- Email: [email protected]
Generation of human iPSC line from a patient with Tetralogy of Fallot, YAHKMUi001-A, carrying a mutation in TBX1 gene
Stem Cell Research 42 (2020) 101687
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Multiple Cell Lines
Generation of human iPSC line from a patient with Tetralogy of Fallot, YAHKMUi001-A, carrying a mutation in TBX1 gene
T
Shen Han1,a,b, Ya-yong Zhang1,a,b, Ming-yao Mengc, Zong-liu Houc, Ping Menga,b, Yi-yi Zhaoc, ⁎ ⁎⁎ Hui Gaoc, Jian Tanga,b, Zu Liua,b, Li-li Yangc, Li-hong Jiangd, , Ya-xiong Lia,b, a
Department of Cardiovascular Surgery, Yan'an Affiliated Hospital of Kunming Medical University, Kunming, China Key Laboratory of Cardiovascular Disease of Yunnan Province, China c Department of Central Laboratory, Yan'an Affiliated Hospital of Kunming Medical University, Kunming, China d Department of Cardiovascular Surgery, First People's Hospital of Yunnan Province, Kunming, China b
A B S T R A C T
The human induced pluripotent stem cell (iPSC) line YAHKMUi001-A was derived from the dermal fibroblasts of a patient with Tetralogy of Fallot (TOF), with a mutation in the TBX1 gene (c.928G > A). The skin fibroblasts were obtained from a 4-year-old boy, and were infected with Sendai virus expressing the Yamanaka factors. The YAHKMUi001-A iPSC line expresses pluripotent stem cell markers, displays a normal karyotype, and has the capacity to differentiate into 3 germ layers. This cell line model can be a good tool to study the pathological mechanism of the TBX1 gene mutations associated with TOF.
Key resources table
Unique stem cell line identifier
YAHKMUi001-A
Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
iPSC line
Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance
Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
Yan'an Affiliated Hospital of Kunming Medical University Shen Han, [email protected] Induced pluripotent stem cell (iPSC) Human Applicable for human iPSC Age: 4 years Sex: male Ethnicity if known: Asian (Chinese) Skin fibroblasts Clonal Sendai virus reprogramming Yes Hereditary Tetralogy of Fallot TBX1 gene, a heterozygous mutation c.928G > A (p.Gly310Ser)/ 22q11.21 N/A N/A
N/A June 2018 N/A Ethics Committee of Yan'an Affiliated Hospital of Kunming Medical University, Yunnan, 2017-075-01, The informed consent of the patient was collected
1. Resource utility TOF is the most common form of cyanotic congenital heart defect (CCHD), which can cause serious health burden in infants. The YAHKMUi001-A cell line can be used as a tool for in vitro modelling of TOF for etiology research or gene therapy. 2. Resource details TOF is the most common form of CCHD, accounting for approximately 10% of all CHD cases, which comprise ventricular septal defects, obstruction of the right ventricular outflow tract, overriding aorta, and right ventricular hypertrophy (Starr, 2010). TBX1 gene is required for the formation of the cardiac outflow tracts, mutations in the TBX1 gene can contribute to conotruncal heart defect, which is associated with
⁎
Corresponding author. Corresponding author at: Department of Cardiovascular Surgery, Yan'an Affiliated Hospital of Kunming Medical University, Kunming, China. E-mail addresses: [email protected] (L.-h. Jiang), [email protected] (Y.-x. Li). 1 These authors contributed equally to this work. ⁎⁎
https://doi.org/10.1016/j.scr.2019.101687 Received 24 October 2019; Received in revised form 6 December 2019; Accepted 11 December 2019 Available online 12 December 2019 1873-5061/ © 2019 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 42 (2020) 101687
S. Han, et al.
Fig. 1. Charaterization of YAHKMUi001-A.
2
Stem Cell Research 42 (2020) 101687
S. Han, et al.
methods. Dulbecco's modified Eagle's medium/ F12 (DMEM/ F12, Invitrogen) complemented with 10% fetal bovine serum (Invitrogen), 100 U/mL penicillin, and 10 U/mL streptomycin was used for cell culture. Once the cultured cells reached 70%–90% confluence, they were harvested by using TrypLE™ Express (Invitrogen).
TOF (Hasten et al., 2018). In this study, we have successfully generated an iPSC line, YAHKMUi001-A, from a 4-year-old boy with TOF carrying a mutation in TBX1 gene. Human skin fibroblasts were reprogrammed by Yamanaka factors, OCT3/4, SOX2, KLF4, and cMYC, which were expressed using the integration-free Sendai virus gene-delivery method (Fusaki et al., 2009). The embryonic stem cell (ESC)-like colonies were selected around 14–21 days after transduction (Fig. 1A). Reverse transcriptase PCR (RT-PCR) was performed on the cells at passage 10 to confirm the absence of reprogramming exogenous factors OCT4, SOX2, KLF4, and c-MYC in the iPSC line (Supplementary Fig. 1A). The expression levels of the pluripotency markers OCT4, NANOG, SSEA4, and TRA-1-60 were confirmed by immunofluorescence staining (Fig. 1B), and with alkaline phosphatase staining (Fig. 1A), Moreover, flow cytometry analysis revealed that more than 95% of the YAHKMUi001-A cells expressed the pluripotency markers, OCT4 and SSEA-4 (Fig. 1C). The transcript levels of OCT4, SOX2, NANOG, and REX1 were verified by quantitative RT-PCR (Fig. 1D). YAHKMUi001-A cells maintained the normal karyotype (46, XY) after 20 passages (Fig. 1E). The sequencing analysis showed a heterozygous mutation c.928G > A (p.Gly310Ser) in the exon of the TBX1 gene in both parental fibroblasts and the YAHKMUi001-A cells (Fig. 1F). In vivo, the differentiation ability was demonstrated by teratoma formation assay, which showed that the cells could differentiate into all three germ layers (Fig. 1G). Furthermore, YAHKMUi001-A iPSC line has identical short tandem repeat (STR) patterns, similar to its primary parental fibroblasts; the mycoplasma testing was found to be negative (Supplementary Fig. 1B). Taken together, these data show that we have generated YAHKMUi001-A iPSC line from a TOF patient who sustained a point mutation in TBX1 gene; thus, YAHKMUi001-A iPSC line can be used as a new tool for studying TBX1-related CHDs (Table 1).
3.3. Generation and differentiation of iPSC The YAHKMUi001-A iPSC line was generated using CytoTune®-iPS 2.0 Sendai Reprogramming Kit, following the manufacturer's protocol (ThermoFisher Scientific). Briefly, the dermal fibroblasts were transduced with four transcription factors: OCT4, c-MYC, SOX2, and KLF4. After 24 h, the medium was replaced, and all the cells were cultured for 6 additional days with media changes every 2 days; then, the cells were harvested and replated onto Matrigel-coated 6-well plates (BD Biosciences) in DMEM/ GlutaMAX, supplemented with 10% FBS and ROCK inhibitor, Y27632 (Selleck). Starting from day 8, the cells were cultured in the iPSC medium, Essential 8 (STEMCELL Technologies), which was replaced every day. Around day 20, colonies were selected and transferred to a Matrigel-coated culture dish. The medium was changed daily, and the cells were subcultured at a ratio of 1:4 every 5 days using EDTA. 3.4. Alkaline phosphatase staining, immunofluorescence and flow cytometry analysis Alkaline phosphatase (AP) activity was confirmed using an alkaline phosphatase detection kit (Solarbio, China), following manufacturer's instructions. For immunofluorescence, the cells grown on chamber slides were washed with PBS and fixed with 4% paraformaldehyde for 20 min, permeabilized with 0.2% Triton X-100 for 30 min, and then blocked with 3% bovine serum albumin (BSA) in PBS for 1 h at room temperature. Then, the slides were incubated with the primary antibody at 4°C for overnight, followed by incubation with secondary antibody for 1 h at room temperature. After washing with PBS, DAPI was used to stain the nucleus. For flow cytometry analysis, the cells were fixed in 4% paraformaldehyde for 15 min. For nuclear staining, cells were also permeabilized with 0.2% Triton X-100 for 20 min. Then, the cells were incubated with the conjugated antibodies at room temperature for 30 min. Finally, flow cytometry analyzed (Beckman) Table 2.
3. Materials and methods 3.1. Animals and ethics statement The study was approved by the Ethics Committee of Yan'an Affiliated Hospital of Kunming Medical University, and the signed informed consent for a 4 -old-TOF patient was collected from his guardians. All the experimental protocols involving animals were approved by the University Animal Care and Use Committee at the Yan'an Affiliated Hospital of Kunming Medical University.
3.5. Detection of reprogramming vectors and pluripotent markers 3.2. Tissue fibroblast isolation Reprogramming vectors and pluripotent markers were detected by qPCR and RT-PCR using the associated primers (Table 2). Total RNA
Skin fibroblasts were isolated and cultured using tissue adherent Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
normal Positive for pluripotency markers: Oct4, Nanog, Tra-160, SSEA4 Positive for pluripotency markers: Oct3/4:97.5% SSEA-4: 99.1% NANOG, OCT4, SOX2, REX1 46XX, Resolution 400 N/A
Fig. 1A Fig. 1B
Genotype Identity
Photography Qualitative analysis (Immunocytochemistry) Quantitative analysis: Flow cytometry RT-qPCR Karyotype (G-banding) and resolution Microsatellite PCR (mPCR)
Mutation analysis (IF APPLICABLE)
STR analysis Sequencing
20 sites tested and all matched heterozygous mutation
submitted in archive with journal Fig. 1F
Southern Blot OR WGS Mycoplasma Teratoma formation HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
N/A Mycoplasma testing by RT-PCR: Negative Proof of three germ layers formation Negative N/A N/A
Not available figure 2/supplementary Fig. 1G Not shown but available with author Not available Not available
Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
3
Fig. 1C and D
Fig. 1E Not available
Stem Cell Research 42 (2020) 101687
S. Han, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody
Dilution
Company Cat # and RRID
Pluripotency Markers
Rabbit anti-OCT4
1:200
Rabbit anti-NANOG
1:200
Mouse anti-Tra-1-60
1:200
Mouse anti-SSEA4
1:200
Mouse anti-Oct3/4 (Alexa Fluor 488 Conjugate) Mouse anti-SSEA-4 (Alexa Fluor 488 Conjugate) Alexa Fluor 594 Goat Anti-Mouse IgG Alexa Fluor 594 Goat Anti-Ribbit IgG Alexa Fluor 488 Goat Anti-Rabbit IgG Alexa Fluor 488 Goat Anti-Mouse IgG
1:100
Cell Signaling Technology Cat#2840, RRID: AB_2,167,691 Proteintech Cat# 14,295-1-AP, RRID: AB_1,607,719 Abcam Cat# ab16288, RRID: AB_778,563 Abcam Cat# ab16287, RRID:AB_778,073 BD Pharmingen Cat# 560,186, RRID: AB_1,645,331
Target SeV
Forward/Reverse primer (5′−3′) GGATCACTAGGTGATATCGAGC/ ACCAGACAAGAGTTTAAGAGATATGTATC ATGCACCGCTACGACGTGAGCGC/ACCTTGACAATCCTGATGTGG TTCCTGCATGCCAGAGGAGCCC/ATGTATCGAAGGTGCTCAA TAACTGACTAGCAGGCTTGTCG/TCCACATACAGTCCTGGATGATGATG CCTCACTTCACTGCACTGTA/CAGGTTTTCTTTCCCTAGCT CGAAGAATAGCAATGGTGTGACG/TTCCAAAGCAGCCTCCAAGTC CCCAGCAGACTTCACATGT/CCTCCCATTTCCCTCGTTTT TCGCTGAGCTGAAACAAATG/CCCTTCTTGAAGGTTTACAC TTCACCAAAGATCTGCTCCTCGCT/ TTATTACTGGTGTGGAGTGGGTGTGG GCTTCTCCTAACACTCCCCTATCC/ACCAGTCGGTGCCAGCGTG
Secondary antibodies
1:100
BD Pharmingen Cat# 560,308, RRID: AB_1,645,371
1:200
Proteintech Cat# SA00013-3, RRID: AB_2,797,133 Proteintech Cat# SA00013-4, RRID: AB_2,810,984 Proteintech Cat# SA00013-1, RRID: AB_2,810,983 Proteintech Cat# SA00006-2, RRID: AB_2,797,132
1:200 1:200 1:200
Primers Transgenes (RT-PCR)
Pluripotency Markers (qPCR)
House-Keeping Genes Targeted mutation analysis/ sequencing
KOS Klf4 c-Myc OCT4 NANOG SOX2 Rex1 GAPDH TBX1
3.8. Mutation analysis
was extracted from the cells using an RNeasy kit (Qiagen). A total of 1 μg RNA was reverse transcribed into cDNA using the Random Primers of GoScript™ Reverse Transcription Mix cDNA synthesis kit (Promega). qPCR was performed in triplicate using SYBR Green Supermix Kit (BIORAD) and CFX96 Touch™ (BIO-RAD) to determine the expression levels of pluripotency genes. Finally, RT-PCR analysis was carried out to detect the silencing of the reprogramming exogenous factors.
Genomic DNA was extracted from parental fibroblasts and iPSCs using Genomic DNA extraction kits (Qiagen) and the mutated region of TBX1 exon 16 was amplified using specific primers sent to Beijing Tsingke Biological Technology Co., Ltd. Sanger sequencing analysis was performed on 3730xl DNA Analyzer (Applied Biosystems, CA, USA). 3.9. STR analysis
3.6. Karyotype analysis
Short tandem repeat (STR) analysis was performed by the Cell Line Authentication Service (TSINGKE Biological Technology, Kunming, China). The sequencing was performed using Prism 3730 Genetic Analyzer (Applied Biosystems, CA, USA) and the results were analysed using GeneMapper V3.0 software. Tested loci: D5S818, D13S317, D7S820, D16S539, VWA, TH01, AMEL, TPOX, CSF1P0, D12S391, FGA, D2S1338, D21S11, D18S51, D8S1179, D3S1358, D6S1043, PENTAE, D19S433, PENTAD.
To examine the genetic stability of the YAHKMUi001-A iPSC line, karyotype analyses were carried out by preparing metaphase spreads of cells cultured to P20 generation. These cells were processed using standard cytogenetic techniques. Briefly, cells were treated with 10 μg/ mL of Colcemid (Gibco) for 60 min at 37°C. Subsequently, single cells were trypsinized, and then treated with 0.075 M hypotonic KCl solution and fixed with hypotonic solution. Then the fixed cells were dropped on to a slide, dried, and stained to observe the G banding pattern.
3.10. Mycoplasma detection 3.7. Teratoma formation assay The detection of mycoplasma was tested by PCR using the EZ-PCR™ Mycoplasma Detection Kit (Biological Industries) according to manufacturer's protocol.
Undifferentiated YAHKMUi001-A iPSC were digested by Accutase (Stemcell) and iPSC(5 × 106) were suspended in 100μL Matrigel (Corning), Cells were injected subcutaneously into NOD-SCID mice to form teratomas, and Matrigel as a negative control. 8–10 weeks after injection, the teratomas was harvested and fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, and stained with hematoxylin and eosin.
Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to 4
Stem Cell Research 42 (2020) 101687
S. Han, et al.
influence the work reported in this paper.
transgene-free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that does not integrate into the host genome. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 85, 348–362. Hasten, E., McDonald-McGinn, D.M., Crowley, T.B., Zackai, E., Emanuel, B.S., Morrow, B.E., Racedo, S.E., 2018. Dysregulation of TBX1 dosage in the anterior heart field results in congenital heart disease resembling the 22q11.2 duplication syndrome. Hum. Mol. Genet. 27, 1847–1857. Starr, J.P., 2010. Tetralogy of fallot: yesterday and today. World J. Surg. 34, 658–668.
Supplementary materials Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2019.101687. References Fusaki, N., Ban, H., Nishiyama, A., Saeki, K., Hasegawa, M., 2009. Efficient induction of
5
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Multiple Cell Lines
Generation of human iPSC line from a patient with Tetralogy of Fallot, YAHKMUi001-A, carrying a mutation in TBX1 gene
T
Shen Han1,a,b, Ya-yong Zhang1,a,b, Ming-yao Mengc, Zong-liu Houc, Ping Menga,b, Yi-yi Zhaoc, ⁎ ⁎⁎ Hui Gaoc, Jian Tanga,b, Zu Liua,b, Li-li Yangc, Li-hong Jiangd, , Ya-xiong Lia,b, a
Department of Cardiovascular Surgery, Yan'an Affiliated Hospital of Kunming Medical University, Kunming, China Key Laboratory of Cardiovascular Disease of Yunnan Province, China c Department of Central Laboratory, Yan'an Affiliated Hospital of Kunming Medical University, Kunming, China d Department of Cardiovascular Surgery, First People's Hospital of Yunnan Province, Kunming, China b
A B S T R A C T
The human induced pluripotent stem cell (iPSC) line YAHKMUi001-A was derived from the dermal fibroblasts of a patient with Tetralogy of Fallot (TOF), with a mutation in the TBX1 gene (c.928G > A). The skin fibroblasts were obtained from a 4-year-old boy, and were infected with Sendai virus expressing the Yamanaka factors. The YAHKMUi001-A iPSC line expresses pluripotent stem cell markers, displays a normal karyotype, and has the capacity to differentiate into 3 germ layers. This cell line model can be a good tool to study the pathological mechanism of the TBX1 gene mutations associated with TOF.
Key resources table
Unique stem cell line identifier
YAHKMUi001-A
Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
iPSC line
Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance
Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
Yan'an Affiliated Hospital of Kunming Medical University Shen Han, [email protected] Induced pluripotent stem cell (iPSC) Human Applicable for human iPSC Age: 4 years Sex: male Ethnicity if known: Asian (Chinese) Skin fibroblasts Clonal Sendai virus reprogramming Yes Hereditary Tetralogy of Fallot TBX1 gene, a heterozygous mutation c.928G > A (p.Gly310Ser)/ 22q11.21 N/A N/A
N/A June 2018 N/A Ethics Committee of Yan'an Affiliated Hospital of Kunming Medical University, Yunnan, 2017-075-01, The informed consent of the patient was collected
1. Resource utility TOF is the most common form of cyanotic congenital heart defect (CCHD), which can cause serious health burden in infants. The YAHKMUi001-A cell line can be used as a tool for in vitro modelling of TOF for etiology research or gene therapy. 2. Resource details TOF is the most common form of CCHD, accounting for approximately 10% of all CHD cases, which comprise ventricular septal defects, obstruction of the right ventricular outflow tract, overriding aorta, and right ventricular hypertrophy (Starr, 2010). TBX1 gene is required for the formation of the cardiac outflow tracts, mutations in the TBX1 gene can contribute to conotruncal heart defect, which is associated with
⁎
Corresponding author. Corresponding author at: Department of Cardiovascular Surgery, Yan'an Affiliated Hospital of Kunming Medical University, Kunming, China. E-mail addresses: [email protected] (L.-h. Jiang), [email protected] (Y.-x. Li). 1 These authors contributed equally to this work. ⁎⁎
https://doi.org/10.1016/j.scr.2019.101687 Received 24 October 2019; Received in revised form 6 December 2019; Accepted 11 December 2019 Available online 12 December 2019 1873-5061/ © 2019 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 42 (2020) 101687
S. Han, et al.
Fig. 1. Charaterization of YAHKMUi001-A.
2
Stem Cell Research 42 (2020) 101687
S. Han, et al.
methods. Dulbecco's modified Eagle's medium/ F12 (DMEM/ F12, Invitrogen) complemented with 10% fetal bovine serum (Invitrogen), 100 U/mL penicillin, and 10 U/mL streptomycin was used for cell culture. Once the cultured cells reached 70%–90% confluence, they were harvested by using TrypLE™ Express (Invitrogen).
TOF (Hasten et al., 2018). In this study, we have successfully generated an iPSC line, YAHKMUi001-A, from a 4-year-old boy with TOF carrying a mutation in TBX1 gene. Human skin fibroblasts were reprogrammed by Yamanaka factors, OCT3/4, SOX2, KLF4, and cMYC, which were expressed using the integration-free Sendai virus gene-delivery method (Fusaki et al., 2009). The embryonic stem cell (ESC)-like colonies were selected around 14–21 days after transduction (Fig. 1A). Reverse transcriptase PCR (RT-PCR) was performed on the cells at passage 10 to confirm the absence of reprogramming exogenous factors OCT4, SOX2, KLF4, and c-MYC in the iPSC line (Supplementary Fig. 1A). The expression levels of the pluripotency markers OCT4, NANOG, SSEA4, and TRA-1-60 were confirmed by immunofluorescence staining (Fig. 1B), and with alkaline phosphatase staining (Fig. 1A), Moreover, flow cytometry analysis revealed that more than 95% of the YAHKMUi001-A cells expressed the pluripotency markers, OCT4 and SSEA-4 (Fig. 1C). The transcript levels of OCT4, SOX2, NANOG, and REX1 were verified by quantitative RT-PCR (Fig. 1D). YAHKMUi001-A cells maintained the normal karyotype (46, XY) after 20 passages (Fig. 1E). The sequencing analysis showed a heterozygous mutation c.928G > A (p.Gly310Ser) in the exon of the TBX1 gene in both parental fibroblasts and the YAHKMUi001-A cells (Fig. 1F). In vivo, the differentiation ability was demonstrated by teratoma formation assay, which showed that the cells could differentiate into all three germ layers (Fig. 1G). Furthermore, YAHKMUi001-A iPSC line has identical short tandem repeat (STR) patterns, similar to its primary parental fibroblasts; the mycoplasma testing was found to be negative (Supplementary Fig. 1B). Taken together, these data show that we have generated YAHKMUi001-A iPSC line from a TOF patient who sustained a point mutation in TBX1 gene; thus, YAHKMUi001-A iPSC line can be used as a new tool for studying TBX1-related CHDs (Table 1).
3.3. Generation and differentiation of iPSC The YAHKMUi001-A iPSC line was generated using CytoTune®-iPS 2.0 Sendai Reprogramming Kit, following the manufacturer's protocol (ThermoFisher Scientific). Briefly, the dermal fibroblasts were transduced with four transcription factors: OCT4, c-MYC, SOX2, and KLF4. After 24 h, the medium was replaced, and all the cells were cultured for 6 additional days with media changes every 2 days; then, the cells were harvested and replated onto Matrigel-coated 6-well plates (BD Biosciences) in DMEM/ GlutaMAX, supplemented with 10% FBS and ROCK inhibitor, Y27632 (Selleck). Starting from day 8, the cells were cultured in the iPSC medium, Essential 8 (STEMCELL Technologies), which was replaced every day. Around day 20, colonies were selected and transferred to a Matrigel-coated culture dish. The medium was changed daily, and the cells were subcultured at a ratio of 1:4 every 5 days using EDTA. 3.4. Alkaline phosphatase staining, immunofluorescence and flow cytometry analysis Alkaline phosphatase (AP) activity was confirmed using an alkaline phosphatase detection kit (Solarbio, China), following manufacturer's instructions. For immunofluorescence, the cells grown on chamber slides were washed with PBS and fixed with 4% paraformaldehyde for 20 min, permeabilized with 0.2% Triton X-100 for 30 min, and then blocked with 3% bovine serum albumin (BSA) in PBS for 1 h at room temperature. Then, the slides were incubated with the primary antibody at 4°C for overnight, followed by incubation with secondary antibody for 1 h at room temperature. After washing with PBS, DAPI was used to stain the nucleus. For flow cytometry analysis, the cells were fixed in 4% paraformaldehyde for 15 min. For nuclear staining, cells were also permeabilized with 0.2% Triton X-100 for 20 min. Then, the cells were incubated with the conjugated antibodies at room temperature for 30 min. Finally, flow cytometry analyzed (Beckman) Table 2.
3. Materials and methods 3.1. Animals and ethics statement The study was approved by the Ethics Committee of Yan'an Affiliated Hospital of Kunming Medical University, and the signed informed consent for a 4 -old-TOF patient was collected from his guardians. All the experimental protocols involving animals were approved by the University Animal Care and Use Committee at the Yan'an Affiliated Hospital of Kunming Medical University.
3.5. Detection of reprogramming vectors and pluripotent markers 3.2. Tissue fibroblast isolation Reprogramming vectors and pluripotent markers were detected by qPCR and RT-PCR using the associated primers (Table 2). Total RNA
Skin fibroblasts were isolated and cultured using tissue adherent Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
normal Positive for pluripotency markers: Oct4, Nanog, Tra-160, SSEA4 Positive for pluripotency markers: Oct3/4:97.5% SSEA-4: 99.1% NANOG, OCT4, SOX2, REX1 46XX, Resolution 400 N/A
Fig. 1A Fig. 1B
Genotype Identity
Photography Qualitative analysis (Immunocytochemistry) Quantitative analysis: Flow cytometry RT-qPCR Karyotype (G-banding) and resolution Microsatellite PCR (mPCR)
Mutation analysis (IF APPLICABLE)
STR analysis Sequencing
20 sites tested and all matched heterozygous mutation
submitted in archive with journal Fig. 1F
Southern Blot OR WGS Mycoplasma Teratoma formation HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
N/A Mycoplasma testing by RT-PCR: Negative Proof of three germ layers formation Negative N/A N/A
Not available figure 2/supplementary Fig. 1G Not shown but available with author Not available Not available
Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
3
Fig. 1C and D
Fig. 1E Not available
Stem Cell Research 42 (2020) 101687
S. Han, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody
Dilution
Company Cat # and RRID
Pluripotency Markers
Rabbit anti-OCT4
1:200
Rabbit anti-NANOG
1:200
Mouse anti-Tra-1-60
1:200
Mouse anti-SSEA4
1:200
Mouse anti-Oct3/4 (Alexa Fluor 488 Conjugate) Mouse anti-SSEA-4 (Alexa Fluor 488 Conjugate) Alexa Fluor 594 Goat Anti-Mouse IgG Alexa Fluor 594 Goat Anti-Ribbit IgG Alexa Fluor 488 Goat Anti-Rabbit IgG Alexa Fluor 488 Goat Anti-Mouse IgG
1:100
Cell Signaling Technology Cat#2840, RRID: AB_2,167,691 Proteintech Cat# 14,295-1-AP, RRID: AB_1,607,719 Abcam Cat# ab16288, RRID: AB_778,563 Abcam Cat# ab16287, RRID:AB_778,073 BD Pharmingen Cat# 560,186, RRID: AB_1,645,331
Target SeV
Forward/Reverse primer (5′−3′) GGATCACTAGGTGATATCGAGC/ ACCAGACAAGAGTTTAAGAGATATGTATC ATGCACCGCTACGACGTGAGCGC/ACCTTGACAATCCTGATGTGG TTCCTGCATGCCAGAGGAGCCC/ATGTATCGAAGGTGCTCAA TAACTGACTAGCAGGCTTGTCG/TCCACATACAGTCCTGGATGATGATG CCTCACTTCACTGCACTGTA/CAGGTTTTCTTTCCCTAGCT CGAAGAATAGCAATGGTGTGACG/TTCCAAAGCAGCCTCCAAGTC CCCAGCAGACTTCACATGT/CCTCCCATTTCCCTCGTTTT TCGCTGAGCTGAAACAAATG/CCCTTCTTGAAGGTTTACAC TTCACCAAAGATCTGCTCCTCGCT/ TTATTACTGGTGTGGAGTGGGTGTGG GCTTCTCCTAACACTCCCCTATCC/ACCAGTCGGTGCCAGCGTG
Secondary antibodies
1:100
BD Pharmingen Cat# 560,308, RRID: AB_1,645,371
1:200
Proteintech Cat# SA00013-3, RRID: AB_2,797,133 Proteintech Cat# SA00013-4, RRID: AB_2,810,984 Proteintech Cat# SA00013-1, RRID: AB_2,810,983 Proteintech Cat# SA00006-2, RRID: AB_2,797,132
1:200 1:200 1:200
Primers Transgenes (RT-PCR)
Pluripotency Markers (qPCR)
House-Keeping Genes Targeted mutation analysis/ sequencing
KOS Klf4 c-Myc OCT4 NANOG SOX2 Rex1 GAPDH TBX1
3.8. Mutation analysis
was extracted from the cells using an RNeasy kit (Qiagen). A total of 1 μg RNA was reverse transcribed into cDNA using the Random Primers of GoScript™ Reverse Transcription Mix cDNA synthesis kit (Promega). qPCR was performed in triplicate using SYBR Green Supermix Kit (BIORAD) and CFX96 Touch™ (BIO-RAD) to determine the expression levels of pluripotency genes. Finally, RT-PCR analysis was carried out to detect the silencing of the reprogramming exogenous factors.
Genomic DNA was extracted from parental fibroblasts and iPSCs using Genomic DNA extraction kits (Qiagen) and the mutated region of TBX1 exon 16 was amplified using specific primers sent to Beijing Tsingke Biological Technology Co., Ltd. Sanger sequencing analysis was performed on 3730xl DNA Analyzer (Applied Biosystems, CA, USA). 3.9. STR analysis
3.6. Karyotype analysis
Short tandem repeat (STR) analysis was performed by the Cell Line Authentication Service (TSINGKE Biological Technology, Kunming, China). The sequencing was performed using Prism 3730 Genetic Analyzer (Applied Biosystems, CA, USA) and the results were analysed using GeneMapper V3.0 software. Tested loci: D5S818, D13S317, D7S820, D16S539, VWA, TH01, AMEL, TPOX, CSF1P0, D12S391, FGA, D2S1338, D21S11, D18S51, D8S1179, D3S1358, D6S1043, PENTAE, D19S433, PENTAD.
To examine the genetic stability of the YAHKMUi001-A iPSC line, karyotype analyses were carried out by preparing metaphase spreads of cells cultured to P20 generation. These cells were processed using standard cytogenetic techniques. Briefly, cells were treated with 10 μg/ mL of Colcemid (Gibco) for 60 min at 37°C. Subsequently, single cells were trypsinized, and then treated with 0.075 M hypotonic KCl solution and fixed with hypotonic solution. Then the fixed cells were dropped on to a slide, dried, and stained to observe the G banding pattern.
3.10. Mycoplasma detection 3.7. Teratoma formation assay The detection of mycoplasma was tested by PCR using the EZ-PCR™ Mycoplasma Detection Kit (Biological Industries) according to manufacturer's protocol.
Undifferentiated YAHKMUi001-A iPSC were digested by Accutase (Stemcell) and iPSC(5 × 106) were suspended in 100μL Matrigel (Corning), Cells were injected subcutaneously into NOD-SCID mice to form teratomas, and Matrigel as a negative control. 8–10 weeks after injection, the teratomas was harvested and fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, and stained with hematoxylin and eosin.
Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to 4
Stem Cell Research 42 (2020) 101687
S. Han, et al.
influence the work reported in this paper.
transgene-free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that does not integrate into the host genome. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 85, 348–362. Hasten, E., McDonald-McGinn, D.M., Crowley, T.B., Zackai, E., Emanuel, B.S., Morrow, B.E., Racedo, S.E., 2018. Dysregulation of TBX1 dosage in the anterior heart field results in congenital heart disease resembling the 22q11.2 duplication syndrome. Hum. Mol. Genet. 27, 1847–1857. Starr, J.P., 2010. Tetralogy of fallot: yesterday and today. World J. Surg. 34, 658–668.
Supplementary materials Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2019.101687. References Fusaki, N., Ban, H., Nishiyama, A., Saeki, K., Hasegawa, M., 2009. Efficient induction of
5