- Email: [email protected]
Generation of an induced pluripotent stem cell line (FRIMOi007-A) derived from an incomplete achromatopsia patient carrying a novel homozygous mutation in PDE6C gene
Stem Cell Research 40 (2019) 101569
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of an induced pluripotent stem cell line (FRIMOi007-A) derived from an incomplete achromatopsia patient carrying a novel homozygous mutation in PDE6C gene
T
Judit Domingo-Prima,b, Víctor Abad-Moralesa,b, Marina Rieraa,b, Rafael Navarroa,c, ⁎ Borja Corcosteguia,c, Esther Pomaresa,b, a b c
Fundació de Recerca de l'Institut de Microcirurgia Ocular, Barcelona, Spain Departament de Genètica, Institut de Microcirurgia Ocular (IMO), Barcelona, Spain Departament de Retina, Institut de Microcirurgia Ocular (IMO), Barcelona, Spain
ABSTRACT
Incomplete achromatopsia (ACHM) is a disorder in which there is function defect of cone photoreceptors in the retina and individuals with such disease retain residual color vision. Here, we have generated an induced pluripotent stem cell (iPSC) line carrying a homozygous mutation in the PDE6C gene, already related with this vision disorder. Skin fibroblasts from a patient with incomplete ACHM were reprogrammed to iPSCs by the non-integrative Sendai-virus method. Finally, the iPSC line has been characterized expressing the pluripotency markers and being capable to differentiate to endoderm, mesoderm and ectoderm in vitro.
Resource utility The generation of an induced pluripotent stem cell (iPSC) line established from a patient affected by incomplete ACHM with a novel mutation in Phosphodiesterase 6C (PDE6C) gene facilitates the molecular study of such disease and becomes an excellent tool for the study of new treatments (Wiley et al., 2015). Resource details Incomplete ACHM reported cases due to PDE6C mutations are usually associated to autosomal recessive inheritance. Mutations at this gene that are related to incomplete ACHM reduce the phototransduction process (Grau et al., 2011). The patients present an initial loss of central vision, severe photophobia and color vision disturbances with variable clinical findings based on the residual functioning cones (Abdelkader et al., 2018). A 42-year-old male was clinically diagnosed for incomplete ACHM at Institut de Microcirurgia Ocular (IMO), Barcelona, based on standard ophthalmic evaluations, fundus autofluorescence imaging and optical coherence tomography, electroretinography and visual field tests. Moreover, the genetic analysis performed by whole-exome sequencing and focused on a panel of 224 genes responsible for inherited retinal dystrophies showed a homozygous variant, c.1670G > A (p.Arg557Gln), not previously described, in PDE6C gene and
⁎
phenotypically correlated with incomplete ACHM. In order to establish and determine whether this variant was the responsible for the disease, we performed a bioinformatic analysis for pathogenicity predictors (by SIFT, PolyPhen2, LRT, Mutation Taster, Mutation Assesor, FATHMM, MetaSVM, LoFtool, Fathmm-MKL, PROVEAN, M-CAP, Condel, SSF, MaxEnt, NNSPLICE, GeneSplicer, HSF), which showed that this variant has a very low population frequency (rs201309785, MAF = 0.00008, ExAC database) and that is highly deleterious. We have also studied the evolutive conservation of the variant position (by Genomic Evolutionary Rate Profiling, PhyloP, Grantham) finding that it affects a highly conserved aminoacid residue. Finally, we have verified the inheritance of the variant by a familial cosegregation analysis and confirmed that the variant is not present either in 232 chromosomes from a validated control population. In order to obtain the iPSCs, patient fibroblast cells were isolated from a skin biopsy. The fibroblasts cells were then reprogrammed using the reprogramming factors OCT3/4, SOX2, KLF4 and c-MYC transduced into the cells by non-integrative Sendai virus. After three weeks, individual colonies were manually picked and expanded. Finally, one of the selected colonies was characterized and validated for successful reprogramming (Table 1). The validation showed that generated iPSC line PDE6C_FiPS4F1 colonies were morphologically as typical human embryonic stem cells: polygonal, large and well-defined, with high nuclear/cytoplasmic ratio and prominent nucleoli (Fig. 1A). Moreover, the iPS cells displayed a normal male karyotype
Corresponding author at: C/ Josep Mª Lladó, 3, 08035 Barcelona, Spain. E-mail address: [email protected] (E. Pomares).
https://doi.org/10.1016/j.scr.2019.101569 Received 21 June 2019; Received in revised form 19 August 2019; Accepted 3 September 2019 Available online 04 September 2019 1873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 40 (2019) 101569
J. Domingo-Prim, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis: Immunocytochemistry Quantitative analysis: Immunocytochemistry Karyotype (G-banding) and resolution STR analysis Sequencing
Normal Positive for: NANOG, OCT4, SOX2, SSEA4, TRA1-60, TRA1-81
Fig. 1 panel A Fig. 1 panel F
Percentage of positive cells (n = 150): NANOG 93.6 %, OCT4 98.9 %, SOX2 95.3 %, SSEA4 66.6 %, TRA1-60 68.3 %, TRA1-81 47.7 % 46, XY Resolution 400–550 16 loci analyzed, all matching Homozygous, missense mutation
N/A
Mycoplasma Directed differentiation
Mycoplasma testing by PCR. Negative Positive OTX2 ectodermal staining, positive Brachyury mesodermal staining and positive SOX17 endodermal staining N/A N/A
Supplementary file Fig. 1 panel E
Genotype Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
N/A N/A
Fig. 1 panel B Available with the authors Fig. 1 panel D
N/A N/A
Fig. 1. Characterization of the iPSC line.
(46, XY) (Fig. 1B), were free of Sendai reprogramming factors (Fig. 1C) and carried the patient mutation c.1670G > A at the PDE6C gene in homozygosis (Fig. 1D). The DNA fingerprinting assay
performed with 16 different markers confirmed that the iPSC line had the same genetic background as the donor fibroblasts. In order to determine whether the cells had the potential to differentiate into
2
Stem Cell Research 40 (2019) 101569
J. Domingo-Prim, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry
Pluripotency Marker Pluripotency Marker Pluripotency Marker Pluripotency Marker Pluripotency Marker Pluripotency Marker Differentiation Marker Differentiation Marker Differentiation Marker Secondary antibody Secondary antibody
Antibody
Dilution
Company Cat # and RRID
Rabbit anti-OCT4 (Alexa Fluor 488 Conjugate) Rabbit anti-NANOG Mouse anti-SOX2(E-4) (Alexa Fluor 488 Conjugate) Mouse anti-SSEA4 (Alexa Fluor 488 Conjugate) Mouse anti-Tra-1-60 (Alexa Fluor 488 Conjugate) Mouse anti-Tra-1-81 (Alexa Fluor 488 Conjugate) Goat anti-OTX2 Goat anti-Brachyury Goat anti-SOX17 (NL557 Conjugate) Donkey anti-Goat IgG Alexa Fluor 488 Goat anti-Rabbit IgG Alexa Fluor 488
1:400 1:100 1:50 1:100 1:50 1:50 1:20 1:20 1:10 1:1000 1:1000
Cell Signaling Technology Cat# 5177S, RRID: AB_10693303 Cell Signaling Technology Cat# 4903P, RRID: AB_10559205 SantaCruz Biotechnology Cat# sc-365,823 AF488, RRID: AB_10842165 BD Pharmingen Cat# 560308, RRID: AB_1645371 BD Pharmingen Cat# 560173, RRID: AB_1645379 BD Pharmingen Cat# 560174, RRID: AB_1645380 R&D Systems Cat# AF1979, RRID: AB_2157172 R&D Systems Cat# AF2085, RRID: AB_2200235 R&D Systems Cat# NL1924R, RRID: AB_2195645 Thermo Fisher Scientific Cat# A32814, RRID: AB_2762838 Thermo Fisher Scientific Cat# A11008, RRID: AB_143165
Primers Target
Forward/Reverse primer (5′-3′)
Sendai virus detection
SeV, 181 bp
Transgene detection
KOS, 528 bp
Transgene detection
KLF4, 410 bp
Transgene detection
c-MYC, 532 bp
House-keeping gene
GAPDH, 983 bp
Mutation sequencing
PDE6C (c.1670G > A), 1154 bp
GGATCACTAGGTGATATCGAGC ACCAGACAAGAGTTTAAGAGATATGTATC ATGCACCGCTACGACGTGAGCGC ACCTTGACAATCCTGATGTGG TTCCTGCATGCCAGAGGAGCCC AATGTATCGAAGGTGCTCAA TAACTGACTAGCAGGCTTGTCG TCCACATACAGTCCTGGATGATGATG TGAAGGTCGGAGTCAACGGATTTGG CATGTAGGCCATGAGGTCCACCAC GCACATGGTGGTTCAGTGAATC CACCCTAAGTACTTTCCAATGTC
each of the three germ layers, we performed an in vitro functional differentiation test that proved that the cells could generate endoderm, mesoderm and ectoderm (Fig. 1E). In parallel, the pluripotency of the iPSC line was assessed by immunocytochemistry for Nanog, OCT4, SOX2, SSEA4, Tra1-60 and Tra1-81 markers (Fig. 1F). Cells were negative for Mycoplasm contamination (Suppl. Figure). Materials and methods
ml of FGF2 (cat# 233-FB, R&D Systems). Three weeks after reprogramming, 12 colonies were picked and transferred into MEFs-coated 24-well plate. Selected iPSC colonies were then expanded for six passages on MEFs, and afterwards moved to feeder-free conditions, onto Matrigel-coated plates (cat# CB 40230, Corning) in mTeSR1 medium (cat# 5850, StemCell Technologies) from passage seven. All cells were incubated at 37 °C in 5% CO2 and weekly subcultured 1:10 using 50 mM EDTA in phosphate buffered saline (PBS).
Reprogramming of skin fibroblasts
Karyotype analysis
Fibroblasts were obtained from skin biopsy and cultured in DMEM (cat# 11960077, Life Technologies) supplemented with 10% FBS (cat# 10082147, Life Technologies) and 1× penicillin-streptomycin (cat# 15140122, Life Technologies). Reprogramming was performed by the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (cat# A16518, ThermoFisher Scientific) following the manufacturer's instructions. Six days after virus transduction, 2 × 104 cells/well were seeded in 6-well plates coated with irradiated mouse embryonic fibroblasts (MEFs) (cat# A34181, ThermoFisher Scientific), and cultured in hES media, containing DMEM/Ham's F-12 (cat# 11320-033, Life Technologies) supplemented with 20% KSR (cat # 10828028 Life Technologies), 1× nonessential amino acids (cat# 11140076, Life Technologies), 1× penicillin-streptomycin, 1× glutamine (cat# 25030081, Life Technologies), 1× β-mercaptoethanol (cat# 21985023, Life Technologies), and 10 ng/
Karyotype was performed in iPSC at passage 8 on fifteen G-banded metaphase cells at 400–550 band resolution (Synlab Diagnosticos Globales). Mutation analysis Genomic DNA was isolated from iPSC using the PureGene Blood Core Kit A (cat# 1042604, Qiagen) following manufacturer's instructions. PCR amplification with specific primers flanking the PDE6C mutation (Table 2) was performed by a three-step PCR of 20 s at 95 °C, 30 s at 58 °C and 1 min at 72 °C for 35 cycles in a SimpliAmp Thermal Cycler (ThermoFisher), using DNA AmpliTools Green Master Mix (cat# 4749, Biotools). The resulting PCR products were sequenced by Sanger (Macrogen).
3
Stem Cell Research 40 (2019) 101569
J. Domingo-Prim, et al.
In vitro differentiation assay
cDNA from cells collected one week after virus expression was amplified simultaneously.
A functional differentiation test was performed in vitro by using the Human Pluripotent Stem Cell Functional Identification kit (cat# SC022, R&D Systems). After differentiation, cells were fixed and stained for the endoderm, mesoderm and ectoderm specific markers SOX17, Brachury and OTX2, respectively (Table 2).
Mycoplasma detection The presence of mycoplasma was regularly tested during the cell culture procedure by using the Mycoplasma Gel Detection Kit (cat# 4542, Biotools).
Immunocytochemistry
STR analysis
Cells were fixed in 4% paraformaldehyde for 15 min at room temperature (RT), washed twice with 1× PBS and simultaneously permeabilized and blocked with 0.3% Triton X-100, 10% sheep serum and 1% bovine serum albumin (BSA) in 1× PBS for 45 min. Cells were rinsed twice in 1% BSA in 1× PBS. Primary antibody incubation was performed at 4 °C, overnight in 1% BSA. Cells were then washed twice with 1× PBS and incubated with the appropriate secondary antibody for 1 h at RT, if needed (Table 2). Finally, cell nuclei were stained with DAPI (11000) at RT for 5 min, rinsed twice and visualized and captured using a Zeiss Axio Vert.A1 inverted microscope. Fluorescence images were then processed and quantified by ImageJ software.
DNA from fibroblasts and iPSC was extracted by the PureGene Blood Core Kit A (cat# 1042604, Qiagen) following manufacturers protocol for cultured cells. PCR multiplex amplification of 16 STR markers was performed with IDplex plus kit (Qiagen) and fragments were analyzed by capillary electrophoresis using an automated analyzer ABI3130 (ThermoFisher) (DNA Data, Biomedical Company). Data available with the authors. Key resources table
Unique stem cell line identifier
FRIMOi007-A
Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
PDE6C_FiPS4F1 Fundació de Recerca de l'Institut de Microcirurgia Ocular, Barcelona, Spain Esther Pomares, [email protected] iPSC Human Age: 42 Sex: Male Ethnicity: Caucasian Dermal fibroblasts Clonal Sendai virus Yes Hereditary Incomplete achromatopsia PDE6C on chromosome 10 q23.33 Mutation: c.1670G > A (p.Arg557Gln) N/A N/A N/A June 2019 http://www.isciii.es/ISCIII/es/contenidos/fd-el-instituto/fd-organizacion/fd-estructura-directiva/fd-subdireccion-general-investigacionterapia-celular-medicina-regenerativa/fd-centros-unidades/fd-banco-nacional-lineas-celulares/fd-lineas-celulares-disponibles/lineas-decelulas-iPS.shtml Patient informed consent was obtainedEthics approval was received from the Ethics Committee of Institut de Microcirurgia Ocular (170505_117)
Cell Source Clonality Method of reprogramming Genetic modification Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
RNA isolation and RT-PCR analysis Total RNA from 1 × 106 cells was obtained by using the RNeasy Protect Cell Mini Kit (cat# 74624, Qiagen), according to manufacturer's instructions in order to confirm the absence of reprogramming factors and clearance of Sendai virus. Once obtained, cDNA was generated by reverse transcription using Transcriptor High Fidelity cDNA Synthesis Kit (cat# 05091284001, Roche Diagnostics). The PCR was performed in a SimpliAmp Thermal Cycler (ThermoFisher) using the DNA AmpliTools Green Master Mix (cat# 4749, Biotools) under the following amplification conditions: Sendai virus genome and reprogramming factors were amplified by 40 cycles of 30 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C and GAPDH, used as a loading control, was amplified by a two-step PCR with 32 cycles of 20 s at 95 °C and 2 min at 63 °C. Primer sequences are given in Table 2. As a positive control for the expression of Sendai virus genome and reprogramming factors,
Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgements We thank the patient for the participation in this study, and R. Fernández and B. Belil for their collaboration. This work was supported by a grant from Fundació Bancària “la Caixa” (LCF/PR/PR17/ 11120006), Barcelona, Spain and the Fundació de Recerca de l'Institut de Microcirurgia Ocular Barcelona, Spain.
4
Stem Cell Research 40 (2019) 101569
J. Domingo-Prim, et al.
Appendix A. Supplementary data
patients with achromatopsia. Ophthalmic Genet. 39 (6), 678–683. Grau, T., Artemyev, N.O., Rosenberg, T., et al., 2011. Decreased catalytic activity and altered activation properties of PDE6C mutants associated with autosomal recessive achromatopsia. Hum. Mol. Genet. 20 (4), 719–730. Wiley, L.A., Burnight, E.R., Songstad, A.E., et al., 2015. Patient-specific induced pluripotent stem cells (iPSCs) for the study and treatment of retinal degenerative diseases. Prog. Retin. Eye Res. 44, 15–35.
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101569. References Abdelkader, E., Brandau, O., Bergmann, C., et al., 2018. Novel causative variants in
5
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of an induced pluripotent stem cell line (FRIMOi007-A) derived from an incomplete achromatopsia patient carrying a novel homozygous mutation in PDE6C gene
T
Judit Domingo-Prima,b, Víctor Abad-Moralesa,b, Marina Rieraa,b, Rafael Navarroa,c, ⁎ Borja Corcosteguia,c, Esther Pomaresa,b, a b c
Fundació de Recerca de l'Institut de Microcirurgia Ocular, Barcelona, Spain Departament de Genètica, Institut de Microcirurgia Ocular (IMO), Barcelona, Spain Departament de Retina, Institut de Microcirurgia Ocular (IMO), Barcelona, Spain
ABSTRACT
Incomplete achromatopsia (ACHM) is a disorder in which there is function defect of cone photoreceptors in the retina and individuals with such disease retain residual color vision. Here, we have generated an induced pluripotent stem cell (iPSC) line carrying a homozygous mutation in the PDE6C gene, already related with this vision disorder. Skin fibroblasts from a patient with incomplete ACHM were reprogrammed to iPSCs by the non-integrative Sendai-virus method. Finally, the iPSC line has been characterized expressing the pluripotency markers and being capable to differentiate to endoderm, mesoderm and ectoderm in vitro.
Resource utility The generation of an induced pluripotent stem cell (iPSC) line established from a patient affected by incomplete ACHM with a novel mutation in Phosphodiesterase 6C (PDE6C) gene facilitates the molecular study of such disease and becomes an excellent tool for the study of new treatments (Wiley et al., 2015). Resource details Incomplete ACHM reported cases due to PDE6C mutations are usually associated to autosomal recessive inheritance. Mutations at this gene that are related to incomplete ACHM reduce the phototransduction process (Grau et al., 2011). The patients present an initial loss of central vision, severe photophobia and color vision disturbances with variable clinical findings based on the residual functioning cones (Abdelkader et al., 2018). A 42-year-old male was clinically diagnosed for incomplete ACHM at Institut de Microcirurgia Ocular (IMO), Barcelona, based on standard ophthalmic evaluations, fundus autofluorescence imaging and optical coherence tomography, electroretinography and visual field tests. Moreover, the genetic analysis performed by whole-exome sequencing and focused on a panel of 224 genes responsible for inherited retinal dystrophies showed a homozygous variant, c.1670G > A (p.Arg557Gln), not previously described, in PDE6C gene and
⁎
phenotypically correlated with incomplete ACHM. In order to establish and determine whether this variant was the responsible for the disease, we performed a bioinformatic analysis for pathogenicity predictors (by SIFT, PolyPhen2, LRT, Mutation Taster, Mutation Assesor, FATHMM, MetaSVM, LoFtool, Fathmm-MKL, PROVEAN, M-CAP, Condel, SSF, MaxEnt, NNSPLICE, GeneSplicer, HSF), which showed that this variant has a very low population frequency (rs201309785, MAF = 0.00008, ExAC database) and that is highly deleterious. We have also studied the evolutive conservation of the variant position (by Genomic Evolutionary Rate Profiling, PhyloP, Grantham) finding that it affects a highly conserved aminoacid residue. Finally, we have verified the inheritance of the variant by a familial cosegregation analysis and confirmed that the variant is not present either in 232 chromosomes from a validated control population. In order to obtain the iPSCs, patient fibroblast cells were isolated from a skin biopsy. The fibroblasts cells were then reprogrammed using the reprogramming factors OCT3/4, SOX2, KLF4 and c-MYC transduced into the cells by non-integrative Sendai virus. After three weeks, individual colonies were manually picked and expanded. Finally, one of the selected colonies was characterized and validated for successful reprogramming (Table 1). The validation showed that generated iPSC line PDE6C_FiPS4F1 colonies were morphologically as typical human embryonic stem cells: polygonal, large and well-defined, with high nuclear/cytoplasmic ratio and prominent nucleoli (Fig. 1A). Moreover, the iPS cells displayed a normal male karyotype
Corresponding author at: C/ Josep Mª Lladó, 3, 08035 Barcelona, Spain. E-mail address: [email protected] (E. Pomares).
https://doi.org/10.1016/j.scr.2019.101569 Received 21 June 2019; Received in revised form 19 August 2019; Accepted 3 September 2019 Available online 04 September 2019 1873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 40 (2019) 101569
J. Domingo-Prim, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis: Immunocytochemistry Quantitative analysis: Immunocytochemistry Karyotype (G-banding) and resolution STR analysis Sequencing
Normal Positive for: NANOG, OCT4, SOX2, SSEA4, TRA1-60, TRA1-81
Fig. 1 panel A Fig. 1 panel F
Percentage of positive cells (n = 150): NANOG 93.6 %, OCT4 98.9 %, SOX2 95.3 %, SSEA4 66.6 %, TRA1-60 68.3 %, TRA1-81 47.7 % 46, XY Resolution 400–550 16 loci analyzed, all matching Homozygous, missense mutation
N/A
Mycoplasma Directed differentiation
Mycoplasma testing by PCR. Negative Positive OTX2 ectodermal staining, positive Brachyury mesodermal staining and positive SOX17 endodermal staining N/A N/A
Supplementary file Fig. 1 panel E
Genotype Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
N/A N/A
Fig. 1 panel B Available with the authors Fig. 1 panel D
N/A N/A
Fig. 1. Characterization of the iPSC line.
(46, XY) (Fig. 1B), were free of Sendai reprogramming factors (Fig. 1C) and carried the patient mutation c.1670G > A at the PDE6C gene in homozygosis (Fig. 1D). The DNA fingerprinting assay
performed with 16 different markers confirmed that the iPSC line had the same genetic background as the donor fibroblasts. In order to determine whether the cells had the potential to differentiate into
2
Stem Cell Research 40 (2019) 101569
J. Domingo-Prim, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry
Pluripotency Marker Pluripotency Marker Pluripotency Marker Pluripotency Marker Pluripotency Marker Pluripotency Marker Differentiation Marker Differentiation Marker Differentiation Marker Secondary antibody Secondary antibody
Antibody
Dilution
Company Cat # and RRID
Rabbit anti-OCT4 (Alexa Fluor 488 Conjugate) Rabbit anti-NANOG Mouse anti-SOX2(E-4) (Alexa Fluor 488 Conjugate) Mouse anti-SSEA4 (Alexa Fluor 488 Conjugate) Mouse anti-Tra-1-60 (Alexa Fluor 488 Conjugate) Mouse anti-Tra-1-81 (Alexa Fluor 488 Conjugate) Goat anti-OTX2 Goat anti-Brachyury Goat anti-SOX17 (NL557 Conjugate) Donkey anti-Goat IgG Alexa Fluor 488 Goat anti-Rabbit IgG Alexa Fluor 488
1:400 1:100 1:50 1:100 1:50 1:50 1:20 1:20 1:10 1:1000 1:1000
Cell Signaling Technology Cat# 5177S, RRID: AB_10693303 Cell Signaling Technology Cat# 4903P, RRID: AB_10559205 SantaCruz Biotechnology Cat# sc-365,823 AF488, RRID: AB_10842165 BD Pharmingen Cat# 560308, RRID: AB_1645371 BD Pharmingen Cat# 560173, RRID: AB_1645379 BD Pharmingen Cat# 560174, RRID: AB_1645380 R&D Systems Cat# AF1979, RRID: AB_2157172 R&D Systems Cat# AF2085, RRID: AB_2200235 R&D Systems Cat# NL1924R, RRID: AB_2195645 Thermo Fisher Scientific Cat# A32814, RRID: AB_2762838 Thermo Fisher Scientific Cat# A11008, RRID: AB_143165
Primers Target
Forward/Reverse primer (5′-3′)
Sendai virus detection
SeV, 181 bp
Transgene detection
KOS, 528 bp
Transgene detection
KLF4, 410 bp
Transgene detection
c-MYC, 532 bp
House-keeping gene
GAPDH, 983 bp
Mutation sequencing
PDE6C (c.1670G > A), 1154 bp
GGATCACTAGGTGATATCGAGC ACCAGACAAGAGTTTAAGAGATATGTATC ATGCACCGCTACGACGTGAGCGC ACCTTGACAATCCTGATGTGG TTCCTGCATGCCAGAGGAGCCC AATGTATCGAAGGTGCTCAA TAACTGACTAGCAGGCTTGTCG TCCACATACAGTCCTGGATGATGATG TGAAGGTCGGAGTCAACGGATTTGG CATGTAGGCCATGAGGTCCACCAC GCACATGGTGGTTCAGTGAATC CACCCTAAGTACTTTCCAATGTC
each of the three germ layers, we performed an in vitro functional differentiation test that proved that the cells could generate endoderm, mesoderm and ectoderm (Fig. 1E). In parallel, the pluripotency of the iPSC line was assessed by immunocytochemistry for Nanog, OCT4, SOX2, SSEA4, Tra1-60 and Tra1-81 markers (Fig. 1F). Cells were negative for Mycoplasm contamination (Suppl. Figure). Materials and methods
ml of FGF2 (cat# 233-FB, R&D Systems). Three weeks after reprogramming, 12 colonies were picked and transferred into MEFs-coated 24-well plate. Selected iPSC colonies were then expanded for six passages on MEFs, and afterwards moved to feeder-free conditions, onto Matrigel-coated plates (cat# CB 40230, Corning) in mTeSR1 medium (cat# 5850, StemCell Technologies) from passage seven. All cells were incubated at 37 °C in 5% CO2 and weekly subcultured 1:10 using 50 mM EDTA in phosphate buffered saline (PBS).
Reprogramming of skin fibroblasts
Karyotype analysis
Fibroblasts were obtained from skin biopsy and cultured in DMEM (cat# 11960077, Life Technologies) supplemented with 10% FBS (cat# 10082147, Life Technologies) and 1× penicillin-streptomycin (cat# 15140122, Life Technologies). Reprogramming was performed by the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (cat# A16518, ThermoFisher Scientific) following the manufacturer's instructions. Six days after virus transduction, 2 × 104 cells/well were seeded in 6-well plates coated with irradiated mouse embryonic fibroblasts (MEFs) (cat# A34181, ThermoFisher Scientific), and cultured in hES media, containing DMEM/Ham's F-12 (cat# 11320-033, Life Technologies) supplemented with 20% KSR (cat # 10828028 Life Technologies), 1× nonessential amino acids (cat# 11140076, Life Technologies), 1× penicillin-streptomycin, 1× glutamine (cat# 25030081, Life Technologies), 1× β-mercaptoethanol (cat# 21985023, Life Technologies), and 10 ng/
Karyotype was performed in iPSC at passage 8 on fifteen G-banded metaphase cells at 400–550 band resolution (Synlab Diagnosticos Globales). Mutation analysis Genomic DNA was isolated from iPSC using the PureGene Blood Core Kit A (cat# 1042604, Qiagen) following manufacturer's instructions. PCR amplification with specific primers flanking the PDE6C mutation (Table 2) was performed by a three-step PCR of 20 s at 95 °C, 30 s at 58 °C and 1 min at 72 °C for 35 cycles in a SimpliAmp Thermal Cycler (ThermoFisher), using DNA AmpliTools Green Master Mix (cat# 4749, Biotools). The resulting PCR products were sequenced by Sanger (Macrogen).
3
Stem Cell Research 40 (2019) 101569
J. Domingo-Prim, et al.
In vitro differentiation assay
cDNA from cells collected one week after virus expression was amplified simultaneously.
A functional differentiation test was performed in vitro by using the Human Pluripotent Stem Cell Functional Identification kit (cat# SC022, R&D Systems). After differentiation, cells were fixed and stained for the endoderm, mesoderm and ectoderm specific markers SOX17, Brachury and OTX2, respectively (Table 2).
Mycoplasma detection The presence of mycoplasma was regularly tested during the cell culture procedure by using the Mycoplasma Gel Detection Kit (cat# 4542, Biotools).
Immunocytochemistry
STR analysis
Cells were fixed in 4% paraformaldehyde for 15 min at room temperature (RT), washed twice with 1× PBS and simultaneously permeabilized and blocked with 0.3% Triton X-100, 10% sheep serum and 1% bovine serum albumin (BSA) in 1× PBS for 45 min. Cells were rinsed twice in 1% BSA in 1× PBS. Primary antibody incubation was performed at 4 °C, overnight in 1% BSA. Cells were then washed twice with 1× PBS and incubated with the appropriate secondary antibody for 1 h at RT, if needed (Table 2). Finally, cell nuclei were stained with DAPI (11000) at RT for 5 min, rinsed twice and visualized and captured using a Zeiss Axio Vert.A1 inverted microscope. Fluorescence images were then processed and quantified by ImageJ software.
DNA from fibroblasts and iPSC was extracted by the PureGene Blood Core Kit A (cat# 1042604, Qiagen) following manufacturers protocol for cultured cells. PCR multiplex amplification of 16 STR markers was performed with IDplex plus kit (Qiagen) and fragments were analyzed by capillary electrophoresis using an automated analyzer ABI3130 (ThermoFisher) (DNA Data, Biomedical Company). Data available with the authors. Key resources table
Unique stem cell line identifier
FRIMOi007-A
Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
PDE6C_FiPS4F1 Fundació de Recerca de l'Institut de Microcirurgia Ocular, Barcelona, Spain Esther Pomares, [email protected] iPSC Human Age: 42 Sex: Male Ethnicity: Caucasian Dermal fibroblasts Clonal Sendai virus Yes Hereditary Incomplete achromatopsia PDE6C on chromosome 10 q23.33 Mutation: c.1670G > A (p.Arg557Gln) N/A N/A N/A June 2019 http://www.isciii.es/ISCIII/es/contenidos/fd-el-instituto/fd-organizacion/fd-estructura-directiva/fd-subdireccion-general-investigacionterapia-celular-medicina-regenerativa/fd-centros-unidades/fd-banco-nacional-lineas-celulares/fd-lineas-celulares-disponibles/lineas-decelulas-iPS.shtml Patient informed consent was obtainedEthics approval was received from the Ethics Committee of Institut de Microcirurgia Ocular (170505_117)
Cell Source Clonality Method of reprogramming Genetic modification Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
RNA isolation and RT-PCR analysis Total RNA from 1 × 106 cells was obtained by using the RNeasy Protect Cell Mini Kit (cat# 74624, Qiagen), according to manufacturer's instructions in order to confirm the absence of reprogramming factors and clearance of Sendai virus. Once obtained, cDNA was generated by reverse transcription using Transcriptor High Fidelity cDNA Synthesis Kit (cat# 05091284001, Roche Diagnostics). The PCR was performed in a SimpliAmp Thermal Cycler (ThermoFisher) using the DNA AmpliTools Green Master Mix (cat# 4749, Biotools) under the following amplification conditions: Sendai virus genome and reprogramming factors were amplified by 40 cycles of 30 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C and GAPDH, used as a loading control, was amplified by a two-step PCR with 32 cycles of 20 s at 95 °C and 2 min at 63 °C. Primer sequences are given in Table 2. As a positive control for the expression of Sendai virus genome and reprogramming factors,
Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgements We thank the patient for the participation in this study, and R. Fernández and B. Belil for their collaboration. This work was supported by a grant from Fundació Bancària “la Caixa” (LCF/PR/PR17/ 11120006), Barcelona, Spain and the Fundació de Recerca de l'Institut de Microcirurgia Ocular Barcelona, Spain.
4
Stem Cell Research 40 (2019) 101569
J. Domingo-Prim, et al.
Appendix A. Supplementary data
patients with achromatopsia. Ophthalmic Genet. 39 (6), 678–683. Grau, T., Artemyev, N.O., Rosenberg, T., et al., 2011. Decreased catalytic activity and altered activation properties of PDE6C mutants associated with autosomal recessive achromatopsia. Hum. Mol. Genet. 20 (4), 719–730. Wiley, L.A., Burnight, E.R., Songstad, A.E., et al., 2015. Patient-specific induced pluripotent stem cells (iPSCs) for the study and treatment of retinal degenerative diseases. Prog. Retin. Eye Res. 44, 15–35.
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101569. References Abdelkader, E., Brandau, O., Bergmann, C., et al., 2018. Novel causative variants in
5