Generation of dynorphin knockout mice

Molecular Brain Research 86 (2001) 70–75 www.elsevier.com / locate / bres

Research report

Generation of dynorphin knockout mice Nima Sharifi a , Nicole Diehl a , Linda Yaswen a , Miles B. Brennan b , Ute Hochgeschwender c , * a

Unit on Molecular Genetics, Clinical Neuroscience Branch, NIMH, 49 Convent Drive, Bethesda, MD 20892, USA b Eleanor Roosevelt Institute, 1899 Gaylord Street, Denver, CO 80206, USA c Developmental Biology Program, Oklahoma Medical Research Foundation, 825 NE 13 th Street, Oklahoma City, OK 73104, USA Accepted 10 October 2000

Abstract The opioid system has important roles in controlling pain, reward and addiction, and is implicated in numerous other processes within and outside the nervous system, such as mood states, immune responses, and prenatal developmental processes. The effects of the opioid system are mediated by at least three ligands, enkephalin, endorphin, and dynorphin, which act through the opioid receptors m, d, and k. In order to dissect the roles of individual components of the opioid system, mutant mice lacking single ligands or receptors are instrumental. We report here on the generation and initial characterization of a mutant mouse strain lacking pre-prodynorphin. Dynorphin ‘knockout’ mice are viable, healthy, and fertile and show no overt behavioral differences to wildtype littermates. Dynorphin knockout mice constitute a valuable tool for many research areas, among them research into pain, substance abuse, and epilepsy.  2001 Elsevier Science B.V. All rights reserved. Theme: Neurotransmitters, modulators, transporters, and receptors Topic: Opioids: anatomy, physiology and behavior Keywords: Homologous targeting; Mouse; RT / PCR

1. Introduction After the identification of opiate binding sites in mammalian brain, the search for endogenous ligands for these receptors identified endorphins, enkephalins, and dynorphins as major endogenous opiates [1]. More recently, novel peptides have been isolated from brain that may represent a new class of endogenous opioids [28]. The ‘classical’ endogenous opiate peptides derive from precursor proteins, which are coded for by three separate genes. The endorphins arise from proopiomelanocortin (POMC). The two enkephalins, leu-enkephalin and metenkephalin, are pentapeptides differing at their C-termini, possessing either leucine or methionine. Both enkephalins are derived from the precursor proenkephalin (PENK). The dynorphins are derived from the precursor prodynorphin (PDYN), which shows considerable amino acid sequence homology with proenkephalin. At least six peptides are *Corresponding author. Tel.: 11-405-271-7318; fax: 11-405-2717220. E-mail address: [email protected] (U. Hochgeschwender).

encoded by the preprodynorphin gene, three of them overlapping. These are alpha-neoendorphin, beta-neoendorphin, dynorphin A, dynorphin A-17, dynorphin B, and dynorphin B-29 [2,5,21]. The physiological actions of endogenous opiates are mediated by three receptor classes, m-, d-, and k-receptors, each of which is encoded by a separate gene (Oprm, Oprd1, and Oprk1, respectively) [10]. These three classical opiate receptors are G protein receptors, and are highly homologous to each other. The endogenous opiates can react with more than one receptor but generally with different affinities. In general, the m-, d-, and k-receptors bind endorphins, enkephalins, and dynorphins, respectively. The endogenous opioids and their receptors are highly expressed in different regions of the brain and spinal cord as well as in some peripheral tissues [14]. The opioid system has been implicated in the control of pain [3] and stress responses [1], as well as in aspects of behavior, including learning and memory, and autonomic, endocrine, and immune responses [26]. Furthermore, genes of the opioid system are known to be transcribed during develop-

0169-328X / 01 / $ – see front matter  2001 Elsevier Science B.V. All rights reserved. PII: S0169-328X( 00 )00264-3

N. Sharifi et al. / Molecular Brain Research 86 (2001) 70 – 75

ment, suggesting a role of this system in regulating developmental processes [16]. To assess the roles of the opioid system in vivo, multiple components of this system have been disrupted by gene targeting in embryonic stem cells to generate mutant mouse strains lacking the respective ligand or receptor. In this way mutant strains lacking each of the three opiate receptors, m [15,17,20,24,25], d [30], and k [23], have been generated, as well as strains lacking two of the three endogenous opiates, enkephalin [11] and endorphin [18,27]. The availability of mutant strains lacking single components of the opioid system allows the analysis of each individual component; in compound mutants, they allow an assessment of the system as a whole. Analysis of the available mutant mouse strains thus far suggests that each component of the opioid system has important roles in a wide range of physiological functions, including analgesia, stress responses, emotional responses, hematopoiesis, and reproduction [4,11,15,17,18,20,23–25,30]. We add to this analytical arsenal a mutant mouse strain lacking the endogenous opiate dynorphin.

71

exponential amplification of a 1.2 kb fragment, indicative of successful targeting. Of the 474 G418-resistant ES cell clones screened, 7 showed a homologous targeting event. High molecular weight DNA of these candidate clones was prepared and subjected to detailed Southern analyses, using standard techniques [19].

2.3. Generation of Pdyn mutant mice ES cell clones which had successfully passed the Southern analyses were injected into C57Bl / 6 blastocysts, followed by reimplantation into pseudopregnant recipient females [8]. High level chimeric males were mated to wildtype C57Bl / 6 females to test for germline transmission of the mutated allele. Upon identification as germline transmitter the male chimera ([275) was then mated to wildtype 129SvEv-Tac females in order to maintain the Pdyn null mutation on a homogeneous genetic background. Heterozygous mice were further mated to generate homozygous mutants. All experiments were carried out in accordance with the IACUC policies at NIMH or OMRF.

2. Materials and methods

2.4. RT /PCR analyses

2.1. Construction of targeting vector

Whole brains from wildtype and mutant littermates were homogenized in RNAzol (Tel-Test, Friendswood, Texas) and total RNA was DNAse treated and reverse transcribed using oligo d(T) primers and AMV-RT as described [21]. A fraction of the cDNA from these reactions was used in PCR assays using the following primers: Dynorphin, exon 3: 59GTGCAGTGAGGATTCAGGATGGG and exon 4: 59 GAGCTTGGCTAGTGCACTGTAGC; Enkephalin, exon 2: 59 CTAAATGC ACGTACCGCCTGGTT and exon 3: 59 CGATGTTATCCCAAGGGAACTCG; Proopiomelanocortin, exon 3: 59 GCTTGCATCCGGGCTTGCAAACT and 59 AGCAACGTTGGGGTACACCTT; Glucose-6Phosphate Dehydrogenase, exon 11: 59 TGTGAAGCTCCCTGATGCCTATG and exon 13: 59CTTCATCAGCTCATCTGCCTCTG. PCR products were run out on a 2% agarose gel with ethidium bromide and gels were photographed.

We previously isolated and characterized the mouse Pdyn gene [21]. Plasmid subclones containing either exon 3 or exon 4 were digested with EcoRI and BamHI (exon 3 subclone) or with BamHI and PstI (exon 4 subclone) and a 3.8 kb EcoRI-BamHI ‘long arm’ and a 1.2 kb BamHI-PstI ‘short arm’ were isolated. The long arm and short arm were ligated 59 and 39, respectively, to a BamHI fragment containing the SV40 enhancer, tk promoter, and the neomycin gene (pAB5; [27]). This selection cassette does not carry its own polyadenylation signal, but rather uses the polyadenylation signal from the targeted locus. The resulting Pdyn targeting vector lacks the entire exon 3, and all coding region of exon 4 as well as 1 kb of 39 untranslated region of exon 4 (see Fig. 1A).

2.2. Homologous targeting of the mouse Pdyn locus Embryonic stem cells J1 [12] were electroporated with the linearized targeting vector at 20 mg DNA per 10 7 cells. After 2 weeks of G418 selection, 540 individual G418resistant clones were picked into 96-well plates. DNA prepared from these individual clones was subjected to PCR analyses, using one primer from the 39 end of the neomycin gene (MB5: 59 ATCCAGGAAACCAGCAGCGGCTAT) and one primer from the Pdyn locus past the 39 end of the targeting vector (TC2: 59 ATTCAGACACATCCCACATAAGGACA). Homologous integration of the targeting vector at the mouse Pdyn locus allows the

3. Results

3.1. Targeting and analysis of embryonic stem cells The targeting vector was constructed using genomic subclones containing exons 3 and 4 of the mouse Pdyn gene [21]. The 3.8 kb EcoRI-BamHI fragment and the 1.2 kb BamHI-PstI fragment from the mouse Pdyn locus were fused 59 and 39, respectively, to the neomycin cassette pAB5 [27], resulting in a deletion of exon 3 and of all of the coding region as well as 1 kb of 39 untranslated region

72 N. Sharifi et al. / Molecular Brain Research 86 (2001) 70 – 75 Fig. 1. Homologous targeting of the Pdyn locus. (A) Schematic drawing of the wildtype allele containing exons 3 and 4 of the mouse Pdyn locus, the targeting vector, and the mutant allele upon homologous integration of the targeting vector. The arrows under the mutant allele indicate the locations of PCR primers used for identifying homologous integration: one primer is located within the neomycin cassette, the other primer is located within the genomic locus outside of the 39 end of the targeting vector. Only homologous recombination, but not random integration, of the targeting vector will allow amplification of a defined PCR fragment. (B) Southern blot analysis for single integration event. DNA from wildtype ES cell line J1, and from homologously targeted ES cell lines 41, 243, and 275 was used with the restriction enzyme (RE) EcoRI. The probe was the neomycin cassette. In an EcoRI digest this probe is expected to light up a 4.4 kb band, which is internal to the targeting vector, and a 2.7 kb band, which is indicative of a homologous recombination event. While all three targeted clones show homologous integration (i.e. the 4.4 kb and the 2.7 kb band), two of the clones (41 and 243) show additional integrations in random places of the genome. (C) Southern blot analysis for intact 39 integration. Probing a Southern blot of BamHI digested ES cell DNA with the PstI-EcoRI fragment reveals a single 2.4 kb wildtype band in the wildtype ES cell line J1 as well as in the targeted ES cells lines 14, 247, and 275, indicating a clean integration of the targeting vector at its 39 end. (D) Southern blot analysis for intact 59 integration. Probing a Southern blot of BamHI digested ES cell DNA with the KpnI-BamHI fragment reveals a single 6.7 kb wildtype band in the wildtype ES cell line J1 as well as in the targeted ES cells lines 14, 229, and 275, again indicating a clean integration of the targeting vector at its 59 end. (E) Southern blot analysis of DNA from homozygous mutant mice (22), and wildtype (11) and heterozygous (12) littermates. The BamHI-PstI fragment was used as a probe, showing complete absence of the wildtype allele in the homozygous mutant.

N. Sharifi et al. / Molecular Brain Research 86 (2001) 70 – 75

of exon 4 of the Pdyn gene (Fig. 1a). Embryonic stem (ES) cells (J1 [12]) were electroporated with this construct, G418-resistant clones were isolated and screened by PCR for homologous integration. G418-resistant clones positive after the PCR screening were subjected to detailed genomic Southern analyses (Fig. 1b–d). The first question was whether the clones had only one homologous integrant. It is not a rare event that targeting vectors integrate at random sites in addition to the homologous site, creating potential unwanted mutations. Therefore Southern blots of the seven ES cell candidates’ DNA digested with EcoRI were probed with the sequences of the selection cassette, specifically a radioactively labeled neomycin gene fragment. This results in a 4.4 kb fragment from the targeting vector, a 2.8 kb fragment upon homologous integration of the targeting vector, and no other fragment unless the targeting vector also integrated at non-homologous site(s). Fig. 1b shows examples of clones which only have the expected 4.4 kb and 2.7 kb bands and clones which have the two expected bands plus additional bands. Clone 275 has the desired pattern (single homologous integration) while clones 41 and 243 have additional undesired integrations (i.e. random integrations in addition to the homologous integration); J1 DNA is from non-targeted ES cells and thus does not have any neomycin sequences. We further wanted to ensure that the homologous integration of the targeting vector occurred without unwanted rearrangements at either its 59 or its 39 ends (Fig. 1c and d). Again, these rearrangements have been observed and are another source of unwanted mutations in the targeted ES cell clones. BamHI-digested ES cell DNAs were electrophoresed and blotted and the blots were probed with labeled DNA hybridizing to fragments spanning the 59 and 39 integration junctions of the targeting vector, respectively. There were no additional rearrangements (e.g. duplications) upon homologous integration of the targeting vector for clone 275 and the other clones shown (Fig. 1c and d).

3.2. Generation of a mouse mutant strain lacking preprodynorphin ES cell clones which passed the rigorous Southern analyses were injected into blastocysts, and resulting chimeras were tested for transmission through the germline. Clone 275 resulted in the generation of strain Dyn tm3ute , which was propagated by breeding the germline transmitting chimera to 129 / SvEv-Tac mice, thus maintaining the mutation on a homogeneous genetic background. DNAs from homozygous mutant, heterozygous, and wildtype littermates were digested with EcoRI, and a Southern blot of these was probed with the short arm of the targeting vector. DNAs from heterozygous mice show both the 3.7 kb wildtype fragment and the 2.7 kb fragment from the mutant allele, shortened due to an EcoRI site in the neomycin cassette. The homozygous mutants show the

73

2.7 kb fragment only, while the wildtype show the 3.7 kb band only (Fig. 1e).

3.3. Analysis of mutant mice lacking preprodynorphin Mice heterozygous for the Pdyn null allele were indistinguishable from wildtype littermates on initial analysis. Breeding of heterozygotes resulted in transmission of the null allele according to the expected Mendelian distribution. Homozygous mutant mice lacking dynorphin do not show any obvious impairments compared to heterozygous and wildtype littermates with respect to cage behavior, growth, weight, fertility, and longevity. Dynorphin knockout mice show the typical pattern of lightcycledependent activity, with wheel running and food consumption during the dark cycle (data not shown). When observed in their home cages, dynorphin knockout mice do not display any obvious behavioral abnormalities, such as seizures, running in circles or other repetitive motions, aggression towards cage mates, or any increases or decreases in general locomotion compared to wildtype littermates. More detailed analyses using a telemetry system for continuous recordings over extended periods of time are currently underway to uncover potentially subtle differences in dynorphin knockout versus wildtype mice. There are no differences with respect to growth rate, body length, or body weight between dynorphin knockout and wildtype animals (data not shown). Breeder pairs of mutant males and females generate litters of normal sizes (5–8 pups) and at the expected frequency (every 3–4 weeks). Pups are cared for in a manner indistinguishable from wildtype breeders with respect to nesting, grooming, and feeding. Dynorphin mutants have normal life spans of well over a year of lifetime, indistinguishable from wildtype 129SvEv littermates. To assess gross changes in gene expression of other ligands of the opioid system, we isolated and reverse transcribed RNA from whole brain of homozygous mutants and wildtype littermates and assayed for mRNAs of dynorphin, enkephalin, and proopiomelanocortin (Fig. 2). The RT / PCR product for dynorphin is, as expected, absent in the mutant. The RT / PCR product for POMC is slightly diminished in the mutant relative to the wildtype; further in situ analyses are needed to determine in which regions of the brain and to what extent there is differential expression of POMC in dynorphin null mice. Furthermore, it will be interesting to assess opioid binding of the different opioid receptors in the brain in Pdyn mutant mice compared to wildtype mice.

4. Discussion We report the generation of a novel mutant mouse strain lacking preprodynorphin. The Pdyn knockout mouse is viable and shows no overt phenotypic alterations compared

74

N. Sharifi et al. / Molecular Brain Research 86 (2001) 70 – 75

Fig. 2. Expression of opioid genes in the brain. Total mRNA from brain of homozygous mutant mice and from wildtype littermates was reverse transcribed and used as template in a PCR with primers from exons of the genes for glucose-6-phosphate-dehydrogenase (G6PD), dynorphin (DYN), enkephalin (ENK), and proopiomelanocortin (POMC). Except for POMC the PCR primers are from exons separated by one intron. PCR templates were reverse transcribed DNA from dynorphin null mice (lane 1), and from wildtype littermates (lane 2), mouse genomic DNA (lane 3), and water as control (lane 4). The dynorphin null mouse lacks dynorphin mRNA and has a slightly reduced level of POMC mRNA.

to its wildtype littermates. This is in accordance with findings for null mutant mice of the other ‘classical’ endogenous opioids (enkephalin [11] and endorphin [18]) as well as for mutants of the three opioid receptors [4,15,17,20,23–25,30]. The Pdyn null mice constitute an in vivo model system to test the role of dynorphin in pain and other processes. Mice lacking individual gene products of the opioid system have no major developmental aberrations. This is intriguing in light of findings that all genes of the opioid system are transcribed during development. In the mouse, developmental expression of Pdyn starts around embryonic day 12.5 and increases steeply to embryonic day 14.5 [21]. In situ hybridization analysis of the developing mouse embryo revealed the kappa opioid receptor as the first opioid receptor expressed, with transcripts detected in the gut epithelium as early as embryonic day 9.5 [29]. The expression of dynorphin ligand [21] and receptor [29] at early stages during prenatal mouse development suggests that early developmental events may be modulated by dynorphin. There are several explanations for a lack of overt developmental aberrations in opioid system knockout mice. If endogenous opioids indeed operate during development as a ‘system’, lack of single components might be too subtle to lead to obvious phenotypes; compound mutants lacking both a ligand and its major receptor, or all ligands and / or all receptors may answer this question. It is also possible that developmental absences underlie the changes observed in pain perception or emotional behavior in adult mutant mice. Equally possible, developmental aberrations have not been uncovered due to a lack of appropriate experimental assays capturing the resulting phenotype. Dynorphin is thought to be the preferred endogenous ligand for the k opioid receptor (KOR) [6]. Analysis of mutant mice lacking KOR revealed a modulatory role of this receptor in specific aspects of opioid function [23]. Specifically, the nociceptive threshold in response to visceral chemical pain is lowered, as evaluated in the abdominal constriction test [23]. In this assay the group of

mutant mice showed a significant increase in the number of writhes induced by acetic acid as compared with their wildtype littermates. Mutant mice showed no differences compared to wildtype mice in pain perception to other nociceptive stimuli, including inflammatory, mechanical, and thermal pain. Furthermore, the locomotor, analgesic and dysphoric effects of the prototypic k-agonist, U50,488H, is essentially mediated by the Oprk1 product [23]. Finally, the physical dependence on morphine is attenuated in k-receptor knockout mice [23]. It will be interesting to see whether the changes observed in KOR mutant mice are replicated in the dynorphin null mutant mice, allowing to conclude that dynorphin is indeed the major ligand for the k-receptor. In addition to pain, in the adult organism dynorphin has been implicated in substance abuse [9], epilepsy [22], as well as in other processes, such as learning and memory [7], or immune cell functions [13]. The Pdyn null mutant mouse offers the opportunity to test the hypotheses about its functions derived from physiological, pharmacological, and behavioral analyses.

Acknowledgements We thank S. Bui for technical assistance, M. Flynn for art work, and E.I. Ginns for support of the work. N.S. was supported by a pre-doctoral intramural research training award (NIMH).

References [1] H. Akil, S.J. Watson, E. Young, M.E. Lewis, H. Khachaturian, J.M. Walker, Endogenous opioids: biology and function, Annu. Rev. Neurosci. 7 (1984) 223–255. [2] O. Civelli, J. Douglass, A. Goldstein, E. Herbert, Sequence and expression of the rat prodynorphin gene, Proc. Natl. Acad. Sci. USA 82 (1985) 4291–4295. [3] A.H. Dickenson, Mechanisms of the analgesic actions of opiates and opioids, Br. Med. Bull. 47 (1991) 690–702.

N. Sharifi et al. / Molecular Brain Research 86 (2001) 70 – 75 [4] D. Filliol, S. Ghozland, J. Chluba, M. Martin, H.W. Matthes, F. Simonin, K. Befort, C. Gaveriaux-Ruff, A. Dierich, M. LeMeur, O. Valverde, R. Maldonado, B.L. Kieffer, Mice deficient for delta- and &mgr;-opioid receptors exhibit opposing alterations of emotional responses, Nature Genet. 25 (2000) 195–200. [5] T. Geijer, M. Telkov, L. Terenius, Characterization of human prodynorphin gene transcripts, Biochem. Biophys. Res. Commun. 215 (1995) 881–888. [6] A. Goldstein, A. Naidu, Multiple opioid receptors: ligand selectivity profiles and binding site signatures, Mol. Pharmacol. 36 (1989) 265–272. [7] M. Hiramatsu, T. Kameyama, Roles of kappa-opioid receptor agonists in learning and memory impairment in animal models, Methods Find. Exp. Clin. Pharmacol. 20 (1998) 595–599. [8] B. Hogan, R. Beddington, F. Costantini, E. Lacy, Manipulating the Mouse Embryo, 2nd Edition, Cold Spring Harbor Laboratory Press, 1994. [9] Y.L. Hurd, P. Svensson, M. Ponten, The role of dopamine, dynorphin, and CART systems in the ventral striatum and amygdala in cocaine abuse, Ann. NY Acad. Sci. 877 (1999) 499–506. [10] B.L. Kieffer, Recent advances in molecular recognition and signal transduction of active peptides: receptors for opioid peptides, Cell. Mol. Neurobiol. 15 (1995) 615–635. [11] M. Konig, A.M. Zimmer, H. Steiner, P.V. Holmes, J.N. Crawley, M.J. Brownstein, A. Zimmer, Pain responses, anxiety and aggression in mice deficient in pre-proenkephalin, Nature 383 (1996) 535–538. [12] E. Li, T.H. Bestor, R. Jaenisch, Targeted mutation of the DNA methyltransferase gene results in embryonic lethality, Cell 69 (1992) 915–926. [13] H.H. Loh, A.P. Smith, N.M. Lee, Effects of opioids on proliferation of mature and immature immune cells, Adv. Exp. Med. Biol. 335 (1993) 29–33. [14] A. Mansour, S.J. Watson, Anatomical distribution of opioid receptors in mammalian brain: an overview, in: A. Herz (Ed.), Handbook of Experimental Pharmacology, Opioids I, Vol. 104 / I, Springer-Verlag, Berlin, 1993, pp. 79–105. [15] H.W. Matthes, R. Maldonado, F. Simonin, O. Valverde, S. Slowe, I. Kitchen, K. Befort, A. Dierich, M. Le Meur, P. Dolle, E. Tzavara, J. Hanoune, B.P. Roques, B.L. Kieffer, Loss of morphine-induced analgesia, reward effect and withdrawal symptoms in mice lacking the mu-opioid-receptor gene, Nature 383 (1996) 819–823. [16] J.E. Pintar, R.E. Scott, Ontogeny of mammalian opioid systems, in: A. Herz (Ed.), Handbook of Experimental Pharmacology, Opioids I, Vol. 104 / I, Springer Verlag, Berlin, 1993, pp. 711–727. [17] S. Roy, R.A. Barke, H.H. Loh, MU-opioid receptor-knockout mice: role of mu-opioid receptor in morphine mediated immune functions, Brain. Res. Mol. Brain Res. 61 (1998) 190–194. [18] M. Rubinstein, J.S. Mogil, M. Japon, E.C. Chan, R.G. Allen, M.J.

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26] [27]

[28]

[29]

[30]

75

Low, Absence of opioid stress-induced analgesia in mice lacking beta-endorphin by site-directed mutagenesis, Proc. Natl. Acad. Sci. USA 93 (1996) 3995–4000. J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989. A.G. Schuller, M.A. King, J. Zhang, E. Bolan, Y.X. Pan, D.J. Morgan, A. Chang, M.E. Czick, E.M. Unterwald, G.W. Pasternak, J.E. Pintar, Retention of heroin and morphine-6 beta-glucuronide analgesia in a new line of mice lacking exon 1 of MOR-1, Nat. Neurosci. 2 (1999) 151–156. N. Sharifi, M. Ament, M.B. Brennan, U. Hochgeschwender, Isolation and characterization of the mouse homolog of the preprodynorphin (Pdyn) gene, Neuropeptides 33 (1999) 236–238. M. Simonato, P. Romualdi, Dynorphin and epilepsy [published erratum appears in Prog Neurobiol 1997 Feb;51(2):223–4, Prog. Neurobiol. 50 (1996) 557–583. F. Simonin, O. Valverde, C. Smadja, S. Slowe, I. Kitchen, A. Dierich, M. Le Meur, B.P. Roques, R. Maldonado, B.L. Kieffer, Disruption of the kappa-opioid receptor gene in mice enhances sensitivity to chemical visceral pain, impairs pharmacological actions of the selective kappa-agonist U-50,488H and attenuates morphine withdrawal, Embo J. 17 (1998) 886–897. I. Sora, N. Takahashi, M. Funada, H. Ujike, R.S. Revay, D.M. Donovan, L.L. Miner, G.R. Uhl, Opiate receptor knockout mice define mu receptor roles in endogenous nociceptive responses and morphine-induced analgesia, Proc. Natl. Acad. Sci. USA 94 (1997) 1544–1549. M. Tian, H.E. Broxmeyer, Y. Fan, Z. Lai, S. Zhang, S. Aronica, S. Cooper, R.M. Bigsby, R. Steinmetz, S.J. Engle, A. Mestek, J.D. Pollock, M.N. Lehman, H.T. Jansen, M. Ying, P.J. Stambrook, J.A. Tischfield, L. Yu, Altered hematopoiesis, behavior, and sexual function in mu opioid receptor-deficient mice, J. Exp. Med. 185 (1997) 1517–1522. A.L. Vaccarino, G.A. Olson, R.D. Olson, A.J. Kastin, Endogenous opiates: 1998, Peptides 20 (1999) 1527–1574. L. Yaswen, N. Diehl, M.B. Brennan, U. Hochgeschwender, Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin, Nat. Med. 5 (1999) 1066–1070. J.E. Zadina, L. Hackler, L.J. Ge, A.J. Kastin, A potent and selective endogenous agonist for the mu-opiate receptor, Nature 386 (1997) 499–502. Y. Zhu, M.S. Hsu, J.E. Pintar, Developmental expression of the mu, kappa, and delta opioid receptor mRNAs in mouse, J. Neurosci. 18 (1998) 2538–2549. Y. Zhu, M.A. King, A.G. Schuller, J.F. Nitsche, M. Reidl, R.P. Elde, E. Unterwald, G.W. Pasternak, J.E. Pintar, Retention of supraspinal delta-like analgesia and loss of morphine tolerance in delta opioid receptor knockout mice, Neuron 24 (1999) 243–252.