- Email: [email protected]
Generation of human induced pluripotent stem cell (iPSC) lines from three patients with von Hippel-Lindau syndrome carrying distinct VHL gene mutations
Stem Cell Research 38 (2019) 101474
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Multiple Cell Lines
Generation of human induced pluripotent stem cell (iPSC) lines from three patients with von Hippel-Lindau syndrome carrying distinct VHL gene mutations Jens Schuster , Ambrin Fatima, Franziska Schwarz1, Joakim Klar, Loora Laan, Niklas Dahl ⁎
T
⁎
Uppsala University, Department of Immunology, Genetics and Pathology and Science for Life Laboratory, Uppsala, Sweden
ABSTRACT
Von Hippel-Lindau (VHL) syndrome is a familial cancer syndrome caused by mutations in the tumor suppressor gene VHL. We generated human iPSC lines from primary dermal fibroblasts of three VHL syndrome patients carrying distinct VHL germ line mutations (c.194C > G, c.194C > T and nt440delTCT, respectively). Characterization of the iPSC lines confirmed expression of pluripotency markers, trilineage differentiation potential and absence of exogenous vector expression. The three hiPSC lines were genetically stable and retained the VHL mutation of each donor. These iPSC lines, the first derived from VHL syndrome patients, offer a useful resource to study disease pathophysiology and for anti-cancer drug development.
Ethical approval
Resource table. Unique stem cell lines identifier Alternative names of stem cell lines Institution Contact information of distributor Type of cell lines Origin Cell Source Clonality Method of reprogramming Multiline rationale Gene modification Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank
UUIGPi001-A UUIGPi002-A UUIGPi003-A VHL2-10 (UUIGPi001-A) VHL3-9 (UUIGPi002-A) VHL4-10 (UUIGPi003-A) Uppsala University Jens Schuster, [email protected] Niklas Dahl, [email protected] Human induced pluripotent stem cells (hiPSC) Human Fibroblasts Clonal Sendai virus Same disease, non-isogenic cell lines YES Hereditary von Hippel-Lindau syndrome, OMIM #193300 von Hippel-Lindau tumor suppressor (VHL); chr3p25.3 N/A N/A N/A 2015 N/A
Obtained from Regional ethics committee, Uppsala, November 18, 2009. Registration number: 2009/319
Resource utility Little is known about the molecular pathophysiology in VHL syndrome (van Leeuwaarde et al., 2018). The iPSC lines presented herein offer a useful resource to study molecular mechanisms behind tumor progression and for drug development to improve treatment of patients with VHL syndrome. Resource details Von Hippel-Lindau (VHL) syndrome is characterized by various malignant and benign neoplasms mainly derived from the neural crest lineage (e.g. hemangioblastomas of the brain and spinal cord; renal cysts and clear cell renal carcinoma; pheochromocytoma, pancreatic cysts and neuroendocrine tumors; endolymphatic sac tumors) (van Leeuwaarde et al., 2018). The syndrome is caused by mutations in the tumor suppressor gene VHL and approximately 80% of cases are familial. The VHL protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF) that regulates gene expression by oxygen (Kaelin Jr., 2005). Detailed investigations of molecular mechanisms underlying disease pathophysiology and cancer progression in VHL, with the aim to develop novel drugs, have been hampered by lack of accessible human disease models. To this end, we
Corresponding authors. E-mail address: [email protected] (J. Schuster). 1 current address: Helmholtz-Zentrum Dresden-Rossendorf (HZDR) Institute of Radiooncology - OncoRay, Dresden, Germany. ⁎
https://doi.org/10.1016/j.scr.2019.101474 Received 29 April 2019; Received in revised form 11 May 2019; Accepted 28 May 2019 Available online 30 May 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 38 (2019) 101474
J. Schuster, et al.
Table 1 Summary of lines. iPSC line names
Abbreviation in figures
Gender
Age (years)
Ethnicity
VHL Genotype
Disease
VHL2-10 (UUIGPi001-A) VHL3-9 (UUIGPi002-A) VHL4-10 (UUIGPi003-A)
VHL2-10 VHL3-9 VHL4-10
male male male
19 37 30
Caucasian Caucasian Caucasian
c.194C > G; heterozygous c.194C > T; heterozygous nt440delTCT; heterozygous
von Hippel-Lindau syndrome von Hippel-Lindau syndrome von Hippel-Lindau syndrome
Table 2 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis (Immunocytochemistry) Qualitative analysis (scorecards)
All iPSC lines appear normal All iPSC lines are positive for pluripotency markers Nanog and Sox2 All lines are pluripotent and undifferentiated compared to a reference set of 23 PSC lines All iPSC lines are positive for cell surface markers TRA-1-60 (VHL2–10 99,3%; VHL3–9 89,5%; VHL4–10 91,4%) and SSEA4 (VHL2–10 99,6%; VHL3–9 96,6%; VHL4–10 97,0%) No acquired genomic aberrations detected DNA profiling performed for 16 polymorphic STRs All iPSC lines matched their corresponding donor fibroblast line iPSC lines retain the VHL mutation present in fibroblasts N/A All iPSC lines are negative
Fig. 1 panel A Fig. 1 panel C Fig. 1 panel F
Expression of all three germ layers detected after four weeks of differentiation N/A N/A N/A
Fig. 1 panel F
Quantitative analysis (Flow Cytometry) Genotype Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
CytoScan™HD array (resolution > 1 Mb) STR analysis (AmpFLSTR™ Identifiler™ PCR Amplification Kit) Sanger Sequencing Southern Blot OR WGS Mycoplasma testing by luminescence (MycoAlert Mycoplasma Detection Kit, Lonza). Embryoid body formation and differentiation followed by Scorecard analysis HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Fig. 1 panel B Supplementary File 1 Fig. 1 panel D Fig. 1 panel G Supplementary File 2
Table 3 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
Pluripotency Markers Pluripotency Markers Pluripotency Markers Pluripotency Markers Secondary Antibodies Secondary Antibodies Secondary Antibodies Secondary Antibodies
Antibody
Dilution
Company Cat # and RRID
Mouse IgG anti-NANOG Mouse IgG anti-SSEA4 Mouse IgM anti-TRA-1-60 Goat IgG anti-SOX2 AF488 Goat anti-mouse IgM AF555 Goat anti-mouse IgG AF647 donkey anti-mouse IgG AF488 donkey anti-goat IgG
1:200 1:100 1:100 1:500 1:1000 1:1000 1:1000 1:1000
Millipore Cat# MABD24, RRID:AB_11203826 Thermo Fisher Scientific Cat# 41-4000, RRID:AB_2533506 Thermo Fisher Scientific Cat# 41-1000, RRID:AB_2533494 R and D Systems Cat# AF2018, RRID:AB_355110 Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069 Thermo Fisher Scientific Cat# A-21426, RRID:AB_2535847 Thermo Fisher Scientific Cat# A-31571, RRID:AB_162542 Thermo Fisher Scientific Cat# A-11055, RRID:AB_2534102
Primers
SeV-F and SeV-R (RT/PCR) GAPDH-F and GAPDH-R (RT/PCR)
Target
Forward/Reverse primer (5′-3′)
Sendai virus genome Glyceraldehyde-3-phosphate dehydrogenase (pos control)
GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC TCCACCCATGGCAAATTCCA/AAATGAGCCCCAGCCTTCTC
identified three unrelated patients diagnosed with VHL syndrome caused by distinct heterozygous VHL germ-line mutations [c.194C > G (p.Ser65Trp), c.194C > T (p.Ser65Leu) and nt440delTCT (p.del76Phe), respectively]. We generated human iPSC lines from primary fibroblasts of each patient (VHL2-10, VHL3-9 and VHL4-10) using the Sendai virus reprogramming system (Tables 1–3). The three hiPSC lines VHL2-10, VHL3-9 and VHL4-10 were expanded as monolayers in tight colonies and showed typical iPSC morphology with large nucleus-to-cytoplasm ratio, prominent nuclei and defined luminescent borders as seen by Bright-field microscopy (Fig. 1A; size bar: 50 μm). Endogenous expression of the pluripotency markers Nanog, Sox2, TRA-1-60 and SSEA4 was demonstrated at protein level by immunocytochemistry and flow cytometry in the three hiPSC lines, respectively (Fig. 1C and B; size bar: 100 μm). Cell authentication using a set of 16 polymorphic short tandem repeats (STRs) confirmed that the
established iPSC lines matched the donor fibroblasts (data available upon request). Additionally, the three VHL syndrome patient derived hiPSC lines VHL2-10, VHL3-9 and VHL4-10 were confirmed free of Sendai reprogramming vector by RT/PCR (Fig. 1D). Analysis of the three hiPSC lines using scorecards confirmed an expression pattern of pluripotency markers corresponding to an undifferentiated state using a reference set of 23 pluripotent stem cell lines (Fig. 1E)(Fergus et al., 2016). In order to assess the differentiation potential of the three hiPSC, an embryoid body (EB) differentiation assay was performed. The expression of specific markers for ectoderm, mesoderm and endoderm was carried out by scorecard analysis. The analysis confirmed that the hiPSC lines are capable of differentiating into the three germ layers (Fig. 1E). Each of the hiPSC lines VHL2-10, VHL3-9 and VHL4-10 retained the pathogenic VHL gene variant (c.194C > G, c.194C > T and 2
Stem Cell Research 38 (2019) 101474
J. Schuster, et al.
A
TRA-1-60
B
VHL2-10
VHL3-9
VHL2-10 0,1% 99,2%
VHL3-9 0,0%
C
VHL4-10
VHL2-10 DAPI
NANOG
SOX2
Merge
VHL4-10 91,3% 0,1%
89,5%
VHL3-9
0,2%
0,4%
3,6%
3,0%
7,1%
DAPI
NANOG
SOX2
Merge
5,7%
pos. control
VHL4-10
VHL3-9
VHL2-10
VHL4-10
M
VHL3-9
-
VHL2-10
D
pos. control
SSEA4
-
M
VHL4-10 GAPDH
E
SeV
Sample Name Self-renewal
Ectoderm
Mesoderm
Endoderm
iPSC: VHL2-10
-0,59
0,01
-0,93
-0,86
EB: VHL2-10
-4,33
1,83
3,83
2,29
iPSC: VHL3-9
-0,12
0,44
-0,13
-1,03
EB: VHL3-9
-5,05
2,03
5,59
2,05
iPSC: VHL4-10
-0,98
0,52
-0,91
-0,98
EB: VHL4-10
-1,66
1,73
4,88
1,69
DAPI
NANOG
SOX2
Merge
Gene expression rela!ve to the reference standard Upregulated
x>1.5
F
Comparable
1.0
0.5
-0.5<=x<=0.5 -1.0<=x<-0.5
Downregulated
-1.5<=x<-1.0
x<-1.5
VHL2-10
VHL3-9
VHL4-10
[c.194C>G]
[c.194C>T]
[nt440delTTC]
Fig. 1. Characterization of the three VHL patient derived iPSC lines.
nt440delTCT, respectively) of the donor as confirmed by Sanger sequencing (Fig. 1F). Genomic integrity was investigated by CytoScan™HD DNA array and no acquired chromosomal aberration was detected in any of the three iPSC lines (Supplementary File 1) (Mills et al., 2011; Wong et al., 2007). All three iPSC lines tested free of Mycoplasma infection using MycoAlert™ Mycoplasma detection kit. The three different VHL syndrome patient derived iPSC lines generated here will offer a useful resource to study disease pathology, cancer progression and for drug development.
Materials and methods Culture conditions Fibroblasts were cultured in DMEM, Sigma cat no: D5796, 10% fetal bovine serum, ThermoFisher Scientific, cat no: 10500056, 2 mM GlutaMAX™, ThermoFisher Scientific, cat no: 35050038, 1% penicillin/ streptomycin, ThermoFisher Scientific, cat no: 15140122 in a humidified atmosphere with 5% CO2 at 37 °C and passaged using TrypLE™ 3
Stem Cell Research 38 (2019) 101474
J. Schuster, et al.
Express, ThermoFisher Scientific, cat no: 12604039, and Defined Trypsin Inhibitor, ThermoFisher Scientific, cat no: R007100. hiPS cells were cultured in Essential-8™ medium, ThermoFisher Scientific, cat no: A1517001, on Vitronectin-XF™, Stem Cell Technologies, cat no: 07180, coated plates (5%CO2, 37 °C) and passaged with Gentle Cell Dissociation Reagent, Stem Cell Technologies, cat no: 07174. hiPSC lines were subsequently adapted to culture on human Laminin-521, Biolamina, Cat no: LN-521, and passaged using TrypLE™ Expressand Defined Trypsin Inhibitor. For embryonic body formation hiPSC were dissociated with accutase, Sigma cat no: A6964, seeded into an AggreWell™400 plate, Stem Cell Technologies, cat no: 34421, in AggreWell™ medium, Stem Cell Technologies, cat no: 05893, supplemented with 10 μM Rho-kinase inhibitor Y27632, Stem Cell Technologies, cat no: 72304 according to protocol. Formed embryoid bodies were transferred to non-adherent culture plates and further differentiated for four weeks.
AF647, donkey anti-goat AF488) were incubated at room temperature for 60 min. Nuclear marker, DAPI (1 μg/ml), Sigma cat no: D8417 was incubated for 10 min at room temperature and specimens were mounted onto microscope slides using CFM-3 mounting medium, Citifluor. Specimens were imaged using an AxioImager (Zeiss).
Reprogramming
RNA was extracted (see RT-PCR) and quality was assessed by Agilent BioAnalyzer. Samples were run on TaqMan® hPSC Scorecard™ Panel, ThermoFisher Scientific, cat no: A15872/A15870 following manufacturer's protocol (Fergus et al., 2016). Scorecards were analysed with company's software at https://apps.thermofisher.com/ hPSCscorecard/home.htm.
Flow cytometry iPSCs were harvested with accutase, Sigma cat no: A6964 and washed in 1%BSA/1xPBS. Primary antibodies (mouse-IgG anti-SSEA4, mouse-IgM anti TRA-1-60) were incubated at room temperature for 30 min. Secondary antibodies (goat anti-mouse IgM AF488, goat antimouse IgG AF555) were incubated for 20 min at room temperature. Cells were analysed on a LSR-FORTESSA (BD). Scorecard assay
Fibroblasts were reprogrammed using CytoTune™-iPS 2.0 Sendai Reprogramming Kit, ThermoFisher Scientific, cat no: A16517, expressing the four Yamanaka factors hKlf4, hc-Myc, hSox2, hOct3/4. hiPSC colonies were manually picked for passage 1 to Vitronectin™-XL coated dishes and clonally expanded (see Culture conditions). Established hiPSC lines were adapted to culture on LN-521 (see Culture Conditions) past passage P10.
Mycoplasma Presence of mycoplasma in hiPSC lines was assessed on cell culture supernatants using MycoAlert™ Mycoplasma Detection kit, Lonza, cat no: LT07-318. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101474.
Cell authentication Cell authentication on DNA from fibroblasts and hiPSC lines was performed at Eurofins Genomics, Germany using AmpFLSTR™ Identifiler™ PCR Amplification Kit, ThermoFisher Scientific, cat no: 4322288.
Acknowledgements We thank the study participants. This work was supported by the Swedish Research Council 2015-02424 (to ND), Hjärnfonden FO20180100 (to ND) and the Sävstaholm Society (to LL). Image acquisition and flow cytometry were performed at the BioVis Platform and scorecard processing at the Genome Centre platform, Science for Life Laboratory, Uppsala University.
Genome stability Genome stability was analysed on DNA from the three hiPSC lines at Uppsala University Hospital, Clinical Genetics unit, Uppsala, using the CytoScan™HD Array, ThermoFisher Scientific, cat no: 901835. RT-PCR
References
RNA was isolated using miRNeasy micro kit, Qiagen, cat no: 217084. cDNA was synthesized using High Capacity cDNA Synthesis kit, ThermoFisher Scientific, cat no: 4368814 from 1 μg of total RNA. Detection of Sendai virus was performed by PCR on a “MyCycler” thermal cycler, BIORAD, by a total of 35 cycles (95 °C - 30 s, 55 °C 1 min, 72 °C - 1 min) with 1/10 of the cDNA reaction with primers SeVF and SeV-R. GAPDH was used as positive control. Samples were run without template as negative control. PCR products (expected sizes SeV: 195 bp (SeV), GAPDH: 325 bp) were visualized by 1% agarose gel electrophoresis. Ladder: GeneRuler 100 bp DNA ladder, ThermoFisher Scientific, cat no: SM0243.
Fergus, J., Quintanilla, R., Lakshmipathy, U., 2016. Characterizing pluripotent stem cells using the TaqMan(R) hPSC scorecard(TM) panel. Methods Mol. Biol. 1307, 25–37. Kaelin Jr., W.G., 2005. The von Hippel-Lindau protein, HIF hydroxylation, and oxygen sensing. Biochem. Biophys. Res. Commun. 338, 627–638. Mills, R.E., Walter, K., Stewart, C., Handsaker, R.E., Chen, K., Alkan, C., Abyzov, A., Yoon, S.C., Ye, K., Cheetham, R.K., Chinwalla, A., Conrad, D.F., Fu, Y., Grubert, F., Hajirasouliha, I., Hormozdiari, F., Iakoucheva, L.M., Iqbal, Z., Kang, S., Kidd, J.M., Konkel, M.K., Korn, J., Khurana, E., Kural, D., Lam, H.Y., Leng, J., Li, R., Li, Y., Lin, C.Y., Luo, R., Mu, X.J., Nemesh, J., Peckham, H.E., Rausch, T., Scally, A., Shi, X., Stromberg, M.P., Stutz, A.M., Urban, A.E., Walker, J.A., Wu, J., Zhang, Y., Zhang, Z.D., Batzer, M.A., Ding, L., Marth, G.T., McVean, G., Sebat, J., Snyder, M., Wang, J., Eichler, E.E., Gerstein, M.B., Hurles, M.E., Lee, C., McCarroll, S.A., Korbel, J.O., 2011. Mapping copy number variation by population-scale genome sequencing. Nature 470, 59–65. van Leeuwaarde, R.S., Ahmad, S., Links, T.P., Giles, R.H., May 17, 2000. Von HippelLindau Syndrome. In: Adam, M.P., Ardinger, H.H., Pagon, R.A. (Eds.), GeneReviews. University of Washington, Seattle (WA) (updated 2018 Sep 6). Wong, K.K., deLeeuw, R.J., Dosanjh, N.S., Kimm, L.R., Cheng, Z., Horsman, D.E., MacAulay, C., Ng, R.T., Brown, C.J., Eichler, E.E., Lam, W.L., 2007. A comprehensive analysis of common copy-number variations in the human genome. Am. J. Hum. Genet. 80, 91–104.
Immunofluorescence Cells were fixed in 4% formaldehyde for 5 min and pre-incubated in 1xPBS, 1%BSA, 0,3% TritonX100. Primary antibodies (mouse antiNANOG, rabbit anti-SOX2) were diluted in preincubation buffer and incubated at 4 °C overnight. Secondary antibodies (donkey anti-mouse
4
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Multiple Cell Lines
Generation of human induced pluripotent stem cell (iPSC) lines from three patients with von Hippel-Lindau syndrome carrying distinct VHL gene mutations Jens Schuster , Ambrin Fatima, Franziska Schwarz1, Joakim Klar, Loora Laan, Niklas Dahl ⁎
T
⁎
Uppsala University, Department of Immunology, Genetics and Pathology and Science for Life Laboratory, Uppsala, Sweden
ABSTRACT
Von Hippel-Lindau (VHL) syndrome is a familial cancer syndrome caused by mutations in the tumor suppressor gene VHL. We generated human iPSC lines from primary dermal fibroblasts of three VHL syndrome patients carrying distinct VHL germ line mutations (c.194C > G, c.194C > T and nt440delTCT, respectively). Characterization of the iPSC lines confirmed expression of pluripotency markers, trilineage differentiation potential and absence of exogenous vector expression. The three hiPSC lines were genetically stable and retained the VHL mutation of each donor. These iPSC lines, the first derived from VHL syndrome patients, offer a useful resource to study disease pathophysiology and for anti-cancer drug development.
Ethical approval
Resource table. Unique stem cell lines identifier Alternative names of stem cell lines Institution Contact information of distributor Type of cell lines Origin Cell Source Clonality Method of reprogramming Multiline rationale Gene modification Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank
UUIGPi001-A UUIGPi002-A UUIGPi003-A VHL2-10 (UUIGPi001-A) VHL3-9 (UUIGPi002-A) VHL4-10 (UUIGPi003-A) Uppsala University Jens Schuster, [email protected] Niklas Dahl, [email protected] Human induced pluripotent stem cells (hiPSC) Human Fibroblasts Clonal Sendai virus Same disease, non-isogenic cell lines YES Hereditary von Hippel-Lindau syndrome, OMIM #193300 von Hippel-Lindau tumor suppressor (VHL); chr3p25.3 N/A N/A N/A 2015 N/A
Obtained from Regional ethics committee, Uppsala, November 18, 2009. Registration number: 2009/319
Resource utility Little is known about the molecular pathophysiology in VHL syndrome (van Leeuwaarde et al., 2018). The iPSC lines presented herein offer a useful resource to study molecular mechanisms behind tumor progression and for drug development to improve treatment of patients with VHL syndrome. Resource details Von Hippel-Lindau (VHL) syndrome is characterized by various malignant and benign neoplasms mainly derived from the neural crest lineage (e.g. hemangioblastomas of the brain and spinal cord; renal cysts and clear cell renal carcinoma; pheochromocytoma, pancreatic cysts and neuroendocrine tumors; endolymphatic sac tumors) (van Leeuwaarde et al., 2018). The syndrome is caused by mutations in the tumor suppressor gene VHL and approximately 80% of cases are familial. The VHL protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF) that regulates gene expression by oxygen (Kaelin Jr., 2005). Detailed investigations of molecular mechanisms underlying disease pathophysiology and cancer progression in VHL, with the aim to develop novel drugs, have been hampered by lack of accessible human disease models. To this end, we
Corresponding authors. E-mail address: [email protected] (J. Schuster). 1 current address: Helmholtz-Zentrum Dresden-Rossendorf (HZDR) Institute of Radiooncology - OncoRay, Dresden, Germany. ⁎
https://doi.org/10.1016/j.scr.2019.101474 Received 29 April 2019; Received in revised form 11 May 2019; Accepted 28 May 2019 Available online 30 May 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 38 (2019) 101474
J. Schuster, et al.
Table 1 Summary of lines. iPSC line names
Abbreviation in figures
Gender
Age (years)
Ethnicity
VHL Genotype
Disease
VHL2-10 (UUIGPi001-A) VHL3-9 (UUIGPi002-A) VHL4-10 (UUIGPi003-A)
VHL2-10 VHL3-9 VHL4-10
male male male
19 37 30
Caucasian Caucasian Caucasian
c.194C > G; heterozygous c.194C > T; heterozygous nt440delTCT; heterozygous
von Hippel-Lindau syndrome von Hippel-Lindau syndrome von Hippel-Lindau syndrome
Table 2 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis (Immunocytochemistry) Qualitative analysis (scorecards)
All iPSC lines appear normal All iPSC lines are positive for pluripotency markers Nanog and Sox2 All lines are pluripotent and undifferentiated compared to a reference set of 23 PSC lines All iPSC lines are positive for cell surface markers TRA-1-60 (VHL2–10 99,3%; VHL3–9 89,5%; VHL4–10 91,4%) and SSEA4 (VHL2–10 99,6%; VHL3–9 96,6%; VHL4–10 97,0%) No acquired genomic aberrations detected DNA profiling performed for 16 polymorphic STRs All iPSC lines matched their corresponding donor fibroblast line iPSC lines retain the VHL mutation present in fibroblasts N/A All iPSC lines are negative
Fig. 1 panel A Fig. 1 panel C Fig. 1 panel F
Expression of all three germ layers detected after four weeks of differentiation N/A N/A N/A
Fig. 1 panel F
Quantitative analysis (Flow Cytometry) Genotype Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
CytoScan™HD array (resolution > 1 Mb) STR analysis (AmpFLSTR™ Identifiler™ PCR Amplification Kit) Sanger Sequencing Southern Blot OR WGS Mycoplasma testing by luminescence (MycoAlert Mycoplasma Detection Kit, Lonza). Embryoid body formation and differentiation followed by Scorecard analysis HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Fig. 1 panel B Supplementary File 1 Fig. 1 panel D Fig. 1 panel G Supplementary File 2
Table 3 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
Pluripotency Markers Pluripotency Markers Pluripotency Markers Pluripotency Markers Secondary Antibodies Secondary Antibodies Secondary Antibodies Secondary Antibodies
Antibody
Dilution
Company Cat # and RRID
Mouse IgG anti-NANOG Mouse IgG anti-SSEA4 Mouse IgM anti-TRA-1-60 Goat IgG anti-SOX2 AF488 Goat anti-mouse IgM AF555 Goat anti-mouse IgG AF647 donkey anti-mouse IgG AF488 donkey anti-goat IgG
1:200 1:100 1:100 1:500 1:1000 1:1000 1:1000 1:1000
Millipore Cat# MABD24, RRID:AB_11203826 Thermo Fisher Scientific Cat# 41-4000, RRID:AB_2533506 Thermo Fisher Scientific Cat# 41-1000, RRID:AB_2533494 R and D Systems Cat# AF2018, RRID:AB_355110 Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069 Thermo Fisher Scientific Cat# A-21426, RRID:AB_2535847 Thermo Fisher Scientific Cat# A-31571, RRID:AB_162542 Thermo Fisher Scientific Cat# A-11055, RRID:AB_2534102
Primers
SeV-F and SeV-R (RT/PCR) GAPDH-F and GAPDH-R (RT/PCR)
Target
Forward/Reverse primer (5′-3′)
Sendai virus genome Glyceraldehyde-3-phosphate dehydrogenase (pos control)
GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC TCCACCCATGGCAAATTCCA/AAATGAGCCCCAGCCTTCTC
identified three unrelated patients diagnosed with VHL syndrome caused by distinct heterozygous VHL germ-line mutations [c.194C > G (p.Ser65Trp), c.194C > T (p.Ser65Leu) and nt440delTCT (p.del76Phe), respectively]. We generated human iPSC lines from primary fibroblasts of each patient (VHL2-10, VHL3-9 and VHL4-10) using the Sendai virus reprogramming system (Tables 1–3). The three hiPSC lines VHL2-10, VHL3-9 and VHL4-10 were expanded as monolayers in tight colonies and showed typical iPSC morphology with large nucleus-to-cytoplasm ratio, prominent nuclei and defined luminescent borders as seen by Bright-field microscopy (Fig. 1A; size bar: 50 μm). Endogenous expression of the pluripotency markers Nanog, Sox2, TRA-1-60 and SSEA4 was demonstrated at protein level by immunocytochemistry and flow cytometry in the three hiPSC lines, respectively (Fig. 1C and B; size bar: 100 μm). Cell authentication using a set of 16 polymorphic short tandem repeats (STRs) confirmed that the
established iPSC lines matched the donor fibroblasts (data available upon request). Additionally, the three VHL syndrome patient derived hiPSC lines VHL2-10, VHL3-9 and VHL4-10 were confirmed free of Sendai reprogramming vector by RT/PCR (Fig. 1D). Analysis of the three hiPSC lines using scorecards confirmed an expression pattern of pluripotency markers corresponding to an undifferentiated state using a reference set of 23 pluripotent stem cell lines (Fig. 1E)(Fergus et al., 2016). In order to assess the differentiation potential of the three hiPSC, an embryoid body (EB) differentiation assay was performed. The expression of specific markers for ectoderm, mesoderm and endoderm was carried out by scorecard analysis. The analysis confirmed that the hiPSC lines are capable of differentiating into the three germ layers (Fig. 1E). Each of the hiPSC lines VHL2-10, VHL3-9 and VHL4-10 retained the pathogenic VHL gene variant (c.194C > G, c.194C > T and 2
Stem Cell Research 38 (2019) 101474
J. Schuster, et al.
A
TRA-1-60
B
VHL2-10
VHL3-9
VHL2-10 0,1% 99,2%
VHL3-9 0,0%
C
VHL4-10
VHL2-10 DAPI
NANOG
SOX2
Merge
VHL4-10 91,3% 0,1%
89,5%
VHL3-9
0,2%
0,4%
3,6%
3,0%
7,1%
DAPI
NANOG
SOX2
Merge
5,7%
pos. control
VHL4-10
VHL3-9
VHL2-10
VHL4-10
M
VHL3-9
-
VHL2-10
D
pos. control
SSEA4
-
M
VHL4-10 GAPDH
E
SeV
Sample Name Self-renewal
Ectoderm
Mesoderm
Endoderm
iPSC: VHL2-10
-0,59
0,01
-0,93
-0,86
EB: VHL2-10
-4,33
1,83
3,83
2,29
iPSC: VHL3-9
-0,12
0,44
-0,13
-1,03
EB: VHL3-9
-5,05
2,03
5,59
2,05
iPSC: VHL4-10
-0,98
0,52
-0,91
-0,98
EB: VHL4-10
-1,66
1,73
4,88
1,69
DAPI
NANOG
SOX2
Merge
Gene expression rela!ve to the reference standard Upregulated
x>1.5
F
Comparable
1.0
0.5
-0.5<=x<=0.5 -1.0<=x<-0.5
Downregulated
-1.5<=x<-1.0
x<-1.5
VHL2-10
VHL3-9
VHL4-10
[c.194C>G]
[c.194C>T]
[nt440delTTC]
Fig. 1. Characterization of the three VHL patient derived iPSC lines.
nt440delTCT, respectively) of the donor as confirmed by Sanger sequencing (Fig. 1F). Genomic integrity was investigated by CytoScan™HD DNA array and no acquired chromosomal aberration was detected in any of the three iPSC lines (Supplementary File 1) (Mills et al., 2011; Wong et al., 2007). All three iPSC lines tested free of Mycoplasma infection using MycoAlert™ Mycoplasma detection kit. The three different VHL syndrome patient derived iPSC lines generated here will offer a useful resource to study disease pathology, cancer progression and for drug development.
Materials and methods Culture conditions Fibroblasts were cultured in DMEM, Sigma cat no: D5796, 10% fetal bovine serum, ThermoFisher Scientific, cat no: 10500056, 2 mM GlutaMAX™, ThermoFisher Scientific, cat no: 35050038, 1% penicillin/ streptomycin, ThermoFisher Scientific, cat no: 15140122 in a humidified atmosphere with 5% CO2 at 37 °C and passaged using TrypLE™ 3
Stem Cell Research 38 (2019) 101474
J. Schuster, et al.
Express, ThermoFisher Scientific, cat no: 12604039, and Defined Trypsin Inhibitor, ThermoFisher Scientific, cat no: R007100. hiPS cells were cultured in Essential-8™ medium, ThermoFisher Scientific, cat no: A1517001, on Vitronectin-XF™, Stem Cell Technologies, cat no: 07180, coated plates (5%CO2, 37 °C) and passaged with Gentle Cell Dissociation Reagent, Stem Cell Technologies, cat no: 07174. hiPSC lines were subsequently adapted to culture on human Laminin-521, Biolamina, Cat no: LN-521, and passaged using TrypLE™ Expressand Defined Trypsin Inhibitor. For embryonic body formation hiPSC were dissociated with accutase, Sigma cat no: A6964, seeded into an AggreWell™400 plate, Stem Cell Technologies, cat no: 34421, in AggreWell™ medium, Stem Cell Technologies, cat no: 05893, supplemented with 10 μM Rho-kinase inhibitor Y27632, Stem Cell Technologies, cat no: 72304 according to protocol. Formed embryoid bodies were transferred to non-adherent culture plates and further differentiated for four weeks.
AF647, donkey anti-goat AF488) were incubated at room temperature for 60 min. Nuclear marker, DAPI (1 μg/ml), Sigma cat no: D8417 was incubated for 10 min at room temperature and specimens were mounted onto microscope slides using CFM-3 mounting medium, Citifluor. Specimens were imaged using an AxioImager (Zeiss).
Reprogramming
RNA was extracted (see RT-PCR) and quality was assessed by Agilent BioAnalyzer. Samples were run on TaqMan® hPSC Scorecard™ Panel, ThermoFisher Scientific, cat no: A15872/A15870 following manufacturer's protocol (Fergus et al., 2016). Scorecards were analysed with company's software at https://apps.thermofisher.com/ hPSCscorecard/home.htm.
Flow cytometry iPSCs were harvested with accutase, Sigma cat no: A6964 and washed in 1%BSA/1xPBS. Primary antibodies (mouse-IgG anti-SSEA4, mouse-IgM anti TRA-1-60) were incubated at room temperature for 30 min. Secondary antibodies (goat anti-mouse IgM AF488, goat antimouse IgG AF555) were incubated for 20 min at room temperature. Cells were analysed on a LSR-FORTESSA (BD). Scorecard assay
Fibroblasts were reprogrammed using CytoTune™-iPS 2.0 Sendai Reprogramming Kit, ThermoFisher Scientific, cat no: A16517, expressing the four Yamanaka factors hKlf4, hc-Myc, hSox2, hOct3/4. hiPSC colonies were manually picked for passage 1 to Vitronectin™-XL coated dishes and clonally expanded (see Culture conditions). Established hiPSC lines were adapted to culture on LN-521 (see Culture Conditions) past passage P10.
Mycoplasma Presence of mycoplasma in hiPSC lines was assessed on cell culture supernatants using MycoAlert™ Mycoplasma Detection kit, Lonza, cat no: LT07-318. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101474.
Cell authentication Cell authentication on DNA from fibroblasts and hiPSC lines was performed at Eurofins Genomics, Germany using AmpFLSTR™ Identifiler™ PCR Amplification Kit, ThermoFisher Scientific, cat no: 4322288.
Acknowledgements We thank the study participants. This work was supported by the Swedish Research Council 2015-02424 (to ND), Hjärnfonden FO20180100 (to ND) and the Sävstaholm Society (to LL). Image acquisition and flow cytometry were performed at the BioVis Platform and scorecard processing at the Genome Centre platform, Science for Life Laboratory, Uppsala University.
Genome stability Genome stability was analysed on DNA from the three hiPSC lines at Uppsala University Hospital, Clinical Genetics unit, Uppsala, using the CytoScan™HD Array, ThermoFisher Scientific, cat no: 901835. RT-PCR
References
RNA was isolated using miRNeasy micro kit, Qiagen, cat no: 217084. cDNA was synthesized using High Capacity cDNA Synthesis kit, ThermoFisher Scientific, cat no: 4368814 from 1 μg of total RNA. Detection of Sendai virus was performed by PCR on a “MyCycler” thermal cycler, BIORAD, by a total of 35 cycles (95 °C - 30 s, 55 °C 1 min, 72 °C - 1 min) with 1/10 of the cDNA reaction with primers SeVF and SeV-R. GAPDH was used as positive control. Samples were run without template as negative control. PCR products (expected sizes SeV: 195 bp (SeV), GAPDH: 325 bp) were visualized by 1% agarose gel electrophoresis. Ladder: GeneRuler 100 bp DNA ladder, ThermoFisher Scientific, cat no: SM0243.
Fergus, J., Quintanilla, R., Lakshmipathy, U., 2016. Characterizing pluripotent stem cells using the TaqMan(R) hPSC scorecard(TM) panel. Methods Mol. Biol. 1307, 25–37. Kaelin Jr., W.G., 2005. The von Hippel-Lindau protein, HIF hydroxylation, and oxygen sensing. Biochem. Biophys. Res. Commun. 338, 627–638. Mills, R.E., Walter, K., Stewart, C., Handsaker, R.E., Chen, K., Alkan, C., Abyzov, A., Yoon, S.C., Ye, K., Cheetham, R.K., Chinwalla, A., Conrad, D.F., Fu, Y., Grubert, F., Hajirasouliha, I., Hormozdiari, F., Iakoucheva, L.M., Iqbal, Z., Kang, S., Kidd, J.M., Konkel, M.K., Korn, J., Khurana, E., Kural, D., Lam, H.Y., Leng, J., Li, R., Li, Y., Lin, C.Y., Luo, R., Mu, X.J., Nemesh, J., Peckham, H.E., Rausch, T., Scally, A., Shi, X., Stromberg, M.P., Stutz, A.M., Urban, A.E., Walker, J.A., Wu, J., Zhang, Y., Zhang, Z.D., Batzer, M.A., Ding, L., Marth, G.T., McVean, G., Sebat, J., Snyder, M., Wang, J., Eichler, E.E., Gerstein, M.B., Hurles, M.E., Lee, C., McCarroll, S.A., Korbel, J.O., 2011. Mapping copy number variation by population-scale genome sequencing. Nature 470, 59–65. van Leeuwaarde, R.S., Ahmad, S., Links, T.P., Giles, R.H., May 17, 2000. Von HippelLindau Syndrome. In: Adam, M.P., Ardinger, H.H., Pagon, R.A. (Eds.), GeneReviews. University of Washington, Seattle (WA) (updated 2018 Sep 6). Wong, K.K., deLeeuw, R.J., Dosanjh, N.S., Kimm, L.R., Cheng, Z., Horsman, D.E., MacAulay, C., Ng, R.T., Brown, C.J., Eichler, E.E., Lam, W.L., 2007. A comprehensive analysis of common copy-number variations in the human genome. Am. J. Hum. Genet. 80, 91–104.
Immunofluorescence Cells were fixed in 4% formaldehyde for 5 min and pre-incubated in 1xPBS, 1%BSA, 0,3% TritonX100. Primary antibodies (mouse antiNANOG, rabbit anti-SOX2) were diluted in preincubation buffer and incubated at 4 °C overnight. Secondary antibodies (donkey anti-mouse
4