- Email: [email protected]
Generation of induced pluripotent stem cells MMCi001-A from a Taiwanese hearing loss patient carrying GJB2 pV37I mutation
Stem Cell Research 42 (2020) 101692
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of induced pluripotent stem cells MMCi001-A from a Taiwanese hearing loss patient carrying GJB2 pV37I mutation
T
Huai-En Lua, Chia-Ling Tsaib, Ing-Ming Chiuc, Yu-Ling Panb, Yi-Feng Linb, Hung-Ching Lind,e, ⁎ Yi-Chao Hsub, a
Bioresource Collection and Research Center, Food Industry Research and Development Institute, Hsinchu, Taiwan Institute of Biomedical Sciences, Mackay Medical College, New Taipei City, Taiwan c Institute of Cellular and System Medicine, National Health Research Institutes, Miaoli, Taiwan d Department of Audiology and Speech-Language Pathology, Mackay Medical College, New Taipei City, Taiwan e Department of Otolaryngology, Mackay Memorial Hospital, Taipei, Taiwan b
A B S T R A C T
Hearing loss is the most common disorder in the sensory system. Mutations in GJB2 have been reported to be very common in sensorineural hearing loss patients. In this report, we generated an induced pluripotent stem cell (iPSC) line, MMCi001-A, from the peripheral blood mononuclear cells of a 4-year-old male hearing loss patient carrying GJB2 pV37I mutation by using the Sendai virus delivery system. The generated iPSCs were demonstrated to express pluripotent markers and be differentiated into three germ layers in vitro and in vivo. This GJB2-pV37I iPSCs is valuable for studying the pathogenic mechanisms and drug discovery of hearing loss.
Cell line repository/bank
Resource Table:
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date
⁎
MMCi001-A
Ethical approval
MMCiPSC-001-A Institute of Biomedical Sciences, Mackay Medical College, Taiwan Yi Chao Hsu, [email protected] iPSC Human Age: 4 Sex: male Ethnicity: Taiwanese Peripheral blood mononuclear cells Clonal Transgene free (CytoTune-iPS 2.0 Sendai Reprogramming Kit) YES Hereditary sensorineural hearing loss GJB2 13q12.11 N/A N/A N/A
Bioresource Collection and Research Center, Taiwan https://catalog.bcrc.firdi.org.tw/BSAS_cart/controller? event=WELCOME Approvals from the Institutional Review Board on Biomedical Science Research at Mackay Memorial Hospital Institutional Review (14MMHIS249) were attained.
1. Resource utility iPSCs derived from sensorineural hearing loss (SNHL) patients are valuable for the generation of disease-relevant inner ear cells, including hair cells and spiral ganglion neurons, which are powerful tools for the study of pathogenic mechanisms and drug discovery. 2. Resource details Sensorineural hearing loss (SNHL) is a very common sensory disorder in the world. SNHL can be caused by genetic mutations, loud noise exposure, ototoxicity, aging or bacterial and viral infections. All of these causes may lead to the dysfunction or loss of inner ear hair cells. Genetic mutations are the major causes of hearing loss in patients. The rate of congenital hearing impairments in new-borns in the world is about 3/1000 and there are about 300 to 400 new-borns detected to have congenital SNHL each year. Among these SNHL patients,
November 30, 2019
Corresponding author. E-mail address: [email protected] (Y.-C. Hsu).
https://doi.org/10.1016/j.scr.2019.101692 Received 25 November 2019; Received in revised form 13 December 2019; Accepted 18 December 2019 Available online 18 December 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 42 (2020) 101692
H.-E. Lu, et al.
Fig. 1. Characterization of MMCi001-A iPSC carrying GJB2 pV37I mutation.
nerve impulse to brain. Therefore, the mutations in GJB2 gene would lead to the abnormal inner ear's lymph composition, and failure in transforming sound vibration as a neurotransmission to the nerves. It has been reported that the most common mutation in Taiwan is GJB2 pV37I homozygous mutation from the screening of more than 5000 hearing loss patients (Wu et al., 2008). To date, there is no evidencebased therapy for the patients with GJB2-related SNHL. The lack of a patient-oriented disease model, especially in the scenario that the GJB2
approximately 70% of them are non-syndromic hearing loss. More importantly, the mutations in the gap junction protein beta-2 (GJB2) gene were detected in about 50% of patients with autosomal recessive SNHL (Parzefall et al., 2017; Zheng et al., 2015). The GJB2 gene encodes the protein connexin 26 (Cx26) for the cellular function of gap junction that is responsible for ion transport between the inner ear cells and the inner ear lymph. The ion transport in the inner ear is crucial for transforming the neurotransmission from the vibration of the sound to a 2
Stem Cell Research 42 (2020) 101692
H.-E. Lu, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology
Photography
Normal morphology
Fig. 1(E)
Phenotype
Immunocytochemistry
Fig. 1(E)
Genotype Identity
Karyotype (G-banding) and resolution Microsatellite PCR (mPCR)
Positive for expression of pluripotency markers: Oct4, Sox2, SSEA-4, TRA 1-60 46XX, Resolution: 5 Mb Not performed
STR analysis
Tested 16 sites, all matched
Supplementary Figure 1
Sanger Sequencing
SNP Analysis:
Fig. 1(D)
Southern Blot OR WGS Mycoplasma Embryoid body formation and Teratoma formation
N/A Supplementary Figure 1 Fig. 1(E), (F) & (G)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping
Not performed Mycoplasma testing by PCR. negative Embryoid body formation: alpha-fetoprotein (AFP) for endoderm, smooth muscle actin (SMA) for mesoderm, and beta-III tubulin (TUJ1) for ectoderm. Teratoma formation: gland structure for endoderm, cartilage for mesoderm, and pigment epithelium for ectoderm. N/A N/A
HLA tissue typing
N/A
N/A
Mutation analysis (IF APPLICABLE)
Microbiology and virology Differentiation potential
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Fig. 1(C), P10 N/A
N/A N/A
medium (StemPro®−34 complete medium, Thermo Fisher Scientific) supplemented with [100 ng/ml] SCF, [100 ng/ml] FLT-3, [20 ng/mL] IL-3, [20 ng/mL] IL-6. All growth factors were purchased from Thermo Fisher Scientific. Furthermore, PBMCs were reprogrammed by using the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) at different multiplicity of infection (MOI) (KOS MOI=5, hc-Myc MOI=5, and hKlf4 MOI=3). Subsequently, the 24-well-plate was placed into the incubator with 37°C, 5% CO2. After seven days, the reprogrammed cells were re-plated onto a 10-cm dish with pre-seeded mouse embryonic fibroblast (MEF) feeder cells. Every other day, the medium was replaced with the medium for culturing human embryonic stem cells (hES medium: DMEM/F-12 supplemented with 20% KnockOut™ Serum Replacement, 1% 10 mM MEM Non-Essential Amino Acids Solution, 1% GlutaMAX™-I, 0.1 mM β-mercaptoethanol, 1% Penicillin-Streptomycin and [10 ng/mL] bFGF). All the hES medium components were also purchased from Thermo Fisher Scientific. The human ES medium that fed the reprogrammed cells were replaced every other day for a week. Once the colonies were observed, the colonies were detached with Accutase solution (Innovative Cell Technology) in the presence of 10 μM Y-27632 and then transferred to a new dish with fresh MEF feeder cells. The cell ratio for passaging was between 1:2 and 1:4. Then the hES medium was replaced every day to maintain the resulting iPSC colonies.
mutation in mice is embryonic lethal, delays the progress of drug discovery targeting GJB2-related SNHL. In this study, we generated an induced pluripotent stem cell (iPSC) line, MMCi001-A, from a 4-yearold male SNHL patient carrying GJB2 pV37I mutation. The peripheral blood mononuclear cells (PBMCs) of this patient were reprogrammed into iPSCs by using the Sendai-virus delivery system (CytoTune-iPS 2.0 Sendai Reprogramming Kit). After virus infection, cells were re-plated onto the feed cells that are composed of mouse embryonic fibroblasts (MEF). The medium was subsequently changed to iPSC medium. Once the cell colonies were observed, these colonies were picked and transferred to a new culture dish with fresh feeder cells. By passage 10, we provided evidence that all exogenous reprogramming factors have been removed in MMCi001-A cells (Fig. 1A), but the expression capacities of endogenous OCT4, SOX2 and NANOG genes were regained (Fig. 1B). The MMCi001-A carrying the pathogenic GBJ2 gene pV37I homozygous mutation had normal karyotype (Fig. 1C). We also demonstrated the resulting iPSCs expressed the pluripotent proteins, OCT4, SOX2, SSEA-4 and TRA-1–60 by immunocytochemistry staining (Fig. 1D, scale bar: 100 μm). Using embryoid body (EB) formation assay, we demonstrated that MMCi001-A cells could be differentiated into the principal cells in three germ layers with the expression of endodermal (alpha-fetoprotein, AFP), mesodermal (alpha-smooth muscle actin, α-SMA) or ectodermal (βIII-tubulin, TUJ1) markers (Fig. 1E, scale bar: 100 μm). In vivo, MMCi001-A cells were injected subcutaneously into nude mice. As a result, teratoma-like masses were observed and analysed by immunohistochemical staining after eight weeks. We could observe that the teratoma possessed the principal tissues in three germ layers, such as glandular structures (endoderm), cartilage (mesoderm) and neural rosette (ectoderm) (Fig. 1F, scale bar: 100 μm). In conclusion, we generated the MMCi001-A cells, which could be a useful tool for drug discovery targeting GJB2 pV37I mutation SNHL.
3.2. RNA extraction and RT-PCR Total RNA in the resulting iPSC clone was extracted by using TRIzol reagent (Life Technologies), and the reverse transcription for cDNA synthesis was performed using RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas). Polymerase chain reaction (PCR) was used to confirm the existence of transgenes and the expression of pluripotency genes of MMCi001-A by using GeneAmp PCR System 2400. The primers for the analysed genes are listed in Table 2. The conditions for PCR were listed as follows: the first step for denaturation at 95°C for 3 min, followed by the second step for 35 cycles of amplification (95°C for 30 s, 55–60°C for 1 min, and 72°C for 1 min) and a final step for the extension at 72°C for 7 min.
3. Materials and methods 3.1. Generation of human induced pluripotent stem cells (hiPSCs) MMCi001-A cells were generated by reprogramming the PBMCs from the SNHL patient carrying GJB2 pV37I mutation. Reprogramming was performed following the manufacturer's protocol of CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific). Briefly, PBMCs (5 × 105) were seeded in a 24-well plate with PBMC culture
3.3. Immunofluorescence staining The characteristics of the resulting iPSCs were confirmed by using 3
Stem Cell Research 42 (2020) 101692
H.-E. Lu, et al.
3.4. In vitro differentiation
Table 2 Reagents details.
In vitro differentiation capacities of MMCi001-A cells was demonstrated by embryoid body (EB) formation assay. iPSCs were re-seeded onto 6-well plates (ultralow attachment, Corning) in DMEM and F12 (1:1) supplemented with 0.1 mM NEAA, 1 mM GlutaMax, 20% FBS, 0.1 mM 2-mercaptoethanol, 50 U/mL penicillin and 50 mg/mL streptomycin for 7 days. Seven days later, EBs were re-seeded onto 0.1% gelatin-coated plates for 2 weeks. The cells were fixed by formaldehyde for further immunostaining experiments of markers in three germ layers by using three-Germ Layer Immunocytochemistry Kit (Thermo Fisher Scientific) to demonstrate the expression of marker genes in endodermal (AFP), mesodermal (α-SMA), and ectodermal (βIII-Tubulin).
Antibodies used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency marker
Rabbit antiOCT4
1:100
Pluripotency marker
Rat anti-SOX2
1:100
Pluripotency marker
Mouse antiSSEA4 (IgG3)
1:100
Pluripotency marker
1:100
Differentiation marker
Mouse antiTRA-1-60 (IgM) Rabbit antiTUJ1
Differentiation marker
Mouse antiAFP (IgG1)
1:500
Differentiation marker
Mouse antiSMA (IgG2a)
1:100
Secondary antibody
Alexa Fluor 555 donkey antirabbit Alexa Fluor 488 donkey anti-rat Alexa Fluor 488 donkey antirabbit
1:250
Target
Forward/Reverse primer (5′−3′)
Sendai virus detection
SeV/ 181 bp
Sendai virus detection Sendai virus detection Sendai virus detection Pluripotent stem cell marker Pluripotent stem cell marker Pluripotent stem cell marker House-keeping gene
KOS/ 528 bp
F: GGATCACTAGGTGATATCGAGC R: ACCAGACAAGAGTTTAAGAGATATGTATC F: ATGCACCGCTACGACGTGAGCGC R: ACCTTGACAATCCTGATGTGG F: TTCCTGCATGCCAGAGGAGCCC R: AATGTATCGAAGGTGCTCAA F: TAACTGACTAGCAGGCTTGTCG R: TCCACATACAGTCCTGGATGATGATG F: TGTACTCCTCGGTCCCTTTC R: TCCAGGTTTTCTTTCCTAGC F: GCTAGTCTCCAAGCGACGAA R: GCAAGAAGCCTCTCCTTGAA F: CAGTCTGGACACTGGCTGAA R: CTCGCTGATTAGGCTCCAAC F: AGCCACATCGCTCAGACACC R: GTACTCAGCGGCCAGCATCG F: TCTTTTCCAGAGCAAACCGC R: GATGCGGACCTTCTGGGTTT
Secondary antibody
Secondary antibody
1:500
1:250
1:250
Thermo Fisher Scientific Cat# A24867, RRID: AB_2650999 Thermo Fisher Scientific Cat# A24759, RRID: AB_2651000 Thermo Fisher Scientific Cat# A24866, RRID: AB_2651001 Thermo Fisher Scientific Cat# A24868, RRID: AB_2651002 Thermo Fisher Scientific Cat# A25532, RRID: AB_2651003 Thermo Fisher Scientific Cat# A25530, RRID: AB_2651004 Thermo Fisher Scientific Cat# A25531, RRID: AB_2651005 Thermo Fisher Scientific Cat# A24869, RRID: AB_2651006
3.5. In vivo differentiation In vivo differentiation capacities of MMCi001-A cells were confirmed by using teratoma formation assay. 1 × 106 of the resulting iPSC cells were transplanted into the testis of a NOD/SCID mouse. After eight weeks, the testis was dissected and fixed with 10% formaldehyde. Subsequent procedures for immunohistochemistry were used for the staining of haematoxylin and eosin. 3.6. Karyotyping Karyotyping analysis was used to demonstrate the chromosomal stability of MMCi001-A cells. Briefly, the resulting iPSCs were treated with 10 μg/ml of colcemid (Thermo Fisher Scientific) for 60 min at 37°C. Single cells were then trypsinized, and treated with 0.075 M hypotonic KCl solution. Furthermore, the cell was fixed with Carnoy's fixative solution with methanol and acetic Acid (3:1). The analyses of chromosome spreads in metaphase (20 metaphase spreads were counted) and G-banding were performed in the Center for Medical Genetics of Changhua Christian Hospital, Taiwan.
Thermo Fisher Scientific Cat# A24876, RRID: AB_2651007 Thermo Fisher Scientific Cat# A25535, RRID: AB_2651010
Primers
Mutation analysis
KLF4/ 410 bp c-MYC/ 532 bp OCT4/ 149 bp SOX2/ 148 bp NANOG/ 143 bp GAPDH/ 302 bp GJB2 Exon 2/ 416 bp
3.7. Mutation analysis Sanger sequencing analyses was conducted by Genomics Inc, Taiwan. In brief, genomic DNA was purified from MMCi001-A cells by PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific). Genomic DNA of the resulting iPSCs was used as a template to amplify the exon 2 of GJB2 gene using primers listed in Table 2. 4. STR analysis For STR-PCR, total cellular DNA were extracted from MMCi001-A and the original PBMCs by PureLink™ genomic DNA mini kit. Fifteen loci, including FGA, vWA, TPOX, D8S1179, D7S820, D3S1358, D21S11, TH01, D13S317, D16S539, D2S1338, CSF1PO, D19S433, D18S51 and D5S818 were analysed by AmpFLSTR™ Identifier™ PCR Amplification Kit. All reagents were purchased from Thermo Fisher Scientific.
PSC 4-Marker Immunocytochemistry Kit (Life Technologies, Invitrogen). For the procedure of immunofluorescence staining, cells were fixed with 4% (w/v) formaldehyde at room temperature for 10 minutes and washed by phosphate-buffered saline (PBS) three times. In addition, the step for permeabilisation (1% (v/v) Saponin in PBS) was included for the staining with antibodies for the markers in the cytosol or nucleus. 3% (w/v) bovine serum albumin (Sigma) was used to block non-specific staining. Subsequently, the cells were incubated with primary antibodies at 4°C for 16 hours, and then incubated with Alexa 594- (red) or Alexa 488 (green)-conjugated secondary antibodies for 1 h at room temperature. Nuclei were stained by NucBlue® Fixed Cell Stain (Thermo Fisher Scientific).
5. Mycoplasma detection Detection of mycoplasma contamination was performed by using Mycoplasma PCR Detection Kit (ABM Inc.). Briefly, the resulting MMCi001-A cells were cultured for more than 72 h, and then the culture medium was collected for analysis of mycoplasma contamination (Table 1). Acknowledgments We thank the discussion and technical support from Taiwan Human Disease iPSC Service Consortium. The Consortium is funded by the Ministry of Science and Technology (MOST) (MOST 106-2319-B-001003, 108-2218-E-080 -001). We thank the grants from the Ministry of 4
Stem Cell Research 42 (2020) 101692
H.-E. Lu, et al.
Science and Technology (MOST) of Taiwan Government (MOST 1072314-B-715 -004 -MY3), intramural research grants from Mackay Medical College(1052B07, 1051B23, 1061B09, 1071B12, 1081E03).
et al., 2017. Whole-exome sequencing to identify the cause of congenital sensorineural hearing loss in carriers of a heterozygous GJB2 mutation. Eur. Arch. Otorhinolaryngol. 274 3619-325. Wu, C.C., Chen, P.J., Chiu, Y.H., Lu, Y.C., Wu, M.C., Hsu, C.J., 2008. Prospective mutation screening of three common deafness genes in a large Taiwanese Cohort with idiopathic bilateral sensorineural hearing impairment reveals a difference in the results between families from hospitals and those from rehabilitation facilities. Audiol. Neurootol. 13, 172–181. Zheng J, J., Ying, Z., Cai, Z., Sun, D., He, Z., Gao, Y., et al., 2015. GJB2 mutation spectrum and genotype-phenotype correlation in 1067 Han Chinese Subjects with non-syndromic hearing loss. PLoS ONE 10, e0128691.
Supplementary materials Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2019.101692. References Parzefall T, T., Frohne, A., Koenighofer, M., Kirchnawy, A., Streubel, B., Schoefer, C.,
5
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of induced pluripotent stem cells MMCi001-A from a Taiwanese hearing loss patient carrying GJB2 pV37I mutation
T
Huai-En Lua, Chia-Ling Tsaib, Ing-Ming Chiuc, Yu-Ling Panb, Yi-Feng Linb, Hung-Ching Lind,e, ⁎ Yi-Chao Hsub, a
Bioresource Collection and Research Center, Food Industry Research and Development Institute, Hsinchu, Taiwan Institute of Biomedical Sciences, Mackay Medical College, New Taipei City, Taiwan c Institute of Cellular and System Medicine, National Health Research Institutes, Miaoli, Taiwan d Department of Audiology and Speech-Language Pathology, Mackay Medical College, New Taipei City, Taiwan e Department of Otolaryngology, Mackay Memorial Hospital, Taipei, Taiwan b
A B S T R A C T
Hearing loss is the most common disorder in the sensory system. Mutations in GJB2 have been reported to be very common in sensorineural hearing loss patients. In this report, we generated an induced pluripotent stem cell (iPSC) line, MMCi001-A, from the peripheral blood mononuclear cells of a 4-year-old male hearing loss patient carrying GJB2 pV37I mutation by using the Sendai virus delivery system. The generated iPSCs were demonstrated to express pluripotent markers and be differentiated into three germ layers in vitro and in vivo. This GJB2-pV37I iPSCs is valuable for studying the pathogenic mechanisms and drug discovery of hearing loss.
Cell line repository/bank
Resource Table:
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date
⁎
MMCi001-A
Ethical approval
MMCiPSC-001-A Institute of Biomedical Sciences, Mackay Medical College, Taiwan Yi Chao Hsu, [email protected] iPSC Human Age: 4 Sex: male Ethnicity: Taiwanese Peripheral blood mononuclear cells Clonal Transgene free (CytoTune-iPS 2.0 Sendai Reprogramming Kit) YES Hereditary sensorineural hearing loss GJB2 13q12.11 N/A N/A N/A
Bioresource Collection and Research Center, Taiwan https://catalog.bcrc.firdi.org.tw/BSAS_cart/controller? event=WELCOME Approvals from the Institutional Review Board on Biomedical Science Research at Mackay Memorial Hospital Institutional Review (14MMHIS249) were attained.
1. Resource utility iPSCs derived from sensorineural hearing loss (SNHL) patients are valuable for the generation of disease-relevant inner ear cells, including hair cells and spiral ganglion neurons, which are powerful tools for the study of pathogenic mechanisms and drug discovery. 2. Resource details Sensorineural hearing loss (SNHL) is a very common sensory disorder in the world. SNHL can be caused by genetic mutations, loud noise exposure, ototoxicity, aging or bacterial and viral infections. All of these causes may lead to the dysfunction or loss of inner ear hair cells. Genetic mutations are the major causes of hearing loss in patients. The rate of congenital hearing impairments in new-borns in the world is about 3/1000 and there are about 300 to 400 new-borns detected to have congenital SNHL each year. Among these SNHL patients,
November 30, 2019
Corresponding author. E-mail address: [email protected] (Y.-C. Hsu).
https://doi.org/10.1016/j.scr.2019.101692 Received 25 November 2019; Received in revised form 13 December 2019; Accepted 18 December 2019 Available online 18 December 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 42 (2020) 101692
H.-E. Lu, et al.
Fig. 1. Characterization of MMCi001-A iPSC carrying GJB2 pV37I mutation.
nerve impulse to brain. Therefore, the mutations in GJB2 gene would lead to the abnormal inner ear's lymph composition, and failure in transforming sound vibration as a neurotransmission to the nerves. It has been reported that the most common mutation in Taiwan is GJB2 pV37I homozygous mutation from the screening of more than 5000 hearing loss patients (Wu et al., 2008). To date, there is no evidencebased therapy for the patients with GJB2-related SNHL. The lack of a patient-oriented disease model, especially in the scenario that the GJB2
approximately 70% of them are non-syndromic hearing loss. More importantly, the mutations in the gap junction protein beta-2 (GJB2) gene were detected in about 50% of patients with autosomal recessive SNHL (Parzefall et al., 2017; Zheng et al., 2015). The GJB2 gene encodes the protein connexin 26 (Cx26) for the cellular function of gap junction that is responsible for ion transport between the inner ear cells and the inner ear lymph. The ion transport in the inner ear is crucial for transforming the neurotransmission from the vibration of the sound to a 2
Stem Cell Research 42 (2020) 101692
H.-E. Lu, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology
Photography
Normal morphology
Fig. 1(E)
Phenotype
Immunocytochemistry
Fig. 1(E)
Genotype Identity
Karyotype (G-banding) and resolution Microsatellite PCR (mPCR)
Positive for expression of pluripotency markers: Oct4, Sox2, SSEA-4, TRA 1-60 46XX, Resolution: 5 Mb Not performed
STR analysis
Tested 16 sites, all matched
Supplementary Figure 1
Sanger Sequencing
SNP Analysis:
Fig. 1(D)
Southern Blot OR WGS Mycoplasma Embryoid body formation and Teratoma formation
N/A Supplementary Figure 1 Fig. 1(E), (F) & (G)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping
Not performed Mycoplasma testing by PCR. negative Embryoid body formation: alpha-fetoprotein (AFP) for endoderm, smooth muscle actin (SMA) for mesoderm, and beta-III tubulin (TUJ1) for ectoderm. Teratoma formation: gland structure for endoderm, cartilage for mesoderm, and pigment epithelium for ectoderm. N/A N/A
HLA tissue typing
N/A
N/A
Mutation analysis (IF APPLICABLE)
Microbiology and virology Differentiation potential
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Fig. 1(C), P10 N/A
N/A N/A
medium (StemPro®−34 complete medium, Thermo Fisher Scientific) supplemented with [100 ng/ml] SCF, [100 ng/ml] FLT-3, [20 ng/mL] IL-3, [20 ng/mL] IL-6. All growth factors were purchased from Thermo Fisher Scientific. Furthermore, PBMCs were reprogrammed by using the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) at different multiplicity of infection (MOI) (KOS MOI=5, hc-Myc MOI=5, and hKlf4 MOI=3). Subsequently, the 24-well-plate was placed into the incubator with 37°C, 5% CO2. After seven days, the reprogrammed cells were re-plated onto a 10-cm dish with pre-seeded mouse embryonic fibroblast (MEF) feeder cells. Every other day, the medium was replaced with the medium for culturing human embryonic stem cells (hES medium: DMEM/F-12 supplemented with 20% KnockOut™ Serum Replacement, 1% 10 mM MEM Non-Essential Amino Acids Solution, 1% GlutaMAX™-I, 0.1 mM β-mercaptoethanol, 1% Penicillin-Streptomycin and [10 ng/mL] bFGF). All the hES medium components were also purchased from Thermo Fisher Scientific. The human ES medium that fed the reprogrammed cells were replaced every other day for a week. Once the colonies were observed, the colonies were detached with Accutase solution (Innovative Cell Technology) in the presence of 10 μM Y-27632 and then transferred to a new dish with fresh MEF feeder cells. The cell ratio for passaging was between 1:2 and 1:4. Then the hES medium was replaced every day to maintain the resulting iPSC colonies.
mutation in mice is embryonic lethal, delays the progress of drug discovery targeting GJB2-related SNHL. In this study, we generated an induced pluripotent stem cell (iPSC) line, MMCi001-A, from a 4-yearold male SNHL patient carrying GJB2 pV37I mutation. The peripheral blood mononuclear cells (PBMCs) of this patient were reprogrammed into iPSCs by using the Sendai-virus delivery system (CytoTune-iPS 2.0 Sendai Reprogramming Kit). After virus infection, cells were re-plated onto the feed cells that are composed of mouse embryonic fibroblasts (MEF). The medium was subsequently changed to iPSC medium. Once the cell colonies were observed, these colonies were picked and transferred to a new culture dish with fresh feeder cells. By passage 10, we provided evidence that all exogenous reprogramming factors have been removed in MMCi001-A cells (Fig. 1A), but the expression capacities of endogenous OCT4, SOX2 and NANOG genes were regained (Fig. 1B). The MMCi001-A carrying the pathogenic GBJ2 gene pV37I homozygous mutation had normal karyotype (Fig. 1C). We also demonstrated the resulting iPSCs expressed the pluripotent proteins, OCT4, SOX2, SSEA-4 and TRA-1–60 by immunocytochemistry staining (Fig. 1D, scale bar: 100 μm). Using embryoid body (EB) formation assay, we demonstrated that MMCi001-A cells could be differentiated into the principal cells in three germ layers with the expression of endodermal (alpha-fetoprotein, AFP), mesodermal (alpha-smooth muscle actin, α-SMA) or ectodermal (βIII-tubulin, TUJ1) markers (Fig. 1E, scale bar: 100 μm). In vivo, MMCi001-A cells were injected subcutaneously into nude mice. As a result, teratoma-like masses were observed and analysed by immunohistochemical staining after eight weeks. We could observe that the teratoma possessed the principal tissues in three germ layers, such as glandular structures (endoderm), cartilage (mesoderm) and neural rosette (ectoderm) (Fig. 1F, scale bar: 100 μm). In conclusion, we generated the MMCi001-A cells, which could be a useful tool for drug discovery targeting GJB2 pV37I mutation SNHL.
3.2. RNA extraction and RT-PCR Total RNA in the resulting iPSC clone was extracted by using TRIzol reagent (Life Technologies), and the reverse transcription for cDNA synthesis was performed using RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas). Polymerase chain reaction (PCR) was used to confirm the existence of transgenes and the expression of pluripotency genes of MMCi001-A by using GeneAmp PCR System 2400. The primers for the analysed genes are listed in Table 2. The conditions for PCR were listed as follows: the first step for denaturation at 95°C for 3 min, followed by the second step for 35 cycles of amplification (95°C for 30 s, 55–60°C for 1 min, and 72°C for 1 min) and a final step for the extension at 72°C for 7 min.
3. Materials and methods 3.1. Generation of human induced pluripotent stem cells (hiPSCs) MMCi001-A cells were generated by reprogramming the PBMCs from the SNHL patient carrying GJB2 pV37I mutation. Reprogramming was performed following the manufacturer's protocol of CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific). Briefly, PBMCs (5 × 105) were seeded in a 24-well plate with PBMC culture
3.3. Immunofluorescence staining The characteristics of the resulting iPSCs were confirmed by using 3
Stem Cell Research 42 (2020) 101692
H.-E. Lu, et al.
3.4. In vitro differentiation
Table 2 Reagents details.
In vitro differentiation capacities of MMCi001-A cells was demonstrated by embryoid body (EB) formation assay. iPSCs were re-seeded onto 6-well plates (ultralow attachment, Corning) in DMEM and F12 (1:1) supplemented with 0.1 mM NEAA, 1 mM GlutaMax, 20% FBS, 0.1 mM 2-mercaptoethanol, 50 U/mL penicillin and 50 mg/mL streptomycin for 7 days. Seven days later, EBs were re-seeded onto 0.1% gelatin-coated plates for 2 weeks. The cells were fixed by formaldehyde for further immunostaining experiments of markers in three germ layers by using three-Germ Layer Immunocytochemistry Kit (Thermo Fisher Scientific) to demonstrate the expression of marker genes in endodermal (AFP), mesodermal (α-SMA), and ectodermal (βIII-Tubulin).
Antibodies used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency marker
Rabbit antiOCT4
1:100
Pluripotency marker
Rat anti-SOX2
1:100
Pluripotency marker
Mouse antiSSEA4 (IgG3)
1:100
Pluripotency marker
1:100
Differentiation marker
Mouse antiTRA-1-60 (IgM) Rabbit antiTUJ1
Differentiation marker
Mouse antiAFP (IgG1)
1:500
Differentiation marker
Mouse antiSMA (IgG2a)
1:100
Secondary antibody
Alexa Fluor 555 donkey antirabbit Alexa Fluor 488 donkey anti-rat Alexa Fluor 488 donkey antirabbit
1:250
Target
Forward/Reverse primer (5′−3′)
Sendai virus detection
SeV/ 181 bp
Sendai virus detection Sendai virus detection Sendai virus detection Pluripotent stem cell marker Pluripotent stem cell marker Pluripotent stem cell marker House-keeping gene
KOS/ 528 bp
F: GGATCACTAGGTGATATCGAGC R: ACCAGACAAGAGTTTAAGAGATATGTATC F: ATGCACCGCTACGACGTGAGCGC R: ACCTTGACAATCCTGATGTGG F: TTCCTGCATGCCAGAGGAGCCC R: AATGTATCGAAGGTGCTCAA F: TAACTGACTAGCAGGCTTGTCG R: TCCACATACAGTCCTGGATGATGATG F: TGTACTCCTCGGTCCCTTTC R: TCCAGGTTTTCTTTCCTAGC F: GCTAGTCTCCAAGCGACGAA R: GCAAGAAGCCTCTCCTTGAA F: CAGTCTGGACACTGGCTGAA R: CTCGCTGATTAGGCTCCAAC F: AGCCACATCGCTCAGACACC R: GTACTCAGCGGCCAGCATCG F: TCTTTTCCAGAGCAAACCGC R: GATGCGGACCTTCTGGGTTT
Secondary antibody
Secondary antibody
1:500
1:250
1:250
Thermo Fisher Scientific Cat# A24867, RRID: AB_2650999 Thermo Fisher Scientific Cat# A24759, RRID: AB_2651000 Thermo Fisher Scientific Cat# A24866, RRID: AB_2651001 Thermo Fisher Scientific Cat# A24868, RRID: AB_2651002 Thermo Fisher Scientific Cat# A25532, RRID: AB_2651003 Thermo Fisher Scientific Cat# A25530, RRID: AB_2651004 Thermo Fisher Scientific Cat# A25531, RRID: AB_2651005 Thermo Fisher Scientific Cat# A24869, RRID: AB_2651006
3.5. In vivo differentiation In vivo differentiation capacities of MMCi001-A cells were confirmed by using teratoma formation assay. 1 × 106 of the resulting iPSC cells were transplanted into the testis of a NOD/SCID mouse. After eight weeks, the testis was dissected and fixed with 10% formaldehyde. Subsequent procedures for immunohistochemistry were used for the staining of haematoxylin and eosin. 3.6. Karyotyping Karyotyping analysis was used to demonstrate the chromosomal stability of MMCi001-A cells. Briefly, the resulting iPSCs were treated with 10 μg/ml of colcemid (Thermo Fisher Scientific) for 60 min at 37°C. Single cells were then trypsinized, and treated with 0.075 M hypotonic KCl solution. Furthermore, the cell was fixed with Carnoy's fixative solution with methanol and acetic Acid (3:1). The analyses of chromosome spreads in metaphase (20 metaphase spreads were counted) and G-banding were performed in the Center for Medical Genetics of Changhua Christian Hospital, Taiwan.
Thermo Fisher Scientific Cat# A24876, RRID: AB_2651007 Thermo Fisher Scientific Cat# A25535, RRID: AB_2651010
Primers
Mutation analysis
KLF4/ 410 bp c-MYC/ 532 bp OCT4/ 149 bp SOX2/ 148 bp NANOG/ 143 bp GAPDH/ 302 bp GJB2 Exon 2/ 416 bp
3.7. Mutation analysis Sanger sequencing analyses was conducted by Genomics Inc, Taiwan. In brief, genomic DNA was purified from MMCi001-A cells by PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific). Genomic DNA of the resulting iPSCs was used as a template to amplify the exon 2 of GJB2 gene using primers listed in Table 2. 4. STR analysis For STR-PCR, total cellular DNA were extracted from MMCi001-A and the original PBMCs by PureLink™ genomic DNA mini kit. Fifteen loci, including FGA, vWA, TPOX, D8S1179, D7S820, D3S1358, D21S11, TH01, D13S317, D16S539, D2S1338, CSF1PO, D19S433, D18S51 and D5S818 were analysed by AmpFLSTR™ Identifier™ PCR Amplification Kit. All reagents were purchased from Thermo Fisher Scientific.
PSC 4-Marker Immunocytochemistry Kit (Life Technologies, Invitrogen). For the procedure of immunofluorescence staining, cells were fixed with 4% (w/v) formaldehyde at room temperature for 10 minutes and washed by phosphate-buffered saline (PBS) three times. In addition, the step for permeabilisation (1% (v/v) Saponin in PBS) was included for the staining with antibodies for the markers in the cytosol or nucleus. 3% (w/v) bovine serum albumin (Sigma) was used to block non-specific staining. Subsequently, the cells were incubated with primary antibodies at 4°C for 16 hours, and then incubated with Alexa 594- (red) or Alexa 488 (green)-conjugated secondary antibodies for 1 h at room temperature. Nuclei were stained by NucBlue® Fixed Cell Stain (Thermo Fisher Scientific).
5. Mycoplasma detection Detection of mycoplasma contamination was performed by using Mycoplasma PCR Detection Kit (ABM Inc.). Briefly, the resulting MMCi001-A cells were cultured for more than 72 h, and then the culture medium was collected for analysis of mycoplasma contamination (Table 1). Acknowledgments We thank the discussion and technical support from Taiwan Human Disease iPSC Service Consortium. The Consortium is funded by the Ministry of Science and Technology (MOST) (MOST 106-2319-B-001003, 108-2218-E-080 -001). We thank the grants from the Ministry of 4
Stem Cell Research 42 (2020) 101692
H.-E. Lu, et al.
Science and Technology (MOST) of Taiwan Government (MOST 1072314-B-715 -004 -MY3), intramural research grants from Mackay Medical College(1052B07, 1051B23, 1061B09, 1071B12, 1081E03).
et al., 2017. Whole-exome sequencing to identify the cause of congenital sensorineural hearing loss in carriers of a heterozygous GJB2 mutation. Eur. Arch. Otorhinolaryngol. 274 3619-325. Wu, C.C., Chen, P.J., Chiu, Y.H., Lu, Y.C., Wu, M.C., Hsu, C.J., 2008. Prospective mutation screening of three common deafness genes in a large Taiwanese Cohort with idiopathic bilateral sensorineural hearing impairment reveals a difference in the results between families from hospitals and those from rehabilitation facilities. Audiol. Neurootol. 13, 172–181. Zheng J, J., Ying, Z., Cai, Z., Sun, D., He, Z., Gao, Y., et al., 2015. GJB2 mutation spectrum and genotype-phenotype correlation in 1067 Han Chinese Subjects with non-syndromic hearing loss. PLoS ONE 10, e0128691.
Supplementary materials Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2019.101692. References Parzefall T, T., Frohne, A., Koenighofer, M., Kirchnawy, A., Streubel, B., Schoefer, C.,
5