- Email: [email protected]
Generation of induced pluripotent stem cell line (ZZUi007-A) from a 52-year-old patient with a novel CHCHD2 gene mutation in Parkinson’s disease
Stem Cell Research 32 (2018) 87–90
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of induced pluripotent stem cell line (ZZUi007-A) from a 52year-old patient with a novel CHCHD2 gene mutation in Parkinson’s disease
T
Yanlin Wanga,1, Zhilei Wanga, Huifang Suna, Chengyuan Maoa, Jing Yanga, Yutao Liua, Han Liua, ⁎ ⁎ Shoutao Zhangc, Jin Zhangb, Yuming Xua, , Changhe Shia, a
Department of Neurology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, China Center for Stem Cell and Regenerative Medicine, Department of Basic Medical Sciences, The First Affiliated Hospital, College of Medicine, Institute of Hematology, Zhejiang University, Hangzhou, Zhejiang 310058, China c School of Life Sciences, Zhengzhou University, Zhengzhou, Henan 450001, China b
A B S T R A C T
CHCHD2 mutation has been reported as a potential cause of a rare form of familial Parkinson's disease. Recently, a novel CHCHD2 mutation was identified in a family with Parkinson's disease. The dermal fibroblasts of the patient were obtained and successfully transformed into induced pluripotent stem cells(iPSCs), employing episomal plasmids expressing OCT3/4, SOX2, KLF4, LIN28, and L-MYC. Our model may offer a good platform for further research on the pathomechanism, drug testing, and gene therapy of this disease.
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
ZZUi007-A ZZU-iPS-PD-CHCHD2–001 Department of Neurology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou University Yuming Xu [email protected] iPSC Human Age: 52 Sex: Male Ethnicity: Han Chinese Human skin fibroblasts Electroporated with episomal plasmids NO N/A Parkinson's disease CHCHD2/c.182C > T (p.Thr61Ile) N/A N/A N/A July 2017 N/A This study was approved by the medical research ethics committee of the First Affiliated Hospital of Zhengzhou University (NO. 2016-007).
⁎
Corresponding authors. E-mail addresses: [email protected] (Y. Xu), [email protected] (C. Shi). 1 First author https://doi.org/10.1016/j.scr.2018.08.011 Received 31 May 2018; Accepted 10 August 2018 Available online 23 August 2018 1873-5061/ © 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 32 (2018) 87–90
Y. Wang et al.
Resource table: Resource utility: CHCHD2 mutation has been shown to be associated with Parkinson's disease (PD) (Shi et al., 2016). Induced pluripotent stem cells (iPSCs), generated from a patient harboring a CHCHD2 mutation, may provide an ideal cell model for exploring the pathogenesis of this disease and aid in drug screening. Resource details: Parkinson's disease (PD) is one of the most common neurodegenerative disorders, characterized by resting tremors, muscular rigidity, bradykinesia, and postural instability. Previous studies have revealed that parkinsonism can be caused by mutations in several genes including parkin, PTEN-induced putative kinase protein 1 (PINK1), parkinsonism-associated deglycase (DJ1), and ATPase 13A2 (ATP13A2) (Bonifati, 2014). In this study, a novel CHCHD2 mutation was identified in a family with Parkinson's disease (Shi et al., 2016), and the fibroblasts of the patient were successfully transformed into iPSCs. Episomal plasmids were used to generate the ZZUi007-A iPSC line (Fig. 1A). Pluripotency markers were examined via immunocytochemical staining using antibodies against human OCT-4, TRA-1-60 and Nanog (Fig. 1B). Flow cytometric analysis showed that more than 99% of the cells expressed OCT-4 and TRA-1-60 (Fig. 1C). The karyotype of CHCHD2–01 iPSCs was numerically and structurally normal (Fig. 1D). The mutation (c.182C > T; p.Thr61Ile) in CHCHD2 was confirmed by Sanger sequencing in the newly established iPSC line (Fig. 1E). Episomal plasmids were detected by polymerase chain reaction (PCR) using episomal plasmid-specific primers and disappeared from passage 15 (Fig. 1F). Furthermore, the iPSC line had the potential to differentiate into cells of all three germ layers in vivo (Fig. 1G).
1. Materials and methods
1.5. Karyotyping
1.1. Ethical statement
Chromosomes of at least 30 proliferating cells were counted and fully analyzed using G-banding by the prenatal diagnosis center of the First Affiliated Hospital of Zhengzhou University.
Written informed consent was obtained from the patient and the study was approved by the medical research ethics committee of the First Affiliated Hospital of Zhengzhou University.
1.6. PCR
1.2. Reprogramming of fibroblasts into iPSCs
Genomic DNA was isolated from the cells using Tissue gDNA Kit (BIOMIGA, GD2211-01). DNA (1 μL) was mixed with forward primer (1 μL), reverse primer (1 μL), double-distilled H2O (12 μL), and 2× Vazyme LAmp Master Mix (15 μL) (Vazyme). PCR was performed with the primers listed in Table 2.
A skin biopsy was obtained from the forearm of a 52-year-old male patient, then dissected and left in fibroblast medium (Dulbecco's Modified Eagle's Medium with high glucose +10% fetal bovine serum), 0.1 mM MEM Non-Essential Amino Acids Solution, 0.1% β-mercaptoethanol, and 1% penicillin-streptomycin (Thermo Fisher Scientific). Subsequently, these fibroblasts were electroporated with OriP/EBNA-1based episomal plasmids expressing reprogramming factors OCT4, SOX2, KLF-4, L-MYC, and LIN28 (Cai et al., 2015).
1.7. Sanger sequencing Genomic DNA was extracted from the established iPSCs using the Tissue gDNA Kit (BIOMIGA, GD2211-01). The frameshift mutation in CHCHD2 was amplified using specific primers (Table 2) and analyzed by Sanger sequencing.
1.3. Immunocytochemistry Cells were fixed in 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and blocked in 3% bovine serum albumin. They were then incubated with primary antibodies and visualized with secondary antibodies. DAPI was used for nuclear counterstaining. Antibodies used are listed in Table 2.
1.8. Teratoma formation iPSCs (2–3 × 106) were suspended in 100 μL of Matrigel (Corning, 354277). Cells were injected into immune-deficient mice (NOD/SCID). Teratomas were formed within 6–8 weeks. Upon removal, the teratomas were fixed, embedded in paraffin, and stained with hematoxylin and eosin.
1.4. Flow cytometry analysis Cells were harvested and washed twice in phosphate-buffered saline. They were incubated with primary antibodies for 30 min at 37 °C and then incubated with secondary antibodies for 30 min at 37 °C. Expression of pluripotency markers was analyzed by flow cytometry (BD Biosciences). Unstained iPSCs were used as negative controls to exclude data from non-specific fluorescence.
1.9. Short Tandem Repeat (STR) analysis SR analysis was performed on the fibroblasts and iPSCs were generated using Promega kit 10 microsatellite markers with detection of ten loci and analyzed on 3730xl DNA Analyzer (Applied Biosystems™) using GeneMapper 4.0 (Thermo Fisher) (Table 1.
88
Stem Cell Research 32 (2018) 87–90
Y. Wang et al.
(caption on next page)
89
Stem Cell Research 32 (2018) 87–90
Y. Wang et al.
Fig. 1. Characterization of ZZUi007-A. (A) Pluripotency of iPSCs confirmed by immunostaining with TRA-1-60, Nanog, and OCT-4, nuclei was counterstained with DAPI (Scale bar = 200 μm). (B) FACS analysis for pluripotient markers. (C) Karyogram of iPSCs show normal ploidy of a male subject. (D) Sequencing chromatograms: vertical arrows indicate the mutation site (c.182C > T). (E) PCR gene expression analysis shows elimination of the non-integrating genome. (F) All three germ layers are shown in teratoma derived from the cell line with H&E staining (Scale bar = 200 μm).
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Immunocytochemisty
Fig. 1 panel A Fig. 1 panel B
Microbiology and virology
Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) STR analysis Sequencing Southern Blot OR WGS Mycoplasma
Differentiation potential Donor screening (OPTIONAL)
Teratoma formation HIV 1 + 2 Hepatitis B, Hepatitis C
Similar to human ESCs Assess staining of Pluripotency markers: OCT4, TRA-1-60, Nanog OCT4 99.6% TRA-1-60 99.9% 46XY, Resolution 450–500 Not performed 10 loci, matched Heterozygous, CHCHD2 Not performed Mycoplasma testing by PCR (TRANSGEN BIOTECH,FM31101), Negative Proof of three germlayers formation. Negative
Genotype additional info (OPTIONAL)
Blood group genotyping HLA tissue typing
Not performed Not performed
Flow cytometry Genotype Identity Mutation analysis (IF APPLICABLE)
Fig. 1 panel C Fig. 1 panel D Not performed STR analysis Fig. 1 panel E Not performed Not shown but available with author Fig. 1 panel G Not shown but available with author Not performed Not performed
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody
Dilution
Company Cat # and RRID
Mouse anti-OCT3/4 Rabbit anti-Nanog Mouse anti-TRA-1-60 Goat Anti-Mouse IgG H&L (Cy3 ®)preadsorbed Goat Anti-Mouse IgG H&L (FITC) Goat Anti-Rabbit IgG H&L (FITC)
1:300 1:400 1:400 1:2000 1:2000 1:2000
SANTA CRUZ BIOTECHNOLOGY, Cat# sc-5279, RRID: AB_628051 Abcam, Cat# ab80892, RRID: AB_2150114 Abcam, Cat# ab16288, RRID: AB_778563 Abcam, Cat# ab97035, RRID:AB_10680176 Abcam, Cat# ab6785, RRID:AB_955241 Abcam, Cat# ab6717, RRID:AB_955238
Plasmid specific primers(PCR)
Target OriP
Plasmid specific primers(PCR)
EBNA1
Targeted mutation analysis
CHCHD2
Forward/Reverse primer (5′-3′) Fw:TCGGGGGTGTTAGAGACAAC Rv:TTCCACGAGGGTAGTGAACC Fw: ATC AGG GCC AAG ACA TAG AGA TG Rv: GCC AAT GCA ACT TGG ACG TT Fw: GTTGACAATTTCCAAAACTGGTTGG Rv: GTACAGTACTTGTTGGTGCTGG
Pluripotency Markers Pluripotency Markers Pluripotency Markers Secondary antibodies Secondary antibodies Secondary antibodies Primers
Acknowledgements
(Dr. Yanlin Wang). We would like to express our sincere gratitude to the staff of the prenatal diagnosis center of the First Affiliated Hospital of Zhengzhou University for their selfless help in karyotype analysis.
This study was funded by the National Natural Science Foundation of China grants 81530037 and 81471158 and National Key R&D Program of China grant 2017YFA0105000 (these three grants were awarded to Dr. Yuming Xu); National Natural Science Foundation of China grants U1404311 and 81771290 (Dr. Changhe Shi) and grant 81600946 (Dr. Jing Yang); Henan Provincial Science and Technology Department grant 162300410129 (Dr. Jing Yang); Henan Provincial Education Department grant 16A320061 (Dr. Jing Yang); Technique Foundation of Henan Province grant 201503038 (Dr. Yutao Liu); Key Scientific Research Projects of Universities in Henan Province grant 16A320052 (Dr. Yutao Liu); and the Scientific Research Foundation of the First Affiliated Hospital of Zhengzhou University grant 20140116
References Bonifati, V., 2014. Genetics of Parkinson's disease–state of the art, 2013. Parkinsonism Relat Disord. 20 (Suppl. 1), S23–S28. https://doi.org/10.1016/S1353-8020(13) 70009-9. Cai, J., Orlova, V.V., Cai, X., Eekhoff, E.M.W., Zhang, K., Pei, D., Pan, G., Mummery, C.L., Dijke, P., 2015. Induced pluripotent stem cells to model human fibrodysplasia ossificans progressiva. Stem Cell Rep. 5 (6), 963–970. Shi, C.H., Mao, C.Y., Zhang, S.Y., Yang, J., Song, B., Wu, P., Zuo, C.T., Liu, Y.T., Ji, Y., Yang, Z.H., Wu, J., Zhuang, Z.P., Xu, Y.M., 2016. CHCHD2 gene mutations in familial and sporadic Parkinson's disease. Neurobiol. Aging. 38, 217.
90
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of induced pluripotent stem cell line (ZZUi007-A) from a 52year-old patient with a novel CHCHD2 gene mutation in Parkinson’s disease
T
Yanlin Wanga,1, Zhilei Wanga, Huifang Suna, Chengyuan Maoa, Jing Yanga, Yutao Liua, Han Liua, ⁎ ⁎ Shoutao Zhangc, Jin Zhangb, Yuming Xua, , Changhe Shia, a
Department of Neurology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, China Center for Stem Cell and Regenerative Medicine, Department of Basic Medical Sciences, The First Affiliated Hospital, College of Medicine, Institute of Hematology, Zhejiang University, Hangzhou, Zhejiang 310058, China c School of Life Sciences, Zhengzhou University, Zhengzhou, Henan 450001, China b
A B S T R A C T
CHCHD2 mutation has been reported as a potential cause of a rare form of familial Parkinson's disease. Recently, a novel CHCHD2 mutation was identified in a family with Parkinson's disease. The dermal fibroblasts of the patient were obtained and successfully transformed into induced pluripotent stem cells(iPSCs), employing episomal plasmids expressing OCT3/4, SOX2, KLF4, LIN28, and L-MYC. Our model may offer a good platform for further research on the pathomechanism, drug testing, and gene therapy of this disease.
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
ZZUi007-A ZZU-iPS-PD-CHCHD2–001 Department of Neurology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou University Yuming Xu [email protected] iPSC Human Age: 52 Sex: Male Ethnicity: Han Chinese Human skin fibroblasts Electroporated with episomal plasmids NO N/A Parkinson's disease CHCHD2/c.182C > T (p.Thr61Ile) N/A N/A N/A July 2017 N/A This study was approved by the medical research ethics committee of the First Affiliated Hospital of Zhengzhou University (NO. 2016-007).
⁎
Corresponding authors. E-mail addresses: [email protected] (Y. Xu), [email protected] (C. Shi). 1 First author https://doi.org/10.1016/j.scr.2018.08.011 Received 31 May 2018; Accepted 10 August 2018 Available online 23 August 2018 1873-5061/ © 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 32 (2018) 87–90
Y. Wang et al.
Resource table: Resource utility: CHCHD2 mutation has been shown to be associated with Parkinson's disease (PD) (Shi et al., 2016). Induced pluripotent stem cells (iPSCs), generated from a patient harboring a CHCHD2 mutation, may provide an ideal cell model for exploring the pathogenesis of this disease and aid in drug screening. Resource details: Parkinson's disease (PD) is one of the most common neurodegenerative disorders, characterized by resting tremors, muscular rigidity, bradykinesia, and postural instability. Previous studies have revealed that parkinsonism can be caused by mutations in several genes including parkin, PTEN-induced putative kinase protein 1 (PINK1), parkinsonism-associated deglycase (DJ1), and ATPase 13A2 (ATP13A2) (Bonifati, 2014). In this study, a novel CHCHD2 mutation was identified in a family with Parkinson's disease (Shi et al., 2016), and the fibroblasts of the patient were successfully transformed into iPSCs. Episomal plasmids were used to generate the ZZUi007-A iPSC line (Fig. 1A). Pluripotency markers were examined via immunocytochemical staining using antibodies against human OCT-4, TRA-1-60 and Nanog (Fig. 1B). Flow cytometric analysis showed that more than 99% of the cells expressed OCT-4 and TRA-1-60 (Fig. 1C). The karyotype of CHCHD2–01 iPSCs was numerically and structurally normal (Fig. 1D). The mutation (c.182C > T; p.Thr61Ile) in CHCHD2 was confirmed by Sanger sequencing in the newly established iPSC line (Fig. 1E). Episomal plasmids were detected by polymerase chain reaction (PCR) using episomal plasmid-specific primers and disappeared from passage 15 (Fig. 1F). Furthermore, the iPSC line had the potential to differentiate into cells of all three germ layers in vivo (Fig. 1G).
1. Materials and methods
1.5. Karyotyping
1.1. Ethical statement
Chromosomes of at least 30 proliferating cells were counted and fully analyzed using G-banding by the prenatal diagnosis center of the First Affiliated Hospital of Zhengzhou University.
Written informed consent was obtained from the patient and the study was approved by the medical research ethics committee of the First Affiliated Hospital of Zhengzhou University.
1.6. PCR
1.2. Reprogramming of fibroblasts into iPSCs
Genomic DNA was isolated from the cells using Tissue gDNA Kit (BIOMIGA, GD2211-01). DNA (1 μL) was mixed with forward primer (1 μL), reverse primer (1 μL), double-distilled H2O (12 μL), and 2× Vazyme LAmp Master Mix (15 μL) (Vazyme). PCR was performed with the primers listed in Table 2.
A skin biopsy was obtained from the forearm of a 52-year-old male patient, then dissected and left in fibroblast medium (Dulbecco's Modified Eagle's Medium with high glucose +10% fetal bovine serum), 0.1 mM MEM Non-Essential Amino Acids Solution, 0.1% β-mercaptoethanol, and 1% penicillin-streptomycin (Thermo Fisher Scientific). Subsequently, these fibroblasts were electroporated with OriP/EBNA-1based episomal plasmids expressing reprogramming factors OCT4, SOX2, KLF-4, L-MYC, and LIN28 (Cai et al., 2015).
1.7. Sanger sequencing Genomic DNA was extracted from the established iPSCs using the Tissue gDNA Kit (BIOMIGA, GD2211-01). The frameshift mutation in CHCHD2 was amplified using specific primers (Table 2) and analyzed by Sanger sequencing.
1.3. Immunocytochemistry Cells were fixed in 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and blocked in 3% bovine serum albumin. They were then incubated with primary antibodies and visualized with secondary antibodies. DAPI was used for nuclear counterstaining. Antibodies used are listed in Table 2.
1.8. Teratoma formation iPSCs (2–3 × 106) were suspended in 100 μL of Matrigel (Corning, 354277). Cells were injected into immune-deficient mice (NOD/SCID). Teratomas were formed within 6–8 weeks. Upon removal, the teratomas were fixed, embedded in paraffin, and stained with hematoxylin and eosin.
1.4. Flow cytometry analysis Cells were harvested and washed twice in phosphate-buffered saline. They were incubated with primary antibodies for 30 min at 37 °C and then incubated with secondary antibodies for 30 min at 37 °C. Expression of pluripotency markers was analyzed by flow cytometry (BD Biosciences). Unstained iPSCs were used as negative controls to exclude data from non-specific fluorescence.
1.9. Short Tandem Repeat (STR) analysis SR analysis was performed on the fibroblasts and iPSCs were generated using Promega kit 10 microsatellite markers with detection of ten loci and analyzed on 3730xl DNA Analyzer (Applied Biosystems™) using GeneMapper 4.0 (Thermo Fisher) (Table 1.
88
Stem Cell Research 32 (2018) 87–90
Y. Wang et al.
(caption on next page)
89
Stem Cell Research 32 (2018) 87–90
Y. Wang et al.
Fig. 1. Characterization of ZZUi007-A. (A) Pluripotency of iPSCs confirmed by immunostaining with TRA-1-60, Nanog, and OCT-4, nuclei was counterstained with DAPI (Scale bar = 200 μm). (B) FACS analysis for pluripotient markers. (C) Karyogram of iPSCs show normal ploidy of a male subject. (D) Sequencing chromatograms: vertical arrows indicate the mutation site (c.182C > T). (E) PCR gene expression analysis shows elimination of the non-integrating genome. (F) All three germ layers are shown in teratoma derived from the cell line with H&E staining (Scale bar = 200 μm).
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Immunocytochemisty
Fig. 1 panel A Fig. 1 panel B
Microbiology and virology
Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) STR analysis Sequencing Southern Blot OR WGS Mycoplasma
Differentiation potential Donor screening (OPTIONAL)
Teratoma formation HIV 1 + 2 Hepatitis B, Hepatitis C
Similar to human ESCs Assess staining of Pluripotency markers: OCT4, TRA-1-60, Nanog OCT4 99.6% TRA-1-60 99.9% 46XY, Resolution 450–500 Not performed 10 loci, matched Heterozygous, CHCHD2 Not performed Mycoplasma testing by PCR (TRANSGEN BIOTECH,FM31101), Negative Proof of three germlayers formation. Negative
Genotype additional info (OPTIONAL)
Blood group genotyping HLA tissue typing
Not performed Not performed
Flow cytometry Genotype Identity Mutation analysis (IF APPLICABLE)
Fig. 1 panel C Fig. 1 panel D Not performed STR analysis Fig. 1 panel E Not performed Not shown but available with author Fig. 1 panel G Not shown but available with author Not performed Not performed
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody
Dilution
Company Cat # and RRID
Mouse anti-OCT3/4 Rabbit anti-Nanog Mouse anti-TRA-1-60 Goat Anti-Mouse IgG H&L (Cy3 ®)preadsorbed Goat Anti-Mouse IgG H&L (FITC) Goat Anti-Rabbit IgG H&L (FITC)
1:300 1:400 1:400 1:2000 1:2000 1:2000
SANTA CRUZ BIOTECHNOLOGY, Cat# sc-5279, RRID: AB_628051 Abcam, Cat# ab80892, RRID: AB_2150114 Abcam, Cat# ab16288, RRID: AB_778563 Abcam, Cat# ab97035, RRID:AB_10680176 Abcam, Cat# ab6785, RRID:AB_955241 Abcam, Cat# ab6717, RRID:AB_955238
Plasmid specific primers(PCR)
Target OriP
Plasmid specific primers(PCR)
EBNA1
Targeted mutation analysis
CHCHD2
Forward/Reverse primer (5′-3′) Fw:TCGGGGGTGTTAGAGACAAC Rv:TTCCACGAGGGTAGTGAACC Fw: ATC AGG GCC AAG ACA TAG AGA TG Rv: GCC AAT GCA ACT TGG ACG TT Fw: GTTGACAATTTCCAAAACTGGTTGG Rv: GTACAGTACTTGTTGGTGCTGG
Pluripotency Markers Pluripotency Markers Pluripotency Markers Secondary antibodies Secondary antibodies Secondary antibodies Primers
Acknowledgements
(Dr. Yanlin Wang). We would like to express our sincere gratitude to the staff of the prenatal diagnosis center of the First Affiliated Hospital of Zhengzhou University for their selfless help in karyotype analysis.
This study was funded by the National Natural Science Foundation of China grants 81530037 and 81471158 and National Key R&D Program of China grant 2017YFA0105000 (these three grants were awarded to Dr. Yuming Xu); National Natural Science Foundation of China grants U1404311 and 81771290 (Dr. Changhe Shi) and grant 81600946 (Dr. Jing Yang); Henan Provincial Science and Technology Department grant 162300410129 (Dr. Jing Yang); Henan Provincial Education Department grant 16A320061 (Dr. Jing Yang); Technique Foundation of Henan Province grant 201503038 (Dr. Yutao Liu); Key Scientific Research Projects of Universities in Henan Province grant 16A320052 (Dr. Yutao Liu); and the Scientific Research Foundation of the First Affiliated Hospital of Zhengzhou University grant 20140116
References Bonifati, V., 2014. Genetics of Parkinson's disease–state of the art, 2013. Parkinsonism Relat Disord. 20 (Suppl. 1), S23–S28. https://doi.org/10.1016/S1353-8020(13) 70009-9. Cai, J., Orlova, V.V., Cai, X., Eekhoff, E.M.W., Zhang, K., Pei, D., Pan, G., Mummery, C.L., Dijke, P., 2015. Induced pluripotent stem cells to model human fibrodysplasia ossificans progressiva. Stem Cell Rep. 5 (6), 963–970. Shi, C.H., Mao, C.Y., Zhang, S.Y., Yang, J., Song, B., Wu, P., Zuo, C.T., Liu, Y.T., Ji, Y., Yang, Z.H., Wu, J., Zhuang, Z.P., Xu, Y.M., 2016. CHCHD2 gene mutations in familial and sporadic Parkinson's disease. Neurobiol. Aging. 38, 217.
90