- Email: [email protected]
Generation of hiPSC line TCIERi001-A from normal human epidermal keratinocytes
Journal Pre-proof
Generation of hiPSC line TCIERi001-A from normal human epidermal keratinocytes Rupendra Shrestha , Yao-Tseng Wen , Rong-Kung Tsai M.D., Ph.D. Professor and Director PII: DOI: Reference:
S1873-5061(19)30220-X https://doi.org/10.1016/j.scr.2019.101590 SCR 101590
To appear in:
Stem Cell Research
Received date: Revised date: Accepted date:
20 May 2019 10 September 2019 17 September 2019
Please cite this article as: Rupendra Shrestha , Yao-Tseng Wen , Rong-Kung Tsai M.D., Ph.D. Professor and Direc Generation of hiPSC line TCIERi001-A from normal human epidermal keratinocytes, Stem Cell Research (2019), doi: https://doi.org/10.1016/j.scr.2019.101590
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license. (http://creativecommons.org/licenses/by-nc-nd/4.0/)
Lab Resource: Stem Cell Line
Title: Generation of hiPSC line TCIERi001-A from normal human epidermal keratinocytes
Authors: Rupendra Shrestha1,2, Yao-Tseng Wen2, Rong-Kung Tsai1,2*
Affiliations: 1Institute of Medical Sciences, Tzu Chi University, Hualien 970, Taiwan; 2
Institute of Eye Research, Hualien Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation,
Hualien 970, Taiwan.
*Corresponding Author Rong-Kung Tsai, M.D., Ph.D. Professor and Director, Institute of Medical Sciences, Tzu Chi University, Hualien 970, Taiwan Institute of Eye Research, Hualien Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation, Hualien 970, Taiwan. Email: [email protected]
Abstract Human induced pluripotent stem cell (hiPSC) line TCIERi001-A was generated from normal human epidermal keratinocytes (NHEK) primary cell line with the nonintegrating system using Sendai reprogramming kit. Sendai particles were used to deliver the defined transcription factors that included three vector preparations, such as polycistronic KLF4– OCT3/4–SOX2, cMYC, and KLF4.
Resource Table Unique stem cell line identifier
TCIERi001-A
Alternative name(s) of stem cell line
IER-EK1
Institution
Institute of Eye Research, Hualien Tzu Chi Hospital, Hualien, Taiwan
Contact information of distributor
Rupendra Shrestha, [email protected] Yao-Tseng Wen, [email protected] Rong-Kung Tsai, [email protected]
Type of cell line
Induced Pluripotent Stem Cells
Origin
Human
Additional origin info
Age: Adult Sex: Female Ethnicity if known: N/A
Cell Source
Epidermal Keratinocytes
Clonality
Clonal
Method of reprogramming
CytoTune™-iPS 2.0 Sendai reprogramming kit (Invitrogen,
Carlsbad,
CA,
USA,
cat.
No.
A16517) Genetic Modification
NO
Type of Modification
N/A
Associated disease
N/A
Gene/locus
N/A
Method of modification
N/A
Name of transgene or resistance
N/A
Inducible/constitutive system
N/A
Date archived/stock date
April, 2017
Cell line repository/bank
https://hpscreg.eu/cell-line/TCIERi001-A
Ethical approval
Normal Human Epidermal Keratinocytes (NHEK) adult,
single
donor
(PromoCell
Heidelberg, Germany, cat. No. C-12003).
GmbH,
Resource utility hiPSCs derived from normal epidermal keratinocytes was used to generate the ectodermal derivatives, such as retinal organoids and retinal pigment epithelium as a source of therapeutic cells.
Resource details Normal human epidermal keratinocytes (NHEK) primary cell line was purchased from PromoCell GmbH (cat. No. 12003) and maintained in EpiLife medium containing human keratinocytes growth supplement (HKGS). Non-integrative reprogramming system was performed using commercially available CytoTune™-iPS 2.0 Sendai reprogramming kit. The system contains Sendai virus particles to deliver defined transcription factors into cells that contain three vector preparations, such as polycistronic KLF4–OCT3/4–SOX2, cMYC, and KLF4. The experimental timeline for the generation of hiPSCs from epidermal keratinocytes is illustrated in Fig.1A. Morphologically identical round hiPSC colonies (Fig. 1B, scale bar 200 μm) with tightly packed cells were observed within 10-12 days. Immunofluorescence analysis of colonies demonstrated the expression of pluripotency markers such as OCT4, SOX2, SSEA4, NANOG, and TRA1-60 (Fig. 1B, scale bar 200 μm). Further, counting of immunofluorescence positive cells showed 94.9% of OCT4, 94.6% of SOX2, 95.8% of NANOG, 94.7% of SSEA4, and 94.9% of TRA1-60 expression in TCIERi001-A (Fig. 1C, supplementary Table 1). Also, the relative expression normalized with β-actin (ACTB) for pluripotency-associated endogenous genes, such as OCT4, SOX2, and
NANOG were
confirmed using quantitative PCR (Fig. 1E). hiPSC line was negative at passage 10 for Sendai viral vector (SeV) and transgenes expression (KOS, KLF4, cMYC) confirmed by RTPCR (Fig. 1D). In vitro differentiation of hiPSCs into embryoid body (EB) (Fig. 1G, scale bar
200 μm) was used as a standard functional assay alternative to teratoma assay to assess the ability of hiPSC to form an amalgam of developmental germ layers. Immunohistochemical analysis also revealed the expression of markers for mesoderm (BRACHYURY), endoderm (GATA4) and ectoderm (NESTIN) (Fig. 1G, scale bar 150 μm). Chromosomal analysis of hiPSC at passage 4 showed the normal diploid karyotype (46,XX) (Fig. 1F) and investigation of copy number variations (CNV) demonstrated the normal genomic integrity (Fig. 1H). Absence of mycoplasma contamination of the hiPSC at passage 4 and epidermal keratinocytes was confirmed by RT-PCR (supplementary Fig. 1). Also, short tandem repeat (STR) analysis with all 16 loci tested confirmed the same number of repeats identical between hiPSCs and parental NHEK cell line. Furthermore, hiPSC-derived EBs were tested for the differentiation potential to form ectodermal derivatives and successfully generated the retinal organoids (BRN3A/AP2α), and retinal cells, such as retinal pigment epithelium cells (OCCLUDIN) and retinal ganglion cells (BRN3A/TUBB3) (Fig. 1I, scale bar 200 μm).
Materials and Methods Keratinocytes culture and iPSC generation NHEK primary cell line was purchased from PromoCell GmbH (Heidelberg, Germany) and maintained in type I collagen (Invitrogen, USA) precoated plates containing EpiLife medium (Invitrogen, USA) supplemented with HKGS (Invitrogen, USA). Keratinocytes were reprogrammed using CytoTune-iPS 2.0 Sendai reprogramming kit as described previously (Shrestha et al., 2019). For the reprogramming experiment, 5 × 104 cells were seeded in the precoated 6-well plates containing EpiLife medium without antibiotics. Once, 30-40% confluency was achieved with small clusters of 5-6 keratinocytes; the cells were transduced with a cocktail of three vector preparations at an MOI of 4:4:2, KLF4–OCT3/4– SOX2:cMYC:KLF4 in the prewarmed EpiLife medium. After 24 h post infection, the cells
were washed with 1X Dulbecco’s PBS (-Ca2+/Mg2+) (Gibco, USA) and fed with fresh EpiLife medium. At day 7, the cells were passaged with TrypLE (Gibco, USA) and 2 × 104 cells/well were seeded onto rhVTN-N (Gibco, USA)-coated plates in EpiLife medium. Next day onward, the cells were fed daily with chemically defined E8 medium (Gibco, USA) containing 10 μM Y-27632 (Merck Millipore, USA) in feeder-free condition. At approximately 10–12 days, hiPSC colonies were manually picked and dissociated using 0.5mM EDTA (Invitrogen, USA). These dissociated cells were clonally expanded on freshly prepared vitronectin-coated plates. Further, hiPSCs were expanded at the split ratio of 1:6 every 5-6 days. The cells were cultured in standard growth conditions at 37°C in a 5% CO2 incubator.
In vitro formation of embryoid bodies and trilineage differentiation hiPSC colonies were dissociated into small clumps using 0.5 mM EDTA and cultured in suspension with chemically defined E8 medium containing 10 μM Y-27632 in ultralow adhesion 6-well plates (Corning, Lowell, MA, USA). On the following day, the cells clumped to form EBs-like hiPSC aggregates. The EBs were maintained in suspension for 10 days. After that, Cryosection of EBs were performed as described previously (Shrestha et al., 2019) and immunofluorescence staining was done to examine the expression of three germ layer markers.
Differentiation of hiPSC-derived EBs to ectodermal derivatives Differentiation into ectodermal derivatives was performed as described previously (Shrestha et al., 2019), EBs were differentiated into morphologically identical optic cups (OCs) and/or bipotent retinal progenitor cells (BRPCs). These cells were cultured in a suspension containing retinal differentiation medium (RDM) to form organoids. Further, OCs were used
for the generation of retinal neurons, and BRPCs with centrally pigmented cells were harvested to produce RPE cells.
Immunofluorescence analysis Cells were fixed with 4% paraformaldehyde for 30 min at RT, washed twice and incubated in blocking buffer (1.5% BSA, 0.05% gelatin, 0.25% Triton X 100, 0.025% Tween 20) for 45 min at RT. The cells were then treated with primary antibodies (diluted in 1.5% BSA) at 4°C for overnight. Next day, the cells were washed and then treated with Alexa Fluor-conjugated secondary antibodies (diluted in 1.5% BSA) for 1 h in the dark at RT. Again, the cells were washed and counterstained with DAPI (Sigma, St. Louis, MO, USA). A final wash was performed, mounted with DPX (Sigma, St. Louis, MO, USA) and coverslipped. Fluorescence images were acquired using an A1+ confocal microscope (Nikon). Antibodies that were used are listed in Table 2 (see reagent details).
RT-PCR analysis for SeV vectors Total RNA was extracted from hiPSCs at passage 10 using PureLink Mini kit (Invitrogen, CA, USA) according to manufacturer recommended protocol. Then, cDNA was synthesized from 1 μg RNA using iScript cDNA synthesis kit (Bio-Rad, USA). Then, cDNA was amplified with OnePCR reaction mixture (GeneDirex), and SeV-specific primers. Standard RT-PCR was performed on the Mastercycler Gradient 96 Thermocycler (Eppendorf Scientific) following optimized PCR conditions of 35 cycles: 94 °C × 30 s for denaturation, 55 °C × 30 s for annealing and 72 °C × 30 s for extension. The detection of transgenes expression was analyzed using agarose gel electrophoresis. NHEK cells transfected with Sendai viral vector for 6 days was used as positive control.
Quantitative real-time polymerase chain reaction (qPCR) cDNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, USA) and amplified for qPCR with an Fast SYBRTM Green Master Mix (Applied Biosystems, Thermo Fisher Scientific) and primers for pluripotency genes as listed in Table 2 (see reagent details). The qPCR was performed with a QuantStudio 3 (Applied Biosystems, Thermo Fisher Scientific). ACTB was used to normalize the relative expression of pluripotency genes and compared the expression level with iPS 98A10.
Karyotype Brifiely, hiPSCs from passage 4 were cultured for overnight and arrested in a metaphase using Colcemid as described previously (Shrestha et al., 2019). Further, 12 metaphase were analyzed at 400 band resolution using a standard G-banded karyotyping.
Digital PCR Pluri Test Genomic DNA was extracted from hiPSC in duplicate using a QIAamp DNA mini kit (QIAGEN GmbH, Germany) according to the manufacturer’s recommended protocol. Then, samples were sent to Stem Genomics—Bio-incubateur Cyborg—IRMB—Hôpital Saint Eloi, France to detect the copy number variations in hiPSCs. The test is based on the principle of using target-specific 24 probes in the chromosome.
Mycoplasma test DNA samples were sent to Department of Laboratory Medicine, Hualien Tzu Chi Hospital. Real-Time PCR was performed to detect 16S rRNA gene using standard laboratory developed test (LDT).
Short tandem repeat (STR) analysis DNA of both parental keratinocytes and hiPSCs were sent to GenePhile Bioscience Co., Ltd. Taipei, Taiwan for STR analysis. Loci tested were D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, AMEL, D5S818, and FGA.
Acknowledgment This research was funded by the Buddhist Tzu Chi Medical Foundation (Hualien, Taiwan) under research grant TCMMP104-05-01.
Conflict of Interest The authors have no conflicts of interest to declare.
References Shrestha, R., Wen, Y.-T., Ding, D.-C., Tsai, R.-K., 2019. Aberrant hiPSCs-Derived from Human Keratinocytes Differentiates into 3D Retinal Organoids that Acquire Mature Photoreceptors. Cells 8, E36. https://doi.org/10.3390/cells8010036
Table 1: Characterization and Validation Classification Morphology
Test Photography
Result Normal
Phenotype
Qualitative analysis Positive for pluripotency (Immunocytochemistry) markers: OCT4, NANOG, SOX2, SSEA4, TRA-1-60 Quantitative analysis Percentage of cell positive (immunofluorescence for pluripotency markers: counting and RT-PCR) TCIERi001-A: OCT4, 94.9%; SOX2, 94.6%; NANOG, 95.8%; SSEA4,
Data Figure 1 panel B Figure 1 panel B Figure 1 panel C and E supplementary Table 1
Genotype Identity
Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis
94.7%; TRA1-60, 94.9% Expression of pluripotency genes: OCT4, SOX2, and NANOG 46XX, Resolution 400 Figure 1 Normal panel F Not performed N/A 16 sites tested, all matched
available with authors N/A N/A
Mutation analysis (IF APPLICABLE) Microbiology and virology
Sequencing Not performed Southern Blot OR WGS Not performed Mycoplasma
Mycoplasma testing by real-time PCR: negative
supplementary Figure 1
Differentiation potential
Embryoid body formation and directed differentiation
Figure 1 Panel G and I
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Expression of germ layer markers (Endoderm: GATA4, Mesoderm: BRACHYURY, Ectoderm: NESTIN) Expression of retinal cell markers (BRN3A, AP2α, TUBB3, OCCLUDIN) Not performed Not performed
N/A
Not performed
N/A
N/A
Table 2: Reagents Details Antibodies used for immunocytochemistry Antibody Dilution Pluripotency Markers Goat anti-OCT4 1:200 Pluripotency Markers
Pluripotency Markers Pluripotency Markers
Mouse Alexa Fluor® 647 antiSOX2 Antibody Rabbit antiNANOG Mouse anti-SSEA4
1:200
1:200 1:300
Company Cat # and RRID Abcam Cat# ab27985, RRID: AB_776898 BioLegend Cat# 656108, RRID:AB_2563681 Millipore Cat# AB9220, RRID:AB_570613 Millipore Cat# MAB4304,
Pluripotency Markers Differentiation Markers Differentiation Markers Differentiation Markers Differentiation Markers Differentiation Markers Differentiation Markers Differentiation Markers Secondary Antibodies
Secondary Antibodies
Secondary Antibodies
Secondary Antibodies
Mouse anti-TRA1-60 Rabbit antiBrachyury Rabbit antiGATA4 Rabbit anti-Nestin
1:100
Rabbit antiOccludin Mouse anti-AP2α
1:200
Rabbit antiTUBB3
1:1000
Mouse anti-Brn3a
1:20
Donkey anti-Goat IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 488 Donkey anti-Goat IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 555 Donkey antiMouse IgG (H+L) Highly CrossAdsorbed Secondary Antibody, Alexa Fluor 488 Donkey antiMouse IgG (H+L) Highly CrossAdsorbed Secondary Antibody, Alexa
1:500
1:200 1:200 1:100
1:50
RRID:AB_177629 Thermo Fisher Scientific Cat# 41-1000, RRID:AB_2533494 Abcam Cat# ab20680, RRID:AB_727024 Millipore Cat# AB4132, RRID:AB_2108750 Sigma-Aldrich Cat# N5413, RRID:AB_1841032 Abcam Cat# ab31721, RRID:AB_881773 Thermo Fisher Scientific Cat# MA1-872, RRID:AB_2199412 Covance Research Products Inc Cat# PRB-435P-100, RRID:AB_291637 Millipore Cat# MAB1585, RRID:AB_94166 Thermo Fisher Scientific Cat# A-11055, RRID:AB_2534102
1:500
Thermo Fisher Scientific Cat# A-21432, RRID:AB_2535853
1:500
Thermo Fisher Scientific Cat# A-21202, RRID:AB_141607
1:500
Thermo Fisher Scientific Cat# A-31570, RRID:AB_2536180
Secondary Antibodies
Secondary Antibodies
Fluor 555 Donkey antiRabbit IgG (H+L) Highly CrossAdsorbed Secondary Antibody, Alexa Fluor 488 Donkey antiRabbit IgG (H+L) Highly CrossAdsorbed Secondary Antibody, Alexa Fluor 555
1:500
Thermo Fisher Scientific Cat# A-21206, RRID:AB_2535792
1:500
Thermo Fisher Scientific Cat# A-31572, RRID:AB_162543
Primers Sendai Virus (RT-PCR) Sendai Virus (RT-PCR) Sendai Virus (RT-PCR) Sendai Virus (RT-PCR) House-Keeping Gene (RT-PCR) Pluripotency Marker (qPCR) Pluripotency Marker (qPCR) Pluripotency Marker (qPCR) House-Keeping Gene (qPCR)
Target SeV
Forward/Reverse Primers (5′-3′) GGATCACTAGGTGATATCGAGC ACCAGACAAGAGTTTAAGAGATATGTATC
KOS
ATGCACCGCTACGACGTGAGCGC ACCTTGACAATCCTGATGTGG
KLF4
TTCCTGCATGCCAGAGGAGCCC AATGTATCGAAGGTGCTCAA
cMYC
TAACTGACTAGCAGGCTTGTCG TCCACATACAGTCCTGGATGATGATG
GAPDH
ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA
OCT4
CAGTGCCCGAAACCCACAC GGAGACCCAGCAGCCTCA
SOX2
GGGAAATGGGAGGGGTGCAAAAGAGG TTGCGTGAGTGTGGATGGGATTGGTG
NANOG
GAGAAGGCCTCAGCACCTAC ATTGTTCCAGGTCTGGTTGC
ACTB
AGAGCTACGAGCTGCCTGAC AGCACTGTGTTGGCGTACAG
Figure 1: Charcaterization of TCIERi001-A line
Generation of hiPSC line TCIERi001-A from normal human epidermal keratinocytes Rupendra Shrestha , Yao-Tseng Wen , Rong-Kung Tsai M.D., Ph.D. Professor and Director PII: DOI: Reference:
S1873-5061(19)30220-X https://doi.org/10.1016/j.scr.2019.101590 SCR 101590
To appear in:
Stem Cell Research
Received date: Revised date: Accepted date:
20 May 2019 10 September 2019 17 September 2019
Please cite this article as: Rupendra Shrestha , Yao-Tseng Wen , Rong-Kung Tsai M.D., Ph.D. Professor and Direc Generation of hiPSC line TCIERi001-A from normal human epidermal keratinocytes, Stem Cell Research (2019), doi: https://doi.org/10.1016/j.scr.2019.101590
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license. (http://creativecommons.org/licenses/by-nc-nd/4.0/)
Lab Resource: Stem Cell Line
Title: Generation of hiPSC line TCIERi001-A from normal human epidermal keratinocytes
Authors: Rupendra Shrestha1,2, Yao-Tseng Wen2, Rong-Kung Tsai1,2*
Affiliations: 1Institute of Medical Sciences, Tzu Chi University, Hualien 970, Taiwan; 2
Institute of Eye Research, Hualien Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation,
Hualien 970, Taiwan.
*Corresponding Author Rong-Kung Tsai, M.D., Ph.D. Professor and Director, Institute of Medical Sciences, Tzu Chi University, Hualien 970, Taiwan Institute of Eye Research, Hualien Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation, Hualien 970, Taiwan. Email: [email protected]
Abstract Human induced pluripotent stem cell (hiPSC) line TCIERi001-A was generated from normal human epidermal keratinocytes (NHEK) primary cell line with the nonintegrating system using Sendai reprogramming kit. Sendai particles were used to deliver the defined transcription factors that included three vector preparations, such as polycistronic KLF4– OCT3/4–SOX2, cMYC, and KLF4.
Resource Table Unique stem cell line identifier
TCIERi001-A
Alternative name(s) of stem cell line
IER-EK1
Institution
Institute of Eye Research, Hualien Tzu Chi Hospital, Hualien, Taiwan
Contact information of distributor
Rupendra Shrestha, [email protected] Yao-Tseng Wen, [email protected] Rong-Kung Tsai, [email protected]
Type of cell line
Induced Pluripotent Stem Cells
Origin
Human
Additional origin info
Age: Adult Sex: Female Ethnicity if known: N/A
Cell Source
Epidermal Keratinocytes
Clonality
Clonal
Method of reprogramming
CytoTune™-iPS 2.0 Sendai reprogramming kit (Invitrogen,
Carlsbad,
CA,
USA,
cat.
No.
A16517) Genetic Modification
NO
Type of Modification
N/A
Associated disease
N/A
Gene/locus
N/A
Method of modification
N/A
Name of transgene or resistance
N/A
Inducible/constitutive system
N/A
Date archived/stock date
April, 2017
Cell line repository/bank
https://hpscreg.eu/cell-line/TCIERi001-A
Ethical approval
Normal Human Epidermal Keratinocytes (NHEK) adult,
single
donor
(PromoCell
Heidelberg, Germany, cat. No. C-12003).
GmbH,
Resource utility hiPSCs derived from normal epidermal keratinocytes was used to generate the ectodermal derivatives, such as retinal organoids and retinal pigment epithelium as a source of therapeutic cells.
Resource details Normal human epidermal keratinocytes (NHEK) primary cell line was purchased from PromoCell GmbH (cat. No. 12003) and maintained in EpiLife medium containing human keratinocytes growth supplement (HKGS). Non-integrative reprogramming system was performed using commercially available CytoTune™-iPS 2.0 Sendai reprogramming kit. The system contains Sendai virus particles to deliver defined transcription factors into cells that contain three vector preparations, such as polycistronic KLF4–OCT3/4–SOX2, cMYC, and KLF4. The experimental timeline for the generation of hiPSCs from epidermal keratinocytes is illustrated in Fig.1A. Morphologically identical round hiPSC colonies (Fig. 1B, scale bar 200 μm) with tightly packed cells were observed within 10-12 days. Immunofluorescence analysis of colonies demonstrated the expression of pluripotency markers such as OCT4, SOX2, SSEA4, NANOG, and TRA1-60 (Fig. 1B, scale bar 200 μm). Further, counting of immunofluorescence positive cells showed 94.9% of OCT4, 94.6% of SOX2, 95.8% of NANOG, 94.7% of SSEA4, and 94.9% of TRA1-60 expression in TCIERi001-A (Fig. 1C, supplementary Table 1). Also, the relative expression normalized with β-actin (ACTB) for pluripotency-associated endogenous genes, such as OCT4, SOX2, and
NANOG were
confirmed using quantitative PCR (Fig. 1E). hiPSC line was negative at passage 10 for Sendai viral vector (SeV) and transgenes expression (KOS, KLF4, cMYC) confirmed by RTPCR (Fig. 1D). In vitro differentiation of hiPSCs into embryoid body (EB) (Fig. 1G, scale bar
200 μm) was used as a standard functional assay alternative to teratoma assay to assess the ability of hiPSC to form an amalgam of developmental germ layers. Immunohistochemical analysis also revealed the expression of markers for mesoderm (BRACHYURY), endoderm (GATA4) and ectoderm (NESTIN) (Fig. 1G, scale bar 150 μm). Chromosomal analysis of hiPSC at passage 4 showed the normal diploid karyotype (46,XX) (Fig. 1F) and investigation of copy number variations (CNV) demonstrated the normal genomic integrity (Fig. 1H). Absence of mycoplasma contamination of the hiPSC at passage 4 and epidermal keratinocytes was confirmed by RT-PCR (supplementary Fig. 1). Also, short tandem repeat (STR) analysis with all 16 loci tested confirmed the same number of repeats identical between hiPSCs and parental NHEK cell line. Furthermore, hiPSC-derived EBs were tested for the differentiation potential to form ectodermal derivatives and successfully generated the retinal organoids (BRN3A/AP2α), and retinal cells, such as retinal pigment epithelium cells (OCCLUDIN) and retinal ganglion cells (BRN3A/TUBB3) (Fig. 1I, scale bar 200 μm).
Materials and Methods Keratinocytes culture and iPSC generation NHEK primary cell line was purchased from PromoCell GmbH (Heidelberg, Germany) and maintained in type I collagen (Invitrogen, USA) precoated plates containing EpiLife medium (Invitrogen, USA) supplemented with HKGS (Invitrogen, USA). Keratinocytes were reprogrammed using CytoTune-iPS 2.0 Sendai reprogramming kit as described previously (Shrestha et al., 2019). For the reprogramming experiment, 5 × 104 cells were seeded in the precoated 6-well plates containing EpiLife medium without antibiotics. Once, 30-40% confluency was achieved with small clusters of 5-6 keratinocytes; the cells were transduced with a cocktail of three vector preparations at an MOI of 4:4:2, KLF4–OCT3/4– SOX2:cMYC:KLF4 in the prewarmed EpiLife medium. After 24 h post infection, the cells
were washed with 1X Dulbecco’s PBS (-Ca2+/Mg2+) (Gibco, USA) and fed with fresh EpiLife medium. At day 7, the cells were passaged with TrypLE (Gibco, USA) and 2 × 104 cells/well were seeded onto rhVTN-N (Gibco, USA)-coated plates in EpiLife medium. Next day onward, the cells were fed daily with chemically defined E8 medium (Gibco, USA) containing 10 μM Y-27632 (Merck Millipore, USA) in feeder-free condition. At approximately 10–12 days, hiPSC colonies were manually picked and dissociated using 0.5mM EDTA (Invitrogen, USA). These dissociated cells were clonally expanded on freshly prepared vitronectin-coated plates. Further, hiPSCs were expanded at the split ratio of 1:6 every 5-6 days. The cells were cultured in standard growth conditions at 37°C in a 5% CO2 incubator.
In vitro formation of embryoid bodies and trilineage differentiation hiPSC colonies were dissociated into small clumps using 0.5 mM EDTA and cultured in suspension with chemically defined E8 medium containing 10 μM Y-27632 in ultralow adhesion 6-well plates (Corning, Lowell, MA, USA). On the following day, the cells clumped to form EBs-like hiPSC aggregates. The EBs were maintained in suspension for 10 days. After that, Cryosection of EBs were performed as described previously (Shrestha et al., 2019) and immunofluorescence staining was done to examine the expression of three germ layer markers.
Differentiation of hiPSC-derived EBs to ectodermal derivatives Differentiation into ectodermal derivatives was performed as described previously (Shrestha et al., 2019), EBs were differentiated into morphologically identical optic cups (OCs) and/or bipotent retinal progenitor cells (BRPCs). These cells were cultured in a suspension containing retinal differentiation medium (RDM) to form organoids. Further, OCs were used
for the generation of retinal neurons, and BRPCs with centrally pigmented cells were harvested to produce RPE cells.
Immunofluorescence analysis Cells were fixed with 4% paraformaldehyde for 30 min at RT, washed twice and incubated in blocking buffer (1.5% BSA, 0.05% gelatin, 0.25% Triton X 100, 0.025% Tween 20) for 45 min at RT. The cells were then treated with primary antibodies (diluted in 1.5% BSA) at 4°C for overnight. Next day, the cells were washed and then treated with Alexa Fluor-conjugated secondary antibodies (diluted in 1.5% BSA) for 1 h in the dark at RT. Again, the cells were washed and counterstained with DAPI (Sigma, St. Louis, MO, USA). A final wash was performed, mounted with DPX (Sigma, St. Louis, MO, USA) and coverslipped. Fluorescence images were acquired using an A1+ confocal microscope (Nikon). Antibodies that were used are listed in Table 2 (see reagent details).
RT-PCR analysis for SeV vectors Total RNA was extracted from hiPSCs at passage 10 using PureLink Mini kit (Invitrogen, CA, USA) according to manufacturer recommended protocol. Then, cDNA was synthesized from 1 μg RNA using iScript cDNA synthesis kit (Bio-Rad, USA). Then, cDNA was amplified with OnePCR reaction mixture (GeneDirex), and SeV-specific primers. Standard RT-PCR was performed on the Mastercycler Gradient 96 Thermocycler (Eppendorf Scientific) following optimized PCR conditions of 35 cycles: 94 °C × 30 s for denaturation, 55 °C × 30 s for annealing and 72 °C × 30 s for extension. The detection of transgenes expression was analyzed using agarose gel electrophoresis. NHEK cells transfected with Sendai viral vector for 6 days was used as positive control.
Quantitative real-time polymerase chain reaction (qPCR) cDNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, USA) and amplified for qPCR with an Fast SYBRTM Green Master Mix (Applied Biosystems, Thermo Fisher Scientific) and primers for pluripotency genes as listed in Table 2 (see reagent details). The qPCR was performed with a QuantStudio 3 (Applied Biosystems, Thermo Fisher Scientific). ACTB was used to normalize the relative expression of pluripotency genes and compared the expression level with iPS 98A10.
Karyotype Brifiely, hiPSCs from passage 4 were cultured for overnight and arrested in a metaphase using Colcemid as described previously (Shrestha et al., 2019). Further, 12 metaphase were analyzed at 400 band resolution using a standard G-banded karyotyping.
Digital PCR Pluri Test Genomic DNA was extracted from hiPSC in duplicate using a QIAamp DNA mini kit (QIAGEN GmbH, Germany) according to the manufacturer’s recommended protocol. Then, samples were sent to Stem Genomics—Bio-incubateur Cyborg—IRMB—Hôpital Saint Eloi, France to detect the copy number variations in hiPSCs. The test is based on the principle of using target-specific 24 probes in the chromosome.
Mycoplasma test DNA samples were sent to Department of Laboratory Medicine, Hualien Tzu Chi Hospital. Real-Time PCR was performed to detect 16S rRNA gene using standard laboratory developed test (LDT).
Short tandem repeat (STR) analysis DNA of both parental keratinocytes and hiPSCs were sent to GenePhile Bioscience Co., Ltd. Taipei, Taiwan for STR analysis. Loci tested were D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, AMEL, D5S818, and FGA.
Acknowledgment This research was funded by the Buddhist Tzu Chi Medical Foundation (Hualien, Taiwan) under research grant TCMMP104-05-01.
Conflict of Interest The authors have no conflicts of interest to declare.
References Shrestha, R., Wen, Y.-T., Ding, D.-C., Tsai, R.-K., 2019. Aberrant hiPSCs-Derived from Human Keratinocytes Differentiates into 3D Retinal Organoids that Acquire Mature Photoreceptors. Cells 8, E36. https://doi.org/10.3390/cells8010036
Table 1: Characterization and Validation Classification Morphology
Test Photography
Result Normal
Phenotype
Qualitative analysis Positive for pluripotency (Immunocytochemistry) markers: OCT4, NANOG, SOX2, SSEA4, TRA-1-60 Quantitative analysis Percentage of cell positive (immunofluorescence for pluripotency markers: counting and RT-PCR) TCIERi001-A: OCT4, 94.9%; SOX2, 94.6%; NANOG, 95.8%; SSEA4,
Data Figure 1 panel B Figure 1 panel B Figure 1 panel C and E supplementary Table 1
Genotype Identity
Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis
94.7%; TRA1-60, 94.9% Expression of pluripotency genes: OCT4, SOX2, and NANOG 46XX, Resolution 400 Figure 1 Normal panel F Not performed N/A 16 sites tested, all matched
available with authors N/A N/A
Mutation analysis (IF APPLICABLE) Microbiology and virology
Sequencing Not performed Southern Blot OR WGS Not performed Mycoplasma
Mycoplasma testing by real-time PCR: negative
supplementary Figure 1
Differentiation potential
Embryoid body formation and directed differentiation
Figure 1 Panel G and I
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Expression of germ layer markers (Endoderm: GATA4, Mesoderm: BRACHYURY, Ectoderm: NESTIN) Expression of retinal cell markers (BRN3A, AP2α, TUBB3, OCCLUDIN) Not performed Not performed
N/A
Not performed
N/A
N/A
Table 2: Reagents Details Antibodies used for immunocytochemistry Antibody Dilution Pluripotency Markers Goat anti-OCT4 1:200 Pluripotency Markers
Pluripotency Markers Pluripotency Markers
Mouse Alexa Fluor® 647 antiSOX2 Antibody Rabbit antiNANOG Mouse anti-SSEA4
1:200
1:200 1:300
Company Cat # and RRID Abcam Cat# ab27985, RRID: AB_776898 BioLegend Cat# 656108, RRID:AB_2563681 Millipore Cat# AB9220, RRID:AB_570613 Millipore Cat# MAB4304,
Pluripotency Markers Differentiation Markers Differentiation Markers Differentiation Markers Differentiation Markers Differentiation Markers Differentiation Markers Differentiation Markers Secondary Antibodies
Secondary Antibodies
Secondary Antibodies
Secondary Antibodies
Mouse anti-TRA1-60 Rabbit antiBrachyury Rabbit antiGATA4 Rabbit anti-Nestin
1:100
Rabbit antiOccludin Mouse anti-AP2α
1:200
Rabbit antiTUBB3
1:1000
Mouse anti-Brn3a
1:20
Donkey anti-Goat IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 488 Donkey anti-Goat IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 555 Donkey antiMouse IgG (H+L) Highly CrossAdsorbed Secondary Antibody, Alexa Fluor 488 Donkey antiMouse IgG (H+L) Highly CrossAdsorbed Secondary Antibody, Alexa
1:500
1:200 1:200 1:100
1:50
RRID:AB_177629 Thermo Fisher Scientific Cat# 41-1000, RRID:AB_2533494 Abcam Cat# ab20680, RRID:AB_727024 Millipore Cat# AB4132, RRID:AB_2108750 Sigma-Aldrich Cat# N5413, RRID:AB_1841032 Abcam Cat# ab31721, RRID:AB_881773 Thermo Fisher Scientific Cat# MA1-872, RRID:AB_2199412 Covance Research Products Inc Cat# PRB-435P-100, RRID:AB_291637 Millipore Cat# MAB1585, RRID:AB_94166 Thermo Fisher Scientific Cat# A-11055, RRID:AB_2534102
1:500
Thermo Fisher Scientific Cat# A-21432, RRID:AB_2535853
1:500
Thermo Fisher Scientific Cat# A-21202, RRID:AB_141607
1:500
Thermo Fisher Scientific Cat# A-31570, RRID:AB_2536180
Secondary Antibodies
Secondary Antibodies
Fluor 555 Donkey antiRabbit IgG (H+L) Highly CrossAdsorbed Secondary Antibody, Alexa Fluor 488 Donkey antiRabbit IgG (H+L) Highly CrossAdsorbed Secondary Antibody, Alexa Fluor 555
1:500
Thermo Fisher Scientific Cat# A-21206, RRID:AB_2535792
1:500
Thermo Fisher Scientific Cat# A-31572, RRID:AB_162543
Primers Sendai Virus (RT-PCR) Sendai Virus (RT-PCR) Sendai Virus (RT-PCR) Sendai Virus (RT-PCR) House-Keeping Gene (RT-PCR) Pluripotency Marker (qPCR) Pluripotency Marker (qPCR) Pluripotency Marker (qPCR) House-Keeping Gene (qPCR)
Target SeV
Forward/Reverse Primers (5′-3′) GGATCACTAGGTGATATCGAGC ACCAGACAAGAGTTTAAGAGATATGTATC
KOS
ATGCACCGCTACGACGTGAGCGC ACCTTGACAATCCTGATGTGG
KLF4
TTCCTGCATGCCAGAGGAGCCC AATGTATCGAAGGTGCTCAA
cMYC
TAACTGACTAGCAGGCTTGTCG TCCACATACAGTCCTGGATGATGATG
GAPDH
ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA
OCT4
CAGTGCCCGAAACCCACAC GGAGACCCAGCAGCCTCA
SOX2
GGGAAATGGGAGGGGTGCAAAAGAGG TTGCGTGAGTGTGGATGGGATTGGTG
NANOG
GAGAAGGCCTCAGCACCTAC ATTGTTCCAGGTCTGGTTGC
ACTB
AGAGCTACGAGCTGCCTGAC AGCACTGTGTTGGCGTACAG
Figure 1: Charcaterization of TCIERi001-A line