi.org/10.1523/JNEUROSCI.0937-07.2007. Verkerk, A.J., Pieretti, M., Sutcliffe, J.S., Fu, Y.H., Kuhl, D.P., Pizzuti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F.P., et al., 1991. Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell. 65, 905–914. https://doi.org/10.1016/ 0092-8674(91)90397-H. Wei, R., Yuan, F., Wu, Y., Liu, Y., You, K., Yang, Z., Chen, Y., Getachew, A., Wang, N., Xu, Y., Zhuang, Y., Yang, F., Li, Y.X., 2018. Construction of a GLI3 compound heterozygous knockout human embryonic stem cell line WAe001-A-20 by CRISPR/Cas9 editing. Stem Cell Res. 32, 139–144. https://doi.org/10.1016/j.scr.2018.09.010.
Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgement This work has been financially supported by Science and Engineering Research Board (SERB), Department of Science & Technology (EMR/2016/006313) and Centre for Brain Development and Repair (CBDR) grant (BT/PR11434/MED/30/1389/2014), India. SG was supported by Bridging Post-Doctoral Fellowship from INSTEM core grant. Authors are thankful to the Stem Cell Facility, InStem. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101494.
5
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of a FMR1 homozygous knockout human embryonic stem cell line (WAe009-A-16) by CRISPR/Cas9 editing Subhajit Giria, Meera Purushottamb, Biju Viswanathb, Ravi S. Muddashettya, a b
T
⁎
Institute for Stem Cell Science and Regenerative Medicine (INSTEM), Bengaluru, India Molecular genetics and ADBS laboratory, Department of Psychiatry, National Institute of Mental Health and Neuro Sciences (NIMHANS), Bengaluru, India
A B S T R A C T
Mutations in FMR1 gene is the cause of Fragile X Syndrome (FXS) leading inherited cause of intellectual disability and autism spectrum disorders. FMR1 gene encodes Fragile X Mental Retardation Protein (FMRP) which is a RNA binding protein and play important role in synaptic plasticity and translational regulation in neurons. We have generated a homozygous FMR1 knockout (FMR1-KO) hESC line using CRISPR/Cas9 based genome editing. It created a homozygous 280 nucleotide deletion at exon1, removing the start codon. This FMR1-KO cell line maintains stem cell like morphology, pluripotency, normal karyotype and ability to in-vitro differentiation.
Resource utility Here, we have generated a homozygous FMR1 knock-out human embryonic stem cell (hESC) line. This is an in-vitro hESC model and differentiated neurons from it will provide opportunity to study the biological roles of FMRP towards neuronal development, synaptic plasticity, synaptic signalling and regulation of activity mediated protein synthesis in human stem cell model. Resource details Fragile X-syndrome (FXS) is caused by expansion of CGG trinucleotide repeats at 5′ UTR of FMR1 gene and leads to epigenetic silencing and complete loss of FMRP expression (Verkerk et al., 1991). FMRP, a polyribosome-associated RNA binding protein, plays a central role in neuronal development and synaptic plasticity through multifaceted regulatory function for mRNA translation (D'Souza et al., 2018; Muddashetty et al., 2007). To provide a robust and well characterized in-vitro cell model to scientific community, we have created a homozygous FMR1-KO hESC line in female background (H9, 46, XX) by using the CRISPR/Cas9 gene editing targeting FMR1 exon 1 (Fig. 1A, the Cas9/sgRNA target sequence is indicated by red color followed by PAM sequence in blue color, the start codon ATG is indicated as increased font size). The H9 hESCs were nucleofected with lentiCRISPRv.2 (Addgene 52,961) containing a sgRNA sequence targeting exon 1 of FMR1 gene. Positively transfected cells were selected against puromycin treatment. The puromycin resistant single cell derived clones were picked up and
⁎
expanded. Genomic DNA was isolated from each clones and genotyping was done using PCR followed by Sanger sequencing with primer pair amplifying exon 1 and flanking sequences (listed in Table 2). Among several edited clones, we have identified one clone having 280 nucleotides deletion at exon 1 removing the start codon and the entire 5’ UTR (Fig. 1B, Supplementary Fig. 1). The deletion is confirmed by TOPO-TA cloning of the PCR fragment flanking the entire deletion region followed by Sanger sequencing which is displayed using CRISP-ID algorithm (Dehairs et al., 2016) to annotate the nucleotide position spanning the entire deletion. This FMR1-KO cell line (H9-FMR1−/− (C93) and mentioned henceforth as C93) was expanded for further characterization and validation (Table 1). The successful knock-out of FMR1 was validated by immunoblotting for FMRP in triplicate at different passage numbers (P14, P15 and P17), where the C93 ESCs were devoid of FMRP protein at cellular level (Fig. 1C). Immunoblotting for FMRP was done The C93 cells preserve the characteristic tightly packaged hESC morphology (Fig. 1D) and express high level of pluripotency markers evidenced by immunostaining for OCT4, NANOG and SSEA-4 (Fig. 1E, scale bar 50 μm). Genomic integrity was confirmed by G-banding karyotype analysis and shown that C93 has a normal female karyotype (Fig. 1F). Expression of pluripotency genes (OCT4, NANOG, SOX2 and GDF3) has been analyzed by qRT-PCR. The expressions of these genes are comparable to the parental H9 cell line except for SOX2, which shows a higher expression in C93 cells (Fig. 1G, error bar indicates ± SEM, n = 3). This observation was previously reported where SOX2 was over-expressed in Fmr1 knock-down mouse ESCs (Khalfallah et al., 2017) hence it could be an effect of absence of FMRP, SOX2 mRNA expression or stability.
Corresponding author at: Institute for Stem Cell Science and Regenerative Medicine, GKVK Post, Bellary Road, Bengaluru 560065, India. E-mail address: [email protected] (R.S. Muddashetty).
https://doi.org/10.1016/j.scr.2019.101494 Received 27 March 2019; Received in revised form 5 June 2019; Accepted 26 June 2019 Available online 28 June 2019 1873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 39 (2019) 101494
S. Giri, et al.
Fig. 1. Generation and functional characterization of FMR1 homozygous knockout embryonic stem cell line WAe009-A-16.
2
Stem Cell Research 39 (2019) 101494
S. Giri, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Microbiology and virology
Photography Immunocytochemistry Quantitative analysis Immunocytochemistry counting, RT-qPCR Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis Sequencing Southern Blot OR WGS Mycoplasma
Fig. 1 panel D Fig. 1 panel E Fig. 1 panel E Fig. 1 panel G Fig. 1 panel F N/A Submitted in archive with journal Fig. 1 panel B N/A Fig. 1 panel H
Differentiation potential
Embryoid body formation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Normal OCT4, NANOG, SSEA-4 positive 97% (958 out of 993 cells) positive for OCT4 96% (859 out of 896 cells) positive for NANOG 46 XX, Resolution 450–500 N/A 10/10 sites matched Homozygous deletion for 280 bp in FMR1 exon1 N/A Mycoplasma testing by luminescence. Negative for mycoplasma Expression of three germ layer markers genes – Ectoderm: SOX1, PAX6 Endoderm: FOXA2 Mesoderm: MSX1, TBXT N/A N/A N/A
Genotype Identity Mutation analysis (IF APPLICABLE)
Fig. 1 panel I
N/A N/A N/A
transfection with mTeSR1 supplemented with 0.5 μg/ml of puromycin (Sigma). Puromycin selection was continued for 72 h with everyday media change and then the single cell derived colonies were expanded for another 8 days. Colonies were manually picked up and seeded in 96well culture dish (Corning) and cultured until confluency. Each colony was passaged to make duplicate, where one batch was maintained and another was subjected to genotyping.
Targeted Sanger sequencing was done for the occurrence of any mutation/indel at potential non-specific target sites and confirmed to be negative (Supplementary Fig. 2). Luminescence based mycoplasma detection assay confirmed that C93 cell line is devoid of any mycoplasma infection (Fig. 1H). Cell type identity was validated by CODIS specified STR analysis for 10 loci (archived with journal). The ability for in-vitro differentiation of C93 was done by embryoid body (EB) formation followed by expression analysis of three germ layer markers (SOX1, PAX6 for ectoderm; FOXA2 for endoderm and MSX1, TBXT for mesoderm) carried out by qRT-PCR and compared with expression levels of the same transcripts in H9 hESC (Fig. 1I). It has also been shown that most of the differentiation markers expression is significantly upregulated (2-way ANOVA with Sidak's test, * - p < .05, ** - p < .01, **** - p < .0001, ns - p > .05). In summary, we have generated an FMR1 homozygous knockout hESC cell line, which preserved normal karyotype and full pluripotency with the ability to differentiate to three germ layers. This cell line will be a valuable resource to study the biological importance of FMRP at cellular level.
Genotyping and sequence analysis Genomic DNA was extracted from each colony using 50 μl of QuickExtract™ DNA Extraction Solution (Lucigen) for each well of 96well plate following manufacturer's protocol. PCR was done for genotyping using Taq DNA polymerase (Qiagen) with Q-solution and 2.5% glycerol as PCR additive with a condition of 7 min hot-start and 68 °C – 58 °C touch-down at 2 °C ramp down. Purified PCR amplicons were sequenced using BigDye® Terminator v3.1 sequencing kit (Applied Biosystems) and 3130XL Genetic Analyser (Applied Biosystems). Sequence chromatograms were viewed and analyzed with SnapGene Viewer (GSL Biotech) software. Primer sequences used for PCR and sequencing are provided in Table 2.
Materials and methods Cell culture
Mycoplasma detection The human embryonic stem cell line H9 was cultured on Matrigel (Corning) coated plates (Corning) using mTeSR1 media (StemCell Technologies) under standard condition (37 °C, humidified air with 5% CO2). At around 80% confluency, cells were split for next passage using Collagenase-Trypsin-KOSR (CTK) solution.
Standard testing for mycoplasma detection was done using MycoAlert™ Mycoplasma Detection Kit (Lonza) following the manufacturer's protocol. Luminescence ratio < 1 was considered as negative for mycoplasma infection.
Gene editing with CRISPR/Cas9 methodology
Karyotyping and STR analysis
CRISPR sgRNA were designed using ‘CCTop’ online server (https:// crispr.cos.uni-heidelberg.de/), targeting the start codon of FMR1 gene (NG_007529.2). Synthesized sgRNA was cloned into lentiCRISPRv.2 plasmid containing SpCas9-P2A-Puromycin and U6-driven sgRNA cassette. The successful sgRNA/Cas9 construct was purified by EndoFree® Plasmid Maxi Kit (Qiagen). The H9 cells were dissociated as single cell using Accutase® solution (Sigma) and 0.8 million cells were nucleofected with 3 μg of sgRNA/Cas9 plasmid. Nucleofection was done using P3 Primary Cell 4D-Nucleofector® X Kit (Lonza) and Amaxa® 4DNucleofector® (Lonza) following the manufacturer's protocol. Immediately after nucleofection, cells were plated on matrigel coated 6well culture plate with a density of 135,000 cells/well using prewarmed mTeSR1 media with 10 μM ROCK-inhibitor (Y-27632) (Sigma). After 24 h, cells were subjected to puromycin selection for positive
The G-banding karyotyping was performed at Anand Diagnostic Laboratory Services, Bangalore. At least, 20 metaphase chromosome spreads were analyzed with a G-band resolution of 450–550 and the results were reported by experienced cytogeneticist. The H9 and WAe009-A-16 cell line were authenticated by STR analysis for the AMEL, CSF1PO, D13S317, D16S539, D21S11, D5S818, D7S820, TH01, TPOX and vWA loci. Immunocytochemistry and western blot Cells were grown on matrigel coated glass coverslips in a 12-well culture dish and fixed with 4% PFA solution, permeabilized, blocked and incubated with antibodies (listed in Table 2). Nuclear counterstaining was done with DAPI (Sigma) and Mowiol® 4–88 solution 3
Stem Cell Research 39 (2019) 101494
S. Giri, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
FMRP (Western Blot) α-Tubulin (Western Blot) Pluripotency markers (Immunofluorescence) Pluripotency markers (Immunofluorescence) Pluripotency markers (Immunofluorescence) Secondary antibodies Secondary antibodies Secondary antibodies Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Rabbit anti-FMRP Mouse anti-α tubulin Mouse anti-OCT-3/4 (C10) Rabbit anti-NANOG Mouse anti-SSEA-4 Goat anti-Mouse IgG (H + L) HRP conjugated Goat anti-Rabbit IgG Alexa Fluor 488 goat anti-mouse IgG (H + L) Alexa Fluor 555 goat anti-rabbit IgG (H + L)
1:1000 1: 5000 1:500 1: 500 1: 250 1: 5000 1: 5000 1: 500 1: 500
Abcam Cat# ab17722, RRID:AB_2278530 Sigma-Aldrich Cat# T9026, RRID:AB_477593 Santa Cruz Biotechnology Cat# sc-5279, RRID:AB_628051 PeproTech Cat# 500-P236-100μg, RRID:AB_1268274 BioLegend Cat# 330401, RRID:AB_1089209 Thermo Fisher Scientific Cat# 31430, RRID:AB_228307 Sigma-Aldrich Cat# A0545, RRID:AB_257896 Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069 Thermo Fisher Scientific Cat# A27039, RRID:AB_2536100
Primers
Pluripotency Markers (qPCR) Pluripotency Markers (qPCR) Pluripotency Markers (qPCR) Pluripotency Markers (qPCR) Differentiation Markers (qPCR) Differentiation Markers (qPCR) Differentiation Markers (qPCR) Differentiation Markers (qPCR) Differentiation Markers (qPCR) House-Keeping Genes (qPCR) FMR1-exon1-sgRNA Targeted mutation analysis/sequencing Non-specific target site 1 (PCR/sequencing) Non-specific target site 2 (PCR/sequencing) Non-specific target site 3 (PCR/sequencing) Non-specific target site 4 (PCR/sequencing) Non-specific target site 5 (PCR/sequencing) Non-specific target site 6 (PCR/sequencing)
Target
Forward/Reverse primer (5′-3′)
OCT4 NANOG SOX2 GDF3 SOX1 PAX6 FOXA2 MSX1 TBXT GAPDH FMR1 exon 1 FMR1 exon1 ESAM C19orf45 COL6A3 SCN5A SLC2A11 SYNCRIP
CCCCAGGGCCCCATTTTGGTACC/ACCTCAGTTTGAATGCATGGGAGAGC AAAGAATCTTCACCTATGCC/GAAGGAAGAGGAGAGACAGT TTCACATGTCCAGCACTACCAGA/TCACATGTGTGAGAGGGGCAGTGTGC TGACCATCTCCCTCAACAGC/TACCCACACCCACACTCATC AATACTGGAGACGAACGCCG/CCTCTCGCCTCGTTTTGACT CTGAGGAATCAGAGAAGACAGGC/ATGGAGCCAGATGTGAAGGAGG GAACACCACTACGCCTTCAAC/AGTGCATCACCTGTTCGTAGGC TCCGCAAACACAAGACGA/ACTGCTTCTGGCGGAACTT TATGAGCCTCGAATCCACATAGT/CCTCGTTCTGATAAGCAGTCAC GCTCAGACACCATGGGGAAGG/GGAATTTGCCATGGGTGGAATC CACCGAGAGAAGATGGAGGAGCTGG/AAACCCAGCTCCTCCATCTTCTCTC CCAAACCAAACCAAACCAAAC/TGTGCATTCCTGAATTTACCC GCTCCGTGAATGTGCAAGAC/CTTCCCCAGCCACAGTGT GAAAGGCTAAATCCCACCCC/GAGGAGCCAAAGAAGGAGG GGATACCCACGAAGAAATTCCA/AGAGCATTTCCTTCTAGCCCC CTCCTACGAGCCCATCACC/GGCTGGTTTGTGACTGACTG GGCAGAGAGAGAGACACACA/CAGCTCCCAGTCCCGATG GCGGGAGAGAGAAAGAGAGG/CCAGCTCACTCCACAATGTC
markers, random hexamer and SuperScript™ III Reverse Transcriptase (Invitrogen) in a 20 μl reaction volume. qPCR was done using 1 μl of cDNA sample and TB Green™ Premix Ex Taq™ (TaKaRa) on a CFX384™ Real-Time PCR Detection Systems (BioRad).
(Sigma) was used as mounting media. Images were acquired with IX73 Fluorescence microscope (Olympus). Images were processed and analyzed with ImageJ software. For western blot, 350 μl of cell lysis buffer (50 mM Tris-Cl, 150 mM NaCl, 5 mM MgCl2, 1% NP-40, 1 mM DTT and 1× Protease inhibitor) was used for each cell line cultured in 35 mm culture dish. Cell lysates were centrifuged at 12000g for 30 min at 4 °C and collected in a fresh tube. Protein samples from 25 μl of cell lysates were separated by SDSPAGE, transferred onto PVDF membrane (Milipore) and probed with antibodies indicated in Table 2. Images were acquired with Amersham™ Imager 600 (GE Healthcare) and analyzed with ImageJ software.
Key resources table
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Embryoid body (EB) formation and in-vito differentiation assay The EB formation was performed following the previously reported protocol (Wei et al., 2018) with slight modification. In brief, cell colonies were cut into small square pieces by mechanical dissection and scraped off from the plate. The small colonies were grown in suspension culture using EB media [Knock-out DMEM (Gibco), 20% KOSR (Sigma), 2 mM GlutaMax (Gibco), 1% PenStrep (Gibco), 0.1 mM NEAA (Gibco) and 0.1 mM β-Mercaptoethanol] for 7 days. The spheroid shaped EBs was transferred to matrigel coated plates and cultured for another 7 days. Total RNA from each sample was isolated followed by expression analysis of three germ layer markers was done by qRT-PCR.
Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank
RNA isolation and qPCR analysis Total RNA from each cell line was isolated using RNeasy® Mini kit (Qiagen) following manufacturer's protocol, cDNA was synthesized using 2 μg of RNA samples for pluripotency markers and 1 μg of RNA samples from C93 EBs and C93 ESCs were used for differentiation 4
WAe009-A-16/INSTEMe010-A-16 H9-FMR1−/−(C93) Institute for Stem Cell Science and Regenerative Medicine Ravi S. Muddashetty; [email protected] Human Embryonic Stem Cell (hESC) hESC line H9 (WA09) from WiCell Institute Age: Blastocyst stage Sex: Female (46, XX) Ethnicity if known: N/A Blastocysts Clonal N/A Yes Induced mutation Fragile X Syndrome (FXS) FMR1/Xq27.3 CRISPR/Cas9 N/A N/A January 2019 N/A
Stem Cell Research 39 (2019) 101494
S. Giri, et al. Ethical approval
Cell lines used following the institutional ethical guidelines. H9 cells were received from WiCell Institute (Agreement No. 17-W0082).
References Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J.V., 2016. CRISP-ID: decoding CRISPR mediated indels by sanger sequencing. Sci. Rep. 6, 28973. https://doi.org/10.1038/ srep28973. D'Souza, M.N., Gowda, N.K.C., Tiwari, V., Babu, R.O., Anand, P., Dastidar, S.G., Singh, R., James, O.G., Selvaraj, B., Pal, R., Ramesh, A., Chattarji, S., Chandran, S., Gulyani, A., Palakodeti, D., Muddashetty, R.S., 2018. FMRP interacts with C/D box snoRNA in the nucleus and regulates ribosomal RNA methylation. iScience 9, 399–411. https://doi. org/10.1016/j.isci.2018.11.007. Khalfallah, O., Jarjat, M., Davidovic, L., Nottet, N., Cestèle, S., Mantegazza, M., Bardoni, B., 2017. Depletion of the fragile X mental retardation protein in embryonic stem cells alters the kinetics of neurogenesis. Stem Cells 35, 374–385. https://doi.org/10. 1002/stem.2505. Muddashetty, R.S., Kelić, S., Gross, C., Xu, M., Bassell, G.J., 2007. Dysregulated metabotropic glutamate receptor-dependent translation of AMPA receptor and postsynaptic density-95 mRNAs at synapses in a mouse model of fragile X syndrome. J. Neurosci. 27, 5338–5348. https://doi.org/10.1523/JNEUROSCI.0937-07.2007. Verkerk, A.J., Pieretti, M., Sutcliffe, J.S., Fu, Y.H., Kuhl, D.P., Pizzuti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F.P., et al., 1991. Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell. 65, 905–914. https://doi.org/10.1016/ 0092-8674(91)90397-H. Wei, R., Yuan, F., Wu, Y., Liu, Y., You, K., Yang, Z., Chen, Y., Getachew, A., Wang, N., Xu, Y., Zhuang, Y., Yang, F., Li, Y.X., 2018. Construction of a GLI3 compound heterozygous knockout human embryonic stem cell line WAe001-A-20 by CRISPR/Cas9 editing. Stem Cell Res. 32, 139–144. https://doi.org/10.1016/j.scr.2018.09.010.
Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgement This work has been financially supported by Science and Engineering Research Board (SERB), Department of Science & Technology (EMR/2016/006313) and Centre for Brain Development and Repair (CBDR) grant (BT/PR11434/MED/30/1389/2014), India. SG was supported by Bridging Post-Doctoral Fellowship from INSTEM core grant. Authors are thankful to the Stem Cell Facility, InStem. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101494.
5