Cas9

Stem Cell Research 42 (2020) 101676

Contents lists available at ScienceDirect

Stem Cell Research journal homepage: www.elsevier.com/locate/scr

Lab resource: Stem Cell Line

Generation of a GLA knock-out human-induced pluripotent stem cell line, KSBCi002-A-1, using CRISPR/Cas9 Young-Kyu Kim, Ji Hoon Yu, Sang-Hyun Min, Sang-Wook Park

T

⁎

Daegu-Gyeongbuk Medical Innovation Foundation (DGMIF), 88 Dongnae-ro, Dong-gu, Daegu, Republic of Korea

A B S T R A C T

Fabry disease is an X-linked inherited disease caused by a mutation in the galactosidase alpha (GLA) gene. Here, we generated a GLA knock-out cell line (GLA-KO hiPSCs) from normal human-induced pluripotent stem cells (hFSiPS1) using the CRISPR-Cas9 genome-editing tool. The GLA-KO hiPSCs maintained normal morphology, karyotypes, expression of stemness markers, and trilineage differentiation potential. Furthermore, the GLA-KO hiPSCs exhibited dissipation of GLA activity and abnormal Globotriaosylceramide (Gb3) accumulation. Our GLA-KO hiPSC line represents a valuable tool for studying the mechanisms involved in Fabry disease and the development of novel therapeutic alternatives to treat this rare condition.

Resource table 1. Resource utility Unique stem cell line identifier Alternative name(s) of stem cell line Institution

Contact information of distributor Type of cell line Origin Additional origin info Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval

⁎

KSCBi002-A-1 GLA-KO hiPS New Drug Development Center, Daegu-Gyeongbuk Medical Innovation Foundation (DGMIF), Daegu, Republic of Korea Sang-Wook Park, [email protected] iPSC human N/A Fibroblasts Clonal Sendai virus YES Knock-out Fabry disease Galactosidase alpha (GLA)/Xq22.1 CRISPR/Cas9 N/A N/A Oct 15, 2019 https://hpscreg.eu/cell-line/KSCBi002-A-1 Cell lines were used according to institutional guidelines that received the original cell line (IRB approval; 201306EXP-06-R, 2014-10CON-04-1C-A).

Here, we established an in vitro model system for Fabry disease by targeting the GLA gene in normal human induced pluripotent stem cells (hFSiPS1). This GLA-KO hiPSC line, as a cellular disease model, could be a useful platform for studying pathogenic mechanisms and identifying new therapeutic drugs for Fabry disease. 2. Resource details Mutations in the GLA gene lead to an X-linked lysosomal-storage disease called Fabry disease. Depletion of alpha-galactosidase activity by GLA mutation leads to progressive Gb3 accumulation in vasculature, kidney, and heart, thereby causing several complications in those organs (Germain 2010). Although the GLA gene is highly penetrant, patients affected with different mutations exhibit different degrees of clinical severity due to residual enzyme activity, which depends on the mutation patterns. As a representative therapy for Fabry disease, repeated enzyme replacement therapy with agalsidase beta (Fabrazyme) or agalsidase alfa (Replagal), has been used to clear the accumulated Gb3 in Fabry disease patients (Eng et al., 2001; Schiffmann et al., 2001). However, the development of additional therapeutic drugs and the progress of mechanistic studies on the correlation between Gb3 accumulation and disease phenotypes are hindered by a lack of diseaserelevant model systems. To overcome these limitations, we have established the GLA knock-out human-induced pluripotent cells (hiPSCs) from previously characterized normal hiPSCs (hFSiPS1) using CRISPR/ Cas9 (Uhm et al., 2017). To generate the GLA-KO hiPSC line, a pCas-

Corresponding author at: New drug development center, Daegu, Republic of Korea. E-mail address: [email protected] (S.-W. Park).

https://doi.org/10.1016/j.scr.2019.101676 Received 7 November 2019; Received in revised form 27 November 2019; Accepted 3 December 2019 Available online 04 December 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Stem Cell Research 42 (2020) 101676

Y.-K. Kim, et al.

Fig. 1. Characterization of KSBCi002-A-1 cells.

2

Stem Cell Research 42 (2020) 101676

Y.-K. Kim, et al.

Accutase (STEMCELL Technologies). Next, 2 × 105 hFSiPS1 cells were electroporated with 5 µg of the above-mentioned cloned vector using the Neon transfection system (Invitrogen) using the operating parameters recommended by the manufacturer (pulse voltage: 1050 v, pulse width: 30 ms, and pulse number: 2 times). The transfected hFSiPS1 cells were seeded on Matrigel-coated dish and cultured in mTeSR1 medium supplemented with 10 µM of Y-27632 (STEMCELL Technologies). After 3 days of transfection, hFSiPS1 cells were dissociated into single cells, and 1000 such single cells were seeded onto a Matrigel-coated 100 mm dish. After 10–14 days, single-cell-derived colonies were detached with Dispase, and each colony was transferred onto a Matrigel-coated 48well dish. Finally, samples of each colony were scraped for DNA genotyping. Genomic DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer's instruction. Then, the CRISPR/Cas9 targeted site was amplified by PCR (C1000 thermal cycler, Bio-Rad), a targeted deep sequencing was performed using the Illumina MiSeq, and indel efficiencies and patterns were analyzed using CRISPR RGEN tools (http://www.rgenome.net/).

guide-EF1a-GFP all-in-one vector cloned with GLA exon 1-targeting gRNA was transfected into the hFSiPS1 cell line (Supplementary Fig. 1A). After single clone selection was performed in the GLA-KO hiPSC line, mutation of each clone was confirmed by targeted deep sequencing. Among 96 clones, we found 9 mutant cell lines. Two of them showed out-of-frame mutations (4-bp and 10-bp deletions). Further, we selected a GLA-KO hiPSC line with a 10-bp deletional mutation (Fig. 1A, Supplementary Fig. 1B). The undifferentiated GLA-KO hiPSC line showed high ratio of nucleus to cytoplasm (Supplementary Fig. 1C). They also exhibited high expression of SSEA-4, OCT4, Tra-160, and NANOG, as detected by immunostaining or flow cytometric analysis (Fig. 1B, C). Moreover, we confirmed that the normal karyotype (46, XY) was maintained in the GLA-KO hiPSCs (Fig. 1D). To determine the differentiation potentials of the GLA-KO hiPSCs, we induced the differentiation of GLA-KO hiPSCs into the ectoderm, mesoderm, and endoderm lineages. After in vitro directed differentiation, we confirmed that each representative lineage marker (ectoderm: PAX6, mesoderm: T, endoderm: FOXA2) was expressed in the GLA-KO hiPSCs (Fig. 1E). This CRISPR/Cas9-derived KO cell line was also shown to be free from mycoplasma contamination (Supplementary Fig. 2). In addition, the GLA-KO hiPSCs completely matched the original hiPSC line clone (KSCBi002-A), as shown by short tandem repeat analysis. To test whether the GLA-KO hiPSC line recapitulates phenotypes of Fabry disease, we performed an α-galactosidase A activity assay and immunostaining for Gb3 (Fig 1F, G). In these experiments, the GLA-KO hiPSC line exhibited typical phenotypes of Fabry disease, such as a deteriorated GLA activity and Gb3 accumulation Table 1

3.3. Flow cytometry hiPSCs were dissociated with Accutase and stained for surface markers (SSEA-4 and Tra-1-60). For intracellular staining (OCT4), the BD Cytofix/Cytoperm™ Fixation/Permeabilization Kit (BD) was used according to the manufacturer's instructions. The cells were incubated with the primary and secondary antibodies in resuspension buffer (0.1% FBS in PBS) for 30 min at 4 °C. The stained cells were analyzed using the BD FACS Aria II system and the FlowJo analysis software.

3. Materials and methods 3.4. Directed differentiation of GLA-KO hiPSCs into three germ layers 3.1. Cell culture In vitro directed differentiation of hiPSCs into three germ layers was performed using the StemDiff Trilineage Kit (STEMCELL Technologies) according to the manufacturer's protocol.

The human stem cell line hFSiPS1 was provided by the National Stem Cell Bank of Korea (Uhm et al., 2017). Cells were maintained in mTeSR1 medium (STEMCELL Technologies) on plates pre-coated with Corning Matrigel® hESC-Qualified Matrix at 37 °C in a humidified incubator containing 5% CO2. After 5–6 days of culture, hiPSCs were split at 1:20 ratio using ReLeSR (STEMCELL Technologies).

3.5. Immunocytochemistry hiPSCs were fixed with 4% paraformaldehyde for 15 min at room temperature. After fixation, cell permeabilization was performed using 0.1% (v/v) Triton X-100 for 10 min at room temperature. Then, the cells were blocked with 5% (v/v) normal goat or donkey serum for 1 hr at room temperature and incubated with primary antibodies overnight at 4 °C. The primary antibodies were diluted in 5% (v/v) normal goat or donkey serum. The following day, the cells were incubated with the secondary antibodies for 1 hr at room-temperature, and nuclei were stained with 0.2 μM of DAPI (4′,6-diamidino-2-phenylindole, Thermo Fisher Scientific) in PBS for 10 min at room-temperature. Images were acquired using an Axio Observer A1 fluorescence microscope (Carl

3.2. Generation of GLA-KO hiPSCs using CRISPR/Cas9 The gRNA for the generation of GLA-KO in hiPSCs was designed using Cas-Designer (http://www.rgenome.net/). To assemble a GLA-KO gRNA template, two GLA-targeting oligonucleotides (Table 2) were annealed in a PCR machine. Then, 1 µg of pCas-guide-EF1a-GFP vector was digested with BamHI and BsmBI for 3 h at 37 °C. Next, the annealed GLA-KO gRNA was cloned into a digested vector. To generate the GLAKO hiPSC line, hFSiPS1 cells were dissociated into single cells using Table 1 Characterization and validation. Classification

Test

Result

Data

Morphology Phenotype

Photography Qualitative analysis (Immunocytochemistry) Quantitative analysis (Flow cytometry)

Supplementary figure 1C Fig. 1 panel B Fig. 1 panel C

Genotype Identity

Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis Sequencing Southern Blot OR WGS Mycoplasma Directed differentiation HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing

Normal SSEA4, OCT4, Tra-1-60, NANOG positive OCT4 and SSEA4 double positive cells: 99.9% Tra-1-60 and SSEA3 double positive cells: 98.2% 46XY, Resolution: 550 Not performed 16 loci tested, all matched Homozygous Not performed Mycoplasma testing by RT-PCR. Negative T (Mesoderm), PAX6 (Ectoderm), and FOXA2(Endoderm) expression Not performed Not performed Not performed

Mutation analysis (If applicable) Microbiology and virology Differentiation potential Donor screening (Optional) Genotype additional info (Optional)

3

Fig. 1 panel D N/A Available from authors e.g. Fig. 1 panel A N/A Supplementary figure 2 Fig. 1 panel E N/A N/A N/A

Stem Cell Research 42 (2020) 101676

Y.-K. Kim, et al.

Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry Antibody Pluripotency Markers

Differentiation marker

Secondary antibodies

Assay kits Mycoplasma detection kit Enzyme activity assay kit Differentiation kit Genome editing Primers gRNA template Targeted mutation analysis/ sequencing

Mouse anti-OCT4 Rabbit anti-Nanog Rabbit anti-SOX2 Mouse anti-SSEA-4 Mouse anti-Tra-1-60 Rabbit anti-FOXA2 Goat anti-T antibody Rabbit Anti-PAX6 antibody Mouse anti-Gb3 antibody Donkey anti-Rabbit IgG Secondary Antibody, Alexa Fluor 488 Donkey anti-Rabbit IgG Secondary Antibody, Alexa Fluor 594 Donkey anti-Mouse IgG Secondary Antibody, Alexa Fluor 594 Donkey anti-Mouse IgG Secondary Antibody, Alexa Fluor 488 Goat anti-Mouse IgM Secondary Antibody, Alexa Fluor 488

Dilution

Company Cat # and RRID

1:300 1:300 1:300 1:300 1:300 1:100 1:100 1:100 1:100 1:500

Cell Signaling Technology Cat# 75463, RRID: AB_2799870 Cell Signaling Technology Cat# 3580, RRID:AB_2150399 Cell Signaling Technology Cat# 23064, RRID:AB_2714146 Millipore Cat# MAB4304, RRID:AB_177629 Millipore Cat# MAB4360, RRID:AB_2119183 Cell Signaling Technology Cat# 8186, RRID:AB_10891055 R and D Systems Cat# AF2085, RRID:AB_2200235 Abcam Cat# ab195045, RRID:AB_2750924 Tokyo Chemical Industry, A2506 Thermo Fisher Scientific Cat# R37118, RRID:AB_2556546

1:500

Thermo Fisher Scientific Cat# R37119, RRID:AB_2556547

1:500

Thermo Fisher Scientific Cat# R37115, RRID:AB_2556543

1:500

Thermo Fisher Scientific Cat# R37114, RRID:AB_2556542

1:500

Thermo Fisher Scientific Cat# A-21042, RRID:AB_2535711

e-MycoTM plus mycoplasma PCR detection kit Alpha Galactosidase (α-Gal) Activity Assay Kit STEMdiff™ Trilineage Differentiation Kit pCas-guide-EF1a-GFP Target GLA exon1 GLA exon1

Intron Biotechnology, Cat#25237 BioVision, Cat# K407-100 Cell Signaling Technology Cat#5230 Origene,GE100018 Forward/Reverse primer (5′−3′) GATCGATTGGCAAGGACGCCTACCAG / AAAACTGGTAGGCGTCCTTGCCAATC TAGGGCGGGTCAATATCAAG/ GGACAGTTTGCTGGGGATAA

Zeiss). Scale bars indicate 50 μm.

Foster, CA).

3.6. Measurement of alpha-galactosidase activity

CRediT authorship contribution statement

Alpha-galactosidase activity was tested with the Alpha Galactosidase (α-Gal) Activity Assay Kit (Biovision) according to the manufacturer's protocol.

Young-Kyu Kim: Conceptualization, Formal analysis, Writing original draft, Validation. Ji Hoon Yu: Conceptualization, Validation. Sang-Hyun Min: Conceptualization, Validation. Sang-Wook Park: Conceptualization, Formal analysis, Writing - original draft, Validation.

3.7. Mycoplasma detection Declaration of Competing Interests Mycoplasma contamination in the GLA-KO hiPSC line was examined using the Mycoplasma PCR Detection Kit (Intron Biotechnology, Korea) based on the manufacturer's protocol. After the PCR, the PCR products were run on an 1.5% agarose gel, and visualized using the Gel Doc XR+ System (Bio-Rad).

None Acknowledgement We gratefully acknowledges the National Research Foundation of Korea (NRF) grant (NRF-2018M3A9G4078526) for financial support.

3.8. Karyotyping Karyotyping of the GLA-KO hiPSCs was performed by GenDix Co, Korea. The undifferentiated GLA-KO hiPSCs at passage 10 were treated with colcemid for 45 min, harvested in fixative solution (acetic acid:methanol, 1:3), and the metaphase slides were prepared. Total 20 randomly selected metaphases spreads were analyzed using the GTGband method.

Supplementary materials

3.9. STR analysis

Eng, C.M., Guffon, N., Wilcox, W.R., Germain, D.P., Lee, P., Waldek, S., Caplan, L., Linthorst, G.E., Desnick, R.J., G. International Collaborative Fabry Disease Study, 2001. Safety and efficacy of recombinant human alpha-galactosidase A replacement therapy in Fabry's disease. N. Engl. J. Med. 345 (1). Germain, D.P., 2010. Fabry disease. Orphanet. J. Rare. Dis. 5, 30. Schiffmann, R., Kopp, J.B., Austin 3rd, H.A., Sabnis, S., Moore, D.F., Weibel, T., Balow, J.E., Brady, R.O., 2001. Enzyme replacement therapy in Fabry disease: a randomized controlled trial. JAMA 285 (21), 2743–2749. Uhm, K.O., Kim, S.J., Jo, E.H., Go, G.Y., Choi, H.Y., Im, Y.S., Ha, H.Y., Kim, J.H., Koo, S.K., 2017. Generation of human induced pluripotent stem cell lines from human dermal fibroblasts using a non-integration system. Stem Cell Res. 21, 13–15.

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2019.101676. References

Genetic identity between the original cell line (hFSiPS1) and the genome-edited cell line (GLA-KO hiPSCs) was confirmed by short tandem repeat (STR) analysis performed by Humanpass Inc., Korea. Total 16 loci (D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, Amelogenin, D5S818, FGA) were analyzed by AmpFlSTR Identifiler kit (Applied Biosystems, USA), 3130XL DNA analyzer (Applied Biosystems, Life Technologies), and GeneMapper ID v3.2 (Applied Biosystems, 4