- Email: [email protected]
Generation of LIF-independent induced pluripotent stem cells from canine fetal fibroblasts
Theriogenology 92 (2017) 75e82
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Generation of LIF-independent induced pluripotent stem cells from canine fetal fibroblasts N.J.N. Gonçalves a, F.F. Bressan a, b, K.C.S. Roballo a, F.V. Meirelles a, b, P.L.P. Xavier a, H. Fukumasu a, C. Williams c, M. Breen c, S. Koh e, R. Sper c, J. Piedrahita c, d, sio a, b, * C.E. Ambro ~o Paulo, Brazil Department of Veterinary Medicine, Faculty of Animal Science and Food Engineering, FZEA/USP, Sa ~o Paulo, Brazil Department of Veterinary Surgery, Sector Anatomy, Faculty of Veterinary Medicine and Animal Science, FMVZ/USP, Sa Department of Molecular Biomedical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA d Center for Comparative Medicine and Translational Research, North Carolina State University, Raleigh, NC, USA e Department of Cell Biology, Duke University, Durham, NC, USA a
b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 May 2016 Received in revised form 18 November 2016 Accepted 6 January 2017 Available online 8 January 2017
Takahashi and Yamanaka established the first technique in which transcription factors related to pluripotency are incorporated into the genome of somatic cells to enable reprogramming of these cells. The expression of these transcription factors enables a differentiated somatic cell to reverse its phenotype to an embryonic state, generating induced pluripotent stem cells (iPSCs). iPSCs from canine fetal fibroblasts were produced through lentiviral polycistronic human and mouse vectors (hOSKM/mOSKM), aiming to obtain pluripotent stem cells with similar features to embryonic stem cells (ESC) in this animal model. The cell lines obtained in this study were independent of LIF or any other supplemental inhibitors, resistant to enzymatic procedure (TrypLE Express Enzyme), and dependent on bFGF. Clonal lines were obtained from slightly different protocols with maximum reprogramming efficiency of 0.001%. All colonies were positive for alkaline phosphatase, embryoid body formation, and spontaneous differentiation and expressed high levels of endogenous OCT4 and SOX2. Canine iPSCs developed tumors at 120 days post-injection in vivo. Preliminary chromosomal evaluations were performed by FISH hybridization, revealing no chromosomal abnormality. To the best of our knowledge, this report is the first to describe the ability to reprogram canine somatic cells via lentiviral vectors without supplementation and with resistance to enzymatic action, thereby demonstrating the pluripotency of these cell lines. © 2017 Elsevier Inc. All rights reserved.
Keywords: iPSC Canine Stem cells Pluripotency Cellular reprogramming
1. Introduction The isolation and derivation of embryonic canine stem cells lines (cESCs) can be performed only with leukemia inhibitory factor (LIF) and fibroblast growth factor 2 (FGF2), but full characterization and in vitro maintenance of ESCs have not been fully described [1]. The production of induced pluripotent stem cells (iPSCs) [2e4] created a new way for obtaining pluripotent cells and studying their applicability in clinical trials and therapies. In veterinary medicine, there have been few previous reports describing and characterizing canine somatic cell-derived iPSCs [5e9,22].
* Corresponding author. Department of Veterinary Medicine, Faculty of Animal ~o Paulo, Brazil. Science and Food Engineering, FZEA/USP, Sa sio). E-mail address: [email protected] (C.E. Ambro http://dx.doi.org/10.1016/j.theriogenology.2017.01.013 0093-691X/© 2017 Elsevier Inc. All rights reserved.
However, only two reports have evaluated tumor formation of these cells [8,22]. Animal models represent a valuable tool in the field of translational research and may assist in the development of new therapeutic strategies for human regenerative medicine. In addition, animal models may provide support and acceptance in the field of stem cell research and therapy [10]. The canine model (Canis lupus familiaris) shares at least half of the more than 400 hereditary canine diseases with humans [11], thus representing an acceptable translational research model. For example, the IGF1Roverexpressing mammary carcinoma canine model [12] has been demonstrated as a new model to study new therapies targeting breast cancer in humans. In addition, the canine model also represents a unique naturally occurring model of genetic diseases such as myelopathy (CDM) for amyotropic lateral sclerosis (ALS) in
76
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
humans [13]. However, derivation of cESCs for therapeutic approaches is still difficult, and the isolated cESCs are not fully characterized to ensure their safety. Hence, the development of canine iPSCs holds a great potential as an alternative option for the development of effective therapeutic treatments and pre-clinical trials. In this context, this study tested two alternative reprogramming factors isolated from mouse and human to optimize an appropriate reprogramming method to produce canine iPSCs. These experiments aimed at increasing knowledge of the factors required in the reprogramming process of canine cells and the production of stable canine iPSCs with complete characterization. 2. Materials and methods 2.1. Cell culture Canine fetal fibroblasts (CFFs) were derived from one 15-day-old gestational embryo. The somites were dissected, washed in saline solution (phosphate buffer saline, PBS), fragmented and disaggregated by pipetting, and the resulting cells were cultured in IMDM medium (Gibco, Life Science) supplemented with 10% fetal bovine serum (Gibco, Life Science) and 0.1% penicillin/streptomycin (Gibco, Life Science). The same medium was used to maintain 293 FT packaging cells (Life Technologies) and mouse embryonic fibroblasts (MEFs). Culture medium was changed every 48 h. All canine iPSCs were generated from CFFs between passage 2 or 3 and maintained in iPSC media, consisting of DMEM/F12 Knockout (Gibco), 20% Knockout Serum Replacement (Invitrogen), 2 mM Lglutamine (Gibco), 0.1 mM nonessential amino acids (Sigma Aldrich), 0.1 mM b-mercaptoethanol (Gibco) and bFGF (10 ng/mL; BD Bioscience). All experiments performed were approved by the Ethics Committee of Animal Use (Protocol No. 2377/2011). 2.2. Feeder cells MEFs were isolated from 13- to 14-day-old Swiss mouse fetuses, and cells at passages 1e3 were used as a feeder monolayer at a concentration of 1 105 cells in 6 well dishes. MEFs were treated with mitomycin before being used as monolayers. 2.3. Lentiviral production and transduction of canine fibroblasts STEMCCA polycistronic lentiviral vectors [14] expressing human OCT4, SOX2, KLF4, and c-MYC (hOSKM) or murine (mOSKM) were used to transfect 293 FT cells. The STEMCCA vector is comprised of human or mouse OCT4, KLF4, SOX2, and c-MYC (OKSM) transcription factors separated by the self-cleaving 2A peptide and IRES sequences driven by the EF-1alpha constitutive promoter (Millipore SCR 544 [14]). The following day after plating 5 106 293FT cells in 100 mm plates, the cells were transfected with 12 mg of
STEMCCA vector, 1.2 mg of auxiliary vector and 2.4 mg of packaging VSVG vector using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's protocol. The mixture of DNA/Lipofectamine was incubated overnight, and the supernatant (culture medium) containing viral particles was recovered after 24 and 48 h. The supernatant was filtered and used the following day. hOSKM or mOSKM was used separately or in combination to reprogram CFFs. CFFs were plated at 1.5 104 per well in a 6-well plate and transduced with 1 mL of lentiviral supernatant. The following day, the medium containing lentiviral particles was removed from the canine fibroblasts, and a second volume of supernatant from the transfected 293FT cells was added (two transductions). After 24 h, the medium was removed and replaced with fresh 293FT medium. After 5 days, transduced fibroblasts were passaged onto MEFs and cultured in iPS medium for a minimum of 14 days. IPSC colonies were observed as early as 11 days on MEFs, and clonal lines were manually isolated using a scalpel and transferred to a new feeder plate with MEFs. The following passages were successfully generated by the enzyme dissociation process (Tryple Express Enzyme, Thermo Fisher Scientific). The iPSCs were incubated with 250 mL/ mL TrypLE for 1 min and then dissociated by pipetting, and the colonies were then transferred to new feeder plates. 2.4. Alkaline phosphatase detection and immunocytochemistry Alkaline phosphatase staining was performed using the Alkaline Phosphatase (AP) Leukocyte Kit (Sigma -Aldrich) according to the manufacturer's instructions. For immunocytochemistry, the cells were fixed in 4% paraformaldehyde (PFA) for 20 min, washed with phosphate-buffered saline (PBS) and incubated overnight with PBS supplemented with 3% bovine serum albumin (BSA) and 0.5% Triton X-100. Cells were washed and incubated in PBS with 3% BSA and 0.2% Tween-20 for 1 h at room temperature. The cells were then incubated overnight at 4 C with the following primary antibodies: rabbit antiOCT3/4 (IgG) diluted at 1:50 (Sigma-Aldrich C279); rabbit antiSOX2 (IgG) diluted at 1:100 (Abcam ab97959); and rabbit antiNANOG (IgG) diluted at 1:100 (Abcam ab80892). The cells were then washed three times with PBS and incubated with secondary antibodies diluted at 1:100 (goat anti-rabbit IgG Alexa Fluor 488, A11008, Life Technologies). The nuclei were stained by Hoechst 33342 (1 mg/mL) for 15 min. 2.5. Embryoid body formation and in vitro differentiation Canine IPS colonies were plated in agarose-coated tissue culture plates and maintained without bFGF. After 72 h, embryoid bodies were transferred to 0.1% gelatin-coated tissue culture plates. Differentiating EBs were maintained in IMDM media supplemented with 10% fetal bovine serum for approximately 5 days until morphological changes to fibroblast-like cells were observed.
Table 1 Primer sequences used for pluripotency analysis, exogenous factor expression and tumor origin as designed by Primer3 [30]. Gene
Sequence (50 - 30 )
Product size
Evaluation
OCT4_FWD OCT4_REV SOX2_FWD SOX2_REV 18S_FWD 18S_REV hOSKM_FWD hOSKM_REV mOSKM_FWD mOSKM_REV
CAGGCCCGAAAGAGAAAGC CGGGCACTGCAGGAACA TGCGAGCGCTGCACAT TCATGAGCGTCTTGGTTTTCC CCTGCGGCTTAATTTGACTC CTGTCAATCCTGTCCGTGTC AAGAGGACTTGTTGCGGAAA GGCATTAAAGCAGCGTATCC ACGAGCACAAGCTCACCTCT GGCATTAAAGCAGCGTATCC
78bp
Pluripotency Pluripotency Pluripotency Pluripotency Housekeeping Housekeeping Exogenous factors/origin of tumor HOSKM Exogenous factors/origin of tumor MOSKM
72bp 65bp 182bp 203bp
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
2.6. Polymerase chain reaction (PCR) and real-time reverse transcription polymerase chain reaction (qRT-PCR) analysis Total RNA and DNA were isolated using Trizol Reagent (Invitrogen) and quantified by an UV spectrophotometer at 260 nm. The High Capacity Reverse Transcription kit (Applied Biosystems, CA, USA) was used for cDNA synthesis. To verify the expression of
77
endogenous OCT4 and SOX2 for pluripotency evaluation and to test if the exogenous factors from hSTEMCCA and mSTEMCCA were silenced, primer sets were designed. For exogenous gene expression, primers were designed for c-Myc (forward primer) and WPRE (reverse primer). Transfected cells five days post-transfection were used as the positive control, and the same fibroblasts without transfection were used as the negative control. Relative expression
Fig. 1. Colony morphology after enzymatic passages. A and B: Colony 4 after four enzymatic passages (10 and 40, respectively). C) Colony 4 from passage 5 expresses alkaline phosphatase (40). D) Colony 5 from passage 4 expresses alkaline phosphatase (10). E and F) Embryoid body formation in agarose after 48 h in culture. G and H) In vitro differentiation after 5 days in gelatin substrate. Morphological changes into fibroblast-like cells were found for colony 4 from passage 16 (40).
78
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
of candidate genes was quantified by SYBR®Green PCR Master Mix (Life Technologies). Conditions for real time RT-PCR were as follows: 95 C for 15 min; 40 cycles of 95 C for 15 s, 60 C for 5 s, and 72 C for 30 s; and 72 C for 2 min; and melting curve analysis at 90 cycles starting at 50 C with 0.5 C increments. The relative expression was calculated by normalization to 18S housekeeping expression using the 2-ddCt method [15]. The presence of exogenous factors in the tumor mass (for evidence of canine origin) was examined by reverse transcriptionepolymerase chain reaction (RT-PCR) using Taq 2 master mix (New England Biolabs). The conditions for PCR were as follows: 95 C for 30 s, 60 C for 60 s, and 68 C for 60 s; and final extension of 68 C for 5 min. The primer sets and product size for real time PCR are listed in Table 1.
2.7. Teratoma assay Canine iPSCs (1.5 106 cells in PBS containing 30% Matrigel; BD Biosciences) were subcutaneously injected into male mice (Balb/c NUDE). Three animals were injected once with iPSCs, and tumors formed in only one animal. The tumors were harvested at 120 days post-injection. The mice were observed every 2e3 days during 120 days until tumors were found. The tumors derived from iPSCs were dissected and fixed in 4% PFA. Fixed tissues were paraffin embedded and stained with hematoxylin and eosin (H&E). Slides were further analyzed and reviewed by a veterinary pathologist.
2.8. Metaphase spread preparation and FISH Canine iPS cells were treated with the microtubule destabilize, Colcemid (10 mL/mL), for 1 h and washed with PBS. The cells were trypsinized and incubated with a hypotonic solution (potassium chloride, 75 mM) for 10 min and resuspended with a fixative solution (3:1 methanol:acetic acid, vol:vol) [16] followed by centrifugation and precipitation [12]. Chromosome spreads were prepared by dropping 10 ml of cells in suspension onto previously cooled slides. FISH analysis was performed using cytogenetically validated specific labeled dog chromosome paint probes and genome-anchored pools of dog bacterial artificial chromosome clones [17]. The chromosomes were counted by DAPI staining and captured with fluorescent microscopy (Axioplan II, Zeiss) with an appropriate filter (Chroma), cooled CCD camera (KAF 1401E, Sensys), and SmartCapture software (Digital Scientific).
3. Results 3.1. Generation of canine iPSCs Murine or human OSKM lentivirus was used separately or in combination to produce canine iPS colonies. Ten clonal lines were stably maintained for more than 15 passages and were characterized. The cells in the reprogramming process presented first colonies at 11 days after transduction (Fig. 1A and B). These colonies were manually replated at the first passage and enzymatically dissociated for following passages. The isolated iPSCs were fed with iPSC medium supplemented only with bFGF. The isolated iPSC lines showed strong alkaline phosphatase activity (Fig. 1C and D), capacity to form embryoid bodies (Fig. 1E and F) and spontaneous differentiation (Fig. 1G and H). 3.2. LIF independent and resistant to enzymatic procedure Several authors have shown that iPSC colonies require both LIF and bFGF to maintain their pluripotency. However, our results showed that the isolated lines only required bFGF as shown by stable maintenance without LIF supplementation. In addition, the enzymatic dissociation of the cells was successfully performed without demonstrating cytotoxicity for at least 20 passages. 3.3. Expression of pluripotency genes and vectors analyzed by qPCR and immunocytochemistry We confirmed pluripotency marker gene expression by realtime PCR. The examined colonies demonstrated strong expression of endogenous OCT4 and SOX2. The relative expression level was calculated by normalizing to the gene expression level of parental fetal fibroblasts used for reprogramming (Fig. 2). Interestingly, the iPSCs reprogrammed by human factors (hOSKM) demonstrated complete silencing of exogenous factors. However, the murine factor (mOSKM)-derived iPSCs showed exogenous gene expression similar to the levels in the control (Fig. 3). Immunocytochemistry showed strong expression of SOX2 and OCT4 but a lower expression of NANOG compared to the negative control (no primary antibody) (Fig. 4). 3.4. Teratoma assay To further test the pluripotency of these cells in vivo, the canine iPSCs were harvested, washed, resuspended in PBS containing 30% Matrigel (BD Bioscience) and injected into Balb c/Nude mice. The
Fig. 2. Expression of SOX2 and OCT4 in canine IPS colonies (line 4, 15 passages; lines 5 and 6, 10 passages) compared to fetal fibroblasts. Relative expression was normalized to 18S expression and calculated using the 2 -ddCT method.
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
79
Fig. 3. Expression of exogenous factors (hOSKM and mOSKM) in canine iPSCs (line 4, 15 passages; lines 5 and 6, 10 passages) compared to established lines 5 days after fetal fibroblasts (HD5 and MD5) were transduced with human and murine vectors. Relative expression was normalized to 18S expression and calculated using the 2 -ddCT method.
iPSC lines reprogrammed by both human and mouse OSKM (h þ mOSKM) or the cell lines produced by only hOSKM were used for the injection. The animal injected with the h þ mOSKM line formed a tumor 120 days post-injection (Fig. 5). The tumor mass was composed of heterogeneous cell types but predominantly cells with a mesodermal lineage (Fig. 6), and it was formed by canine iPSCs cells. As shown by PCR, exogenous factors were present in the tumor mass (Fig. 7).
3.5. Metaphase spread and FISH High-resolution metaphase chromosome was prepared from cultured ciPSCs at passage 15 using standard techniques. Karyotype analysis of metaphase chromosomes demonstrated visually normal chromosomes, and no gross structural rearrangements were identified (Fig. 8).
Fig. 4. Detection of OCT4, NANOG and SOX2 protein in the positive clonal line (colony 4, passage 10) compared to the negative control as visualized using light and fluorescent microscopy. Merged images (overlapping) of positive fluorescence and nuclear staining with DAPI.
80
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
Fig. 5. Subcutaneous injection of clonal lineage (4h þ m) iPSCs into Balb/c nude mice. (A), Teratogenic mass formation after 120 days and retained for 1 week (B), 2 weeks (C), 3 weeks (D) and prior to euthanasia for histopathological evaluation.
4. Discussion We report, for the first time, the generation of canine iPSCs by both human and mouse OSKM factors with lentiviral transduction from fetal canine fibroblasts. These cells do not require LIF for maintenance and can be passaged using enzymatic methods for at least 15 passages without morphological or karyotypical changes. Therefore, this study provides a novel protocol to establish canine iPSC lines. Previously, five studies have described the isolation of canine embryonic stem cell (ESC)-like cells [1,18e21] and demonstrated the difficulty of characterization of these cells. In these studies, canine embryos at different stages were collected (morula and blastocyst) and cultured with LIF on MEFs, but only a few lines were established from the blastocyst [18]. Schneider et al. [19] reported CTE-like isolation in medium supplemented with LIF. Using a similar protocol, Hayes et al. [20] maintained CTE-like cells for 34 passages. In 2009 [21], the first study to report the cultivation of
CTE-like cells dependent on LIF and bFGF and positive for in vitro characterization was published, but these cells still compromised development when injected into immunosuppressed mice. Using a bFGF plus LIF combination, however, Vaags et al. [1] generated colonies that maintained a large number of passages and were capable of forming teratomas. In addition, other studies have described the generation of pluripotent cells through gene induction [5e9,22e25]. LIF-dependent canine iPSCs have been generated previously [7], but they spontaneously differentiated into fibroblast-like cells in the absence of both LIF and bFGF or only bFGF. These authors generated slightly domed ciPSC colonies using six transgenes (OCT4, SOX2, KLF4, c-MYC, LIN28 and NANOG) with small molecule inhibitors. In comparison to previous reports, we generated ciPSC colonies with polycistronic human and mouse vectors without LIF on MEF feeder layers with no inhibitors [3,9]. MEFs secrete factors, such as LIF, bFGF, and SCF, which enhance canine embryonic development [18]. Analysis of the secreted
Fig. 6. Photomicrograph showing tumor mass (A and C) with diffuse muscle tissue (TM). (B) Intense vascularization (vessels) and cells with adipose tissue characteristics (AT) and multinucleated cells (MC). (C) Tumor with cells from 2 germ layers (20).
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
Fig. 7. Polymerase chain reaction (PCR) analysis of tumor mass. Evaluation of the presence of the mOSKM exogenous factor in the mass (mOSKM tumor). Positive control (mOSKM IPSCs from canine fetal fibroblasts), negative control from cells (canine and mouse fibroblasts) and blank for contamination control.
factors from feeder cells will help to identify small molecules that generate naıve ciPSCs [9]. Unlike mouse or human ESCs, which require LIF or bFGF, respectively, for survival, the removal of LIF or bFGF leads to loss of pluripotent markers and suppression of proliferation or apoptosis [6]. In our study, the colonies remained unchanged with bFGF dependency, and the colonies did not show differences in the maintenance of pluripotency or in the capacity to expand with or without LIF. Working with canine iPS, Luo and colleagues in 2011 [6] observed total dependency of ciPSCs on both bFGF and LIF. When the cells were cultured without LIF or bFGF, the colony development was decreased, and morphological changes occurred. These authors cultured ciPSCs for 7 days without LIF and bFGF, and they measured NANOG expression levels. The results indicated that removing either LIF or bFGF is sufficient to lose pluripotency as indicated by decreased expression of NANOG. In 2013, Koh et al. [8] used a retroviral system to generate ciPSCs that are dependent on both LIF and bFGF in the presence of two small molecule inhibitors (PD 0325901/CHIR 99021). The results suggested that GSK-3-derived apoptotic signaling pathways were inhibited by CHIR 99021 and that the absence of LIF induced differentiation as demonstrated by the loss of AP activity. For the first time, this group demonstrated chromosomal instability of ciPSCs
81
by a combined approach of a CGH and FISH. The results demonstrated that genomic aberrations on specific chromosomes (4, 8, 13 and 16) are acquired after extensive passages. In human ESCs and iPSCs [26e29], it has been previously shown that genomic aberrations are acquired during extensive passages in vitro. However, unlike these previous results described by Koh et al. [8], the ciPSCs in the present study maintained a stable karyotype of 78 chromosomes and XY types at passage 15, which was similar to results described by Nishimura et al. [9] who generated functional platelets from ciPSCs, producing mature magakaryocytes (MKs) for the first time, thus demonstrating successful differentiation of canine iPSCs. The evaluation of exogenous factors showed that the human factors were completely silenced but that the murine exogenous factors remained expressed. Previously Koh et al. [8] produced iPSC lines from canine skin fibroblasts with murine factors (mOSKM) in addition to the lines produced in the present study showed murine exogenous expression, demonstrating that the murine factors are important to maintain the established lines. Otherwise, a new approach has been described, were fibroblast are exposed to DNA methyltransferase inhibitor 5-Aza-cytidine (5-aza-CR), increasing cell plasticity to differentiate in insulin-secreting cells in dogs, Brevini et al. [31], pigs, Brevini et al. [32] and humans, Brevini et al. [33]. This approach can be added to new iPSC protocols in the future, but the action is transient and still unclear. Most of the canine iPSC studies have described incomplete tumor formation. Withworth et al. [7] described germ cell-like tumor formation from passage 5 cells when transgenes are still being transcribed. In contrast to the results from Shimada et al. [5] and Luo et al. [6], Withworth et al. could not prove the pluripotency of those cells in vivo. Moreover, Lee et al. [22] and Koh et al. [8] reported tumors containing cells from 3 germ layers after subcutaneous transplantation. In our study, we described a significant tumor mass of canine iPSCs origin with several cell types but predominantly with mesodermal origin 120 days post-injection.
5. Conclusions In our study, we generated ten stable and pluripotent canine iPS cell lines independent of hLIF. The colonies exhibited positive results for in vitro and in vivo tests, and they exhibited normal karyotype and chromosomes without abnormalities. Expansion of these cells with an enzymatic protocol was possible, and cells were maintained for at least 15 passages without morphological changes. These cells maintained a high expression of endogenous pluripotent markers after passage 10. This study reports for the first time canine IPS colony maintenance without hLIF supplementation and that is resistant to enzymatic passages.
Fig. 8. Canine IPSC (colony 4, passage 10) chromosomal count data with DAPI staining captured using a fluorescence microscope and evaluated by in situ hybridization (FISH) with centromeric probes. No evidence of morphological changes was found.
82
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
Author disclosure statement The authors indicate no potential conflicts of interest. Acknowledgments
[16]
[17] [18]
The authors would like to thank FAPESP (2011/22915-5), FAPESP/BEPE (2012/09631-0), UGPN/USP (13.1.4148.1.5) and FAPESP (2015/09575-1) for financial support. References mez DA, [1] Vaags AK, Rosic-Kablar S, Gartley CJ, Zheng YZ, Chesney A, Villago et al. Derivation and characterization of canine embryonic stem cell lines with in vitro and in vivo differentiation potential. Stem Cells 2009;27:329e40. [2] Yamanaka S. Strategies and new developments in the generation of patients pecific pluripotent stem cells. Cell Stem Cell 2007;1:39e49. [3] Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006;126: 663e76. [4] Takahashi K, Tanabe K, Ohnuki M, Ichisaka T, Tomoda K, Yamanaka S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131:861e72. [5] Shimada H, Nakada A, Hashimoto Y, Shigeno K, Shionoya Y, Nakamura T. Generation of canine-induced pluripotent stem cells by retroviral transduction and chemical inhibitors. Mol Reprod Dev 2010;77:2. [6] Luo J, Suhr ST, Chang EA, Wang K, Ross PJ, Nelson LL, et al. Generation of leukemia inhibitory factor and basic fibroblast growth factor-dependent induced pluripotent stem cells from canine adult somatic cells. Stem cells Dev 2011;20:1669e78. [7] Whitworth DJ, Ovchinnikov DA, Wolvetang EJ. Generation and characterization of LIF-dependent canine induced pluripotent stem cells from adult dermal fibroblasts. Stem Cells Dev 2012;21:2288e97. [8] Koh S, Thomas R, Tsai S, Bischoff S, Lim JH, Breen M, et al. Growth requirements and chromosomal instability of induced pluripotent stem cells generated from adult canine fibroblasts. Stem Cells Dev 2013;22:951e63. [9] Nishimura K, Takahashi J. Therapeutic application of stem cell technology toward the treatment of Parkinson's disease. Biol Pharm Bull 2013;36:171e5. [10] Fiester A, Scholer H, Caplan A. Stem cell therapies: time to talk to the animals. Cloning Stem Cells 2014;6:3e4. [11] Starkey MP, Scase TJ, Mellersh CS, Murphy S. Dogs really are man's best frienddcanine genomics has applications in veterinary and human medicine! Brief Funct Genomic Proteom 2005;4:112e28. [12] Nguyen HN, Reijo Pera RA. Metaphase spreads and spectral karyotyping of human embryonic stem cells. CSH Protoc 2008;3(9). http://dx.doi.org/ 10.1101/pdb.prot5047. [13] Nardone R, Holler Y, Taylor AC, Lochner P, Tezzon SG, Golaszewski S, et al. Canine degenerative myelopathy: a model of human amyotrophic lateral sclerosis. Zoology 2016;119:64e73. http://dx.doi.org/10.1016/j.zool.2015.09. 003. [14] Sommer CA, Stadtfeld M, Murphy GJ, Hochedlinger K, Kotton DN, Mostoslavsky G. Induced pluripontent stem cell generation using a single lentiviral stem cell cassette. Stem Cells 2009;27:543e9. [15] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30] [31]
[32]
[33]
time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25: 402e8. Miething F, Hering S, Hanschke B, Dressler J. Effect of fixation to the degradation of nuclear and mitochondrial DNA in different tissues. J Histochem Cytochem 2006;54:371e4. Breen M, Langford CF, Carter NP, Holmes NG, Dickens HF, Thomas R, et al. Fish mapping and identification of canine chromosomes. J Hered 1999;90:27e30. Hatoya S, Torii R, Kondo Y, Okuno T, Kobayashi K, Wijewardana V. Isolation and characterization of embryonic stem-like cells from canine blastocysts. Mol Reprod Dev 2006;73:298e305. Schneider MR, Adler H, Braun J, Kienzle B, Wolf E, Kolb HJ. Canine embryoderived stem cellsdtoward clinically relevant animal models for evaluating efficacy and safety of cell therapies. Stem Cells, 25: 1850e1851. Hayes B, Fagerlie SR, Ramakrishnan A, Bara S, Harkey M, Graf L. Derivation, characterization, and in vitro differentiation of canine embryonic stem cells. Stem Cells 2008;26:465e73. Wilcox JT, Semple E, Gartley C, Brisson BA, Perrault SD, Villagomez DA. Characterization of canine embryonic stem cell lines derived from different niche microenvironments. Stem Cells Dev 2009;18:1167e78. Lee AS, Xu D, Plews JR, Nguyen PK, Nag D, Lyons JK, et al. Preclinical derivation and imaging of autologously transplanted canine induced pluripotent stem cells. J Biol Chem 2011;286:32697e704. sio CE, Piedrahita JA. Stem cells and regenerative Gonçalves NN, Ambro medicine in domestic and companion animals: a multispecies perspective. Reprod Domest Anim 2014;49:2e10. Gonçalves NJN, Bressan FF, Souza AF, Martins DS, Miglino MA, Meirelles FV, et al. Canine fibroblasts expressing human transcription factors: what is in the route for the production of canine induced pluripotent stem cells. Reprod Domest Anim 2012;47(Suppl. 6):84e7. http://dx.doi.org/10.1111/rda.12002. Yu J, Hu K, Smuga-Otto K, Tian S, Stewart R, Slukvin LI, et al. Human induced pluripotent stem cells free of vector and transgene sequences. Science 2009;324:797e801. Baker DE, Harrison NJ, Maltby E, Smith K, Moore HD, Shaw PJ, et al. Adaptation to culture of human embryonic stem cells and oncogenesis in vivo. Nat Biotechnol 2007;25:207e15. Lefort N, Feyeux M, Bas C, Feraud O, Bennaceur-Griscelli A, Tachdjian G, et al. Human embryonic stem cells reveal recurrent genomic instability at 20q11.21. Nat Biotechnol 2008;26:1364e6. Spits C, Mateizel I, Geens M, Mertzanidou A, Staessen C, Vandeskelde Y, et al. Recurrent chromosomal abnormalities in human embryonic stem cells. Nat Biotechnol 2008;26:1361e3. Mayshar Y, Ben-David U, Lavon N, Biancotti JC, Yakir B, Clark AT, et al. WE Lowry and N Benvenisty. Identification and classification of chromosomal aberrations in human induced pluripotent stem cells. Cell Stem Cell 2011;7: 521e31. Koressaar T, Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007;23(10):1289e91. Manzoni EFM, Pennarossa G, de Eguileor M, Tettamanti G, Gandolfi F, Brevini TAL. 5-azacytidine affects TET2 and histone transcription and reshapes morphology of human skin fibroblasts. Sci Rep 2016;6(37017):1e13. Pennarossa G, Maffei S, Campagnol M, Rahman MM, Brevini TAL, Gandolfi F. Reprogramming of pig dermal fibroblast into insulin secreting cells by a brief exposure to 5-aza-cytidine. Stem Cell Rev Rep 2014;10:31e43. Brevini TAL, Pennarossa G, Acocella F, Brizzola S, Zenobi A, Gandolfi F. Epigenetic conversion of adult dog skin fibroblasts into insulin-secreting cells. Vet J 2016;211:52e6.
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Generation of LIF-independent induced pluripotent stem cells from canine fetal fibroblasts N.J.N. Gonçalves a, F.F. Bressan a, b, K.C.S. Roballo a, F.V. Meirelles a, b, P.L.P. Xavier a, H. Fukumasu a, C. Williams c, M. Breen c, S. Koh e, R. Sper c, J. Piedrahita c, d, sio a, b, * C.E. Ambro ~o Paulo, Brazil Department of Veterinary Medicine, Faculty of Animal Science and Food Engineering, FZEA/USP, Sa ~o Paulo, Brazil Department of Veterinary Surgery, Sector Anatomy, Faculty of Veterinary Medicine and Animal Science, FMVZ/USP, Sa Department of Molecular Biomedical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA d Center for Comparative Medicine and Translational Research, North Carolina State University, Raleigh, NC, USA e Department of Cell Biology, Duke University, Durham, NC, USA a
b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 May 2016 Received in revised form 18 November 2016 Accepted 6 January 2017 Available online 8 January 2017
Takahashi and Yamanaka established the first technique in which transcription factors related to pluripotency are incorporated into the genome of somatic cells to enable reprogramming of these cells. The expression of these transcription factors enables a differentiated somatic cell to reverse its phenotype to an embryonic state, generating induced pluripotent stem cells (iPSCs). iPSCs from canine fetal fibroblasts were produced through lentiviral polycistronic human and mouse vectors (hOSKM/mOSKM), aiming to obtain pluripotent stem cells with similar features to embryonic stem cells (ESC) in this animal model. The cell lines obtained in this study were independent of LIF or any other supplemental inhibitors, resistant to enzymatic procedure (TrypLE Express Enzyme), and dependent on bFGF. Clonal lines were obtained from slightly different protocols with maximum reprogramming efficiency of 0.001%. All colonies were positive for alkaline phosphatase, embryoid body formation, and spontaneous differentiation and expressed high levels of endogenous OCT4 and SOX2. Canine iPSCs developed tumors at 120 days post-injection in vivo. Preliminary chromosomal evaluations were performed by FISH hybridization, revealing no chromosomal abnormality. To the best of our knowledge, this report is the first to describe the ability to reprogram canine somatic cells via lentiviral vectors without supplementation and with resistance to enzymatic action, thereby demonstrating the pluripotency of these cell lines. © 2017 Elsevier Inc. All rights reserved.
Keywords: iPSC Canine Stem cells Pluripotency Cellular reprogramming
1. Introduction The isolation and derivation of embryonic canine stem cells lines (cESCs) can be performed only with leukemia inhibitory factor (LIF) and fibroblast growth factor 2 (FGF2), but full characterization and in vitro maintenance of ESCs have not been fully described [1]. The production of induced pluripotent stem cells (iPSCs) [2e4] created a new way for obtaining pluripotent cells and studying their applicability in clinical trials and therapies. In veterinary medicine, there have been few previous reports describing and characterizing canine somatic cell-derived iPSCs [5e9,22].
* Corresponding author. Department of Veterinary Medicine, Faculty of Animal ~o Paulo, Brazil. Science and Food Engineering, FZEA/USP, Sa sio). E-mail address: [email protected] (C.E. Ambro http://dx.doi.org/10.1016/j.theriogenology.2017.01.013 0093-691X/© 2017 Elsevier Inc. All rights reserved.
However, only two reports have evaluated tumor formation of these cells [8,22]. Animal models represent a valuable tool in the field of translational research and may assist in the development of new therapeutic strategies for human regenerative medicine. In addition, animal models may provide support and acceptance in the field of stem cell research and therapy [10]. The canine model (Canis lupus familiaris) shares at least half of the more than 400 hereditary canine diseases with humans [11], thus representing an acceptable translational research model. For example, the IGF1Roverexpressing mammary carcinoma canine model [12] has been demonstrated as a new model to study new therapies targeting breast cancer in humans. In addition, the canine model also represents a unique naturally occurring model of genetic diseases such as myelopathy (CDM) for amyotropic lateral sclerosis (ALS) in
76
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
humans [13]. However, derivation of cESCs for therapeutic approaches is still difficult, and the isolated cESCs are not fully characterized to ensure their safety. Hence, the development of canine iPSCs holds a great potential as an alternative option for the development of effective therapeutic treatments and pre-clinical trials. In this context, this study tested two alternative reprogramming factors isolated from mouse and human to optimize an appropriate reprogramming method to produce canine iPSCs. These experiments aimed at increasing knowledge of the factors required in the reprogramming process of canine cells and the production of stable canine iPSCs with complete characterization. 2. Materials and methods 2.1. Cell culture Canine fetal fibroblasts (CFFs) were derived from one 15-day-old gestational embryo. The somites were dissected, washed in saline solution (phosphate buffer saline, PBS), fragmented and disaggregated by pipetting, and the resulting cells were cultured in IMDM medium (Gibco, Life Science) supplemented with 10% fetal bovine serum (Gibco, Life Science) and 0.1% penicillin/streptomycin (Gibco, Life Science). The same medium was used to maintain 293 FT packaging cells (Life Technologies) and mouse embryonic fibroblasts (MEFs). Culture medium was changed every 48 h. All canine iPSCs were generated from CFFs between passage 2 or 3 and maintained in iPSC media, consisting of DMEM/F12 Knockout (Gibco), 20% Knockout Serum Replacement (Invitrogen), 2 mM Lglutamine (Gibco), 0.1 mM nonessential amino acids (Sigma Aldrich), 0.1 mM b-mercaptoethanol (Gibco) and bFGF (10 ng/mL; BD Bioscience). All experiments performed were approved by the Ethics Committee of Animal Use (Protocol No. 2377/2011). 2.2. Feeder cells MEFs were isolated from 13- to 14-day-old Swiss mouse fetuses, and cells at passages 1e3 were used as a feeder monolayer at a concentration of 1 105 cells in 6 well dishes. MEFs were treated with mitomycin before being used as monolayers. 2.3. Lentiviral production and transduction of canine fibroblasts STEMCCA polycistronic lentiviral vectors [14] expressing human OCT4, SOX2, KLF4, and c-MYC (hOSKM) or murine (mOSKM) were used to transfect 293 FT cells. The STEMCCA vector is comprised of human or mouse OCT4, KLF4, SOX2, and c-MYC (OKSM) transcription factors separated by the self-cleaving 2A peptide and IRES sequences driven by the EF-1alpha constitutive promoter (Millipore SCR 544 [14]). The following day after plating 5 106 293FT cells in 100 mm plates, the cells were transfected with 12 mg of
STEMCCA vector, 1.2 mg of auxiliary vector and 2.4 mg of packaging VSVG vector using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's protocol. The mixture of DNA/Lipofectamine was incubated overnight, and the supernatant (culture medium) containing viral particles was recovered after 24 and 48 h. The supernatant was filtered and used the following day. hOSKM or mOSKM was used separately or in combination to reprogram CFFs. CFFs were plated at 1.5 104 per well in a 6-well plate and transduced with 1 mL of lentiviral supernatant. The following day, the medium containing lentiviral particles was removed from the canine fibroblasts, and a second volume of supernatant from the transfected 293FT cells was added (two transductions). After 24 h, the medium was removed and replaced with fresh 293FT medium. After 5 days, transduced fibroblasts were passaged onto MEFs and cultured in iPS medium for a minimum of 14 days. IPSC colonies were observed as early as 11 days on MEFs, and clonal lines were manually isolated using a scalpel and transferred to a new feeder plate with MEFs. The following passages were successfully generated by the enzyme dissociation process (Tryple Express Enzyme, Thermo Fisher Scientific). The iPSCs were incubated with 250 mL/ mL TrypLE for 1 min and then dissociated by pipetting, and the colonies were then transferred to new feeder plates. 2.4. Alkaline phosphatase detection and immunocytochemistry Alkaline phosphatase staining was performed using the Alkaline Phosphatase (AP) Leukocyte Kit (Sigma -Aldrich) according to the manufacturer's instructions. For immunocytochemistry, the cells were fixed in 4% paraformaldehyde (PFA) for 20 min, washed with phosphate-buffered saline (PBS) and incubated overnight with PBS supplemented with 3% bovine serum albumin (BSA) and 0.5% Triton X-100. Cells were washed and incubated in PBS with 3% BSA and 0.2% Tween-20 for 1 h at room temperature. The cells were then incubated overnight at 4 C with the following primary antibodies: rabbit antiOCT3/4 (IgG) diluted at 1:50 (Sigma-Aldrich C279); rabbit antiSOX2 (IgG) diluted at 1:100 (Abcam ab97959); and rabbit antiNANOG (IgG) diluted at 1:100 (Abcam ab80892). The cells were then washed three times with PBS and incubated with secondary antibodies diluted at 1:100 (goat anti-rabbit IgG Alexa Fluor 488, A11008, Life Technologies). The nuclei were stained by Hoechst 33342 (1 mg/mL) for 15 min. 2.5. Embryoid body formation and in vitro differentiation Canine IPS colonies were plated in agarose-coated tissue culture plates and maintained without bFGF. After 72 h, embryoid bodies were transferred to 0.1% gelatin-coated tissue culture plates. Differentiating EBs were maintained in IMDM media supplemented with 10% fetal bovine serum for approximately 5 days until morphological changes to fibroblast-like cells were observed.
Table 1 Primer sequences used for pluripotency analysis, exogenous factor expression and tumor origin as designed by Primer3 [30]. Gene
Sequence (50 - 30 )
Product size
Evaluation
OCT4_FWD OCT4_REV SOX2_FWD SOX2_REV 18S_FWD 18S_REV hOSKM_FWD hOSKM_REV mOSKM_FWD mOSKM_REV
CAGGCCCGAAAGAGAAAGC CGGGCACTGCAGGAACA TGCGAGCGCTGCACAT TCATGAGCGTCTTGGTTTTCC CCTGCGGCTTAATTTGACTC CTGTCAATCCTGTCCGTGTC AAGAGGACTTGTTGCGGAAA GGCATTAAAGCAGCGTATCC ACGAGCACAAGCTCACCTCT GGCATTAAAGCAGCGTATCC
78bp
Pluripotency Pluripotency Pluripotency Pluripotency Housekeeping Housekeeping Exogenous factors/origin of tumor HOSKM Exogenous factors/origin of tumor MOSKM
72bp 65bp 182bp 203bp
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
2.6. Polymerase chain reaction (PCR) and real-time reverse transcription polymerase chain reaction (qRT-PCR) analysis Total RNA and DNA were isolated using Trizol Reagent (Invitrogen) and quantified by an UV spectrophotometer at 260 nm. The High Capacity Reverse Transcription kit (Applied Biosystems, CA, USA) was used for cDNA synthesis. To verify the expression of
77
endogenous OCT4 and SOX2 for pluripotency evaluation and to test if the exogenous factors from hSTEMCCA and mSTEMCCA were silenced, primer sets were designed. For exogenous gene expression, primers were designed for c-Myc (forward primer) and WPRE (reverse primer). Transfected cells five days post-transfection were used as the positive control, and the same fibroblasts without transfection were used as the negative control. Relative expression
Fig. 1. Colony morphology after enzymatic passages. A and B: Colony 4 after four enzymatic passages (10 and 40, respectively). C) Colony 4 from passage 5 expresses alkaline phosphatase (40). D) Colony 5 from passage 4 expresses alkaline phosphatase (10). E and F) Embryoid body formation in agarose after 48 h in culture. G and H) In vitro differentiation after 5 days in gelatin substrate. Morphological changes into fibroblast-like cells were found for colony 4 from passage 16 (40).
78
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
of candidate genes was quantified by SYBR®Green PCR Master Mix (Life Technologies). Conditions for real time RT-PCR were as follows: 95 C for 15 min; 40 cycles of 95 C for 15 s, 60 C for 5 s, and 72 C for 30 s; and 72 C for 2 min; and melting curve analysis at 90 cycles starting at 50 C with 0.5 C increments. The relative expression was calculated by normalization to 18S housekeeping expression using the 2-ddCt method [15]. The presence of exogenous factors in the tumor mass (for evidence of canine origin) was examined by reverse transcriptionepolymerase chain reaction (RT-PCR) using Taq 2 master mix (New England Biolabs). The conditions for PCR were as follows: 95 C for 30 s, 60 C for 60 s, and 68 C for 60 s; and final extension of 68 C for 5 min. The primer sets and product size for real time PCR are listed in Table 1.
2.7. Teratoma assay Canine iPSCs (1.5 106 cells in PBS containing 30% Matrigel; BD Biosciences) were subcutaneously injected into male mice (Balb/c NUDE). Three animals were injected once with iPSCs, and tumors formed in only one animal. The tumors were harvested at 120 days post-injection. The mice were observed every 2e3 days during 120 days until tumors were found. The tumors derived from iPSCs were dissected and fixed in 4% PFA. Fixed tissues were paraffin embedded and stained with hematoxylin and eosin (H&E). Slides were further analyzed and reviewed by a veterinary pathologist.
2.8. Metaphase spread preparation and FISH Canine iPS cells were treated with the microtubule destabilize, Colcemid (10 mL/mL), for 1 h and washed with PBS. The cells were trypsinized and incubated with a hypotonic solution (potassium chloride, 75 mM) for 10 min and resuspended with a fixative solution (3:1 methanol:acetic acid, vol:vol) [16] followed by centrifugation and precipitation [12]. Chromosome spreads were prepared by dropping 10 ml of cells in suspension onto previously cooled slides. FISH analysis was performed using cytogenetically validated specific labeled dog chromosome paint probes and genome-anchored pools of dog bacterial artificial chromosome clones [17]. The chromosomes were counted by DAPI staining and captured with fluorescent microscopy (Axioplan II, Zeiss) with an appropriate filter (Chroma), cooled CCD camera (KAF 1401E, Sensys), and SmartCapture software (Digital Scientific).
3. Results 3.1. Generation of canine iPSCs Murine or human OSKM lentivirus was used separately or in combination to produce canine iPS colonies. Ten clonal lines were stably maintained for more than 15 passages and were characterized. The cells in the reprogramming process presented first colonies at 11 days after transduction (Fig. 1A and B). These colonies were manually replated at the first passage and enzymatically dissociated for following passages. The isolated iPSCs were fed with iPSC medium supplemented only with bFGF. The isolated iPSC lines showed strong alkaline phosphatase activity (Fig. 1C and D), capacity to form embryoid bodies (Fig. 1E and F) and spontaneous differentiation (Fig. 1G and H). 3.2. LIF independent and resistant to enzymatic procedure Several authors have shown that iPSC colonies require both LIF and bFGF to maintain their pluripotency. However, our results showed that the isolated lines only required bFGF as shown by stable maintenance without LIF supplementation. In addition, the enzymatic dissociation of the cells was successfully performed without demonstrating cytotoxicity for at least 20 passages. 3.3. Expression of pluripotency genes and vectors analyzed by qPCR and immunocytochemistry We confirmed pluripotency marker gene expression by realtime PCR. The examined colonies demonstrated strong expression of endogenous OCT4 and SOX2. The relative expression level was calculated by normalizing to the gene expression level of parental fetal fibroblasts used for reprogramming (Fig. 2). Interestingly, the iPSCs reprogrammed by human factors (hOSKM) demonstrated complete silencing of exogenous factors. However, the murine factor (mOSKM)-derived iPSCs showed exogenous gene expression similar to the levels in the control (Fig. 3). Immunocytochemistry showed strong expression of SOX2 and OCT4 but a lower expression of NANOG compared to the negative control (no primary antibody) (Fig. 4). 3.4. Teratoma assay To further test the pluripotency of these cells in vivo, the canine iPSCs were harvested, washed, resuspended in PBS containing 30% Matrigel (BD Bioscience) and injected into Balb c/Nude mice. The
Fig. 2. Expression of SOX2 and OCT4 in canine IPS colonies (line 4, 15 passages; lines 5 and 6, 10 passages) compared to fetal fibroblasts. Relative expression was normalized to 18S expression and calculated using the 2 -ddCT method.
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
79
Fig. 3. Expression of exogenous factors (hOSKM and mOSKM) in canine iPSCs (line 4, 15 passages; lines 5 and 6, 10 passages) compared to established lines 5 days after fetal fibroblasts (HD5 and MD5) were transduced with human and murine vectors. Relative expression was normalized to 18S expression and calculated using the 2 -ddCT method.
iPSC lines reprogrammed by both human and mouse OSKM (h þ mOSKM) or the cell lines produced by only hOSKM were used for the injection. The animal injected with the h þ mOSKM line formed a tumor 120 days post-injection (Fig. 5). The tumor mass was composed of heterogeneous cell types but predominantly cells with a mesodermal lineage (Fig. 6), and it was formed by canine iPSCs cells. As shown by PCR, exogenous factors were present in the tumor mass (Fig. 7).
3.5. Metaphase spread and FISH High-resolution metaphase chromosome was prepared from cultured ciPSCs at passage 15 using standard techniques. Karyotype analysis of metaphase chromosomes demonstrated visually normal chromosomes, and no gross structural rearrangements were identified (Fig. 8).
Fig. 4. Detection of OCT4, NANOG and SOX2 protein in the positive clonal line (colony 4, passage 10) compared to the negative control as visualized using light and fluorescent microscopy. Merged images (overlapping) of positive fluorescence and nuclear staining with DAPI.
80
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
Fig. 5. Subcutaneous injection of clonal lineage (4h þ m) iPSCs into Balb/c nude mice. (A), Teratogenic mass formation after 120 days and retained for 1 week (B), 2 weeks (C), 3 weeks (D) and prior to euthanasia for histopathological evaluation.
4. Discussion We report, for the first time, the generation of canine iPSCs by both human and mouse OSKM factors with lentiviral transduction from fetal canine fibroblasts. These cells do not require LIF for maintenance and can be passaged using enzymatic methods for at least 15 passages without morphological or karyotypical changes. Therefore, this study provides a novel protocol to establish canine iPSC lines. Previously, five studies have described the isolation of canine embryonic stem cell (ESC)-like cells [1,18e21] and demonstrated the difficulty of characterization of these cells. In these studies, canine embryos at different stages were collected (morula and blastocyst) and cultured with LIF on MEFs, but only a few lines were established from the blastocyst [18]. Schneider et al. [19] reported CTE-like isolation in medium supplemented with LIF. Using a similar protocol, Hayes et al. [20] maintained CTE-like cells for 34 passages. In 2009 [21], the first study to report the cultivation of
CTE-like cells dependent on LIF and bFGF and positive for in vitro characterization was published, but these cells still compromised development when injected into immunosuppressed mice. Using a bFGF plus LIF combination, however, Vaags et al. [1] generated colonies that maintained a large number of passages and were capable of forming teratomas. In addition, other studies have described the generation of pluripotent cells through gene induction [5e9,22e25]. LIF-dependent canine iPSCs have been generated previously [7], but they spontaneously differentiated into fibroblast-like cells in the absence of both LIF and bFGF or only bFGF. These authors generated slightly domed ciPSC colonies using six transgenes (OCT4, SOX2, KLF4, c-MYC, LIN28 and NANOG) with small molecule inhibitors. In comparison to previous reports, we generated ciPSC colonies with polycistronic human and mouse vectors without LIF on MEF feeder layers with no inhibitors [3,9]. MEFs secrete factors, such as LIF, bFGF, and SCF, which enhance canine embryonic development [18]. Analysis of the secreted
Fig. 6. Photomicrograph showing tumor mass (A and C) with diffuse muscle tissue (TM). (B) Intense vascularization (vessels) and cells with adipose tissue characteristics (AT) and multinucleated cells (MC). (C) Tumor with cells from 2 germ layers (20).
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
Fig. 7. Polymerase chain reaction (PCR) analysis of tumor mass. Evaluation of the presence of the mOSKM exogenous factor in the mass (mOSKM tumor). Positive control (mOSKM IPSCs from canine fetal fibroblasts), negative control from cells (canine and mouse fibroblasts) and blank for contamination control.
factors from feeder cells will help to identify small molecules that generate naıve ciPSCs [9]. Unlike mouse or human ESCs, which require LIF or bFGF, respectively, for survival, the removal of LIF or bFGF leads to loss of pluripotent markers and suppression of proliferation or apoptosis [6]. In our study, the colonies remained unchanged with bFGF dependency, and the colonies did not show differences in the maintenance of pluripotency or in the capacity to expand with or without LIF. Working with canine iPS, Luo and colleagues in 2011 [6] observed total dependency of ciPSCs on both bFGF and LIF. When the cells were cultured without LIF or bFGF, the colony development was decreased, and morphological changes occurred. These authors cultured ciPSCs for 7 days without LIF and bFGF, and they measured NANOG expression levels. The results indicated that removing either LIF or bFGF is sufficient to lose pluripotency as indicated by decreased expression of NANOG. In 2013, Koh et al. [8] used a retroviral system to generate ciPSCs that are dependent on both LIF and bFGF in the presence of two small molecule inhibitors (PD 0325901/CHIR 99021). The results suggested that GSK-3-derived apoptotic signaling pathways were inhibited by CHIR 99021 and that the absence of LIF induced differentiation as demonstrated by the loss of AP activity. For the first time, this group demonstrated chromosomal instability of ciPSCs
81
by a combined approach of a CGH and FISH. The results demonstrated that genomic aberrations on specific chromosomes (4, 8, 13 and 16) are acquired after extensive passages. In human ESCs and iPSCs [26e29], it has been previously shown that genomic aberrations are acquired during extensive passages in vitro. However, unlike these previous results described by Koh et al. [8], the ciPSCs in the present study maintained a stable karyotype of 78 chromosomes and XY types at passage 15, which was similar to results described by Nishimura et al. [9] who generated functional platelets from ciPSCs, producing mature magakaryocytes (MKs) for the first time, thus demonstrating successful differentiation of canine iPSCs. The evaluation of exogenous factors showed that the human factors were completely silenced but that the murine exogenous factors remained expressed. Previously Koh et al. [8] produced iPSC lines from canine skin fibroblasts with murine factors (mOSKM) in addition to the lines produced in the present study showed murine exogenous expression, demonstrating that the murine factors are important to maintain the established lines. Otherwise, a new approach has been described, were fibroblast are exposed to DNA methyltransferase inhibitor 5-Aza-cytidine (5-aza-CR), increasing cell plasticity to differentiate in insulin-secreting cells in dogs, Brevini et al. [31], pigs, Brevini et al. [32] and humans, Brevini et al. [33]. This approach can be added to new iPSC protocols in the future, but the action is transient and still unclear. Most of the canine iPSC studies have described incomplete tumor formation. Withworth et al. [7] described germ cell-like tumor formation from passage 5 cells when transgenes are still being transcribed. In contrast to the results from Shimada et al. [5] and Luo et al. [6], Withworth et al. could not prove the pluripotency of those cells in vivo. Moreover, Lee et al. [22] and Koh et al. [8] reported tumors containing cells from 3 germ layers after subcutaneous transplantation. In our study, we described a significant tumor mass of canine iPSCs origin with several cell types but predominantly with mesodermal origin 120 days post-injection.
5. Conclusions In our study, we generated ten stable and pluripotent canine iPS cell lines independent of hLIF. The colonies exhibited positive results for in vitro and in vivo tests, and they exhibited normal karyotype and chromosomes without abnormalities. Expansion of these cells with an enzymatic protocol was possible, and cells were maintained for at least 15 passages without morphological changes. These cells maintained a high expression of endogenous pluripotent markers after passage 10. This study reports for the first time canine IPS colony maintenance without hLIF supplementation and that is resistant to enzymatic passages.
Fig. 8. Canine IPSC (colony 4, passage 10) chromosomal count data with DAPI staining captured using a fluorescence microscope and evaluated by in situ hybridization (FISH) with centromeric probes. No evidence of morphological changes was found.
82
N.J.N. Gonçalves et al. / Theriogenology 92 (2017) 75e82
Author disclosure statement The authors indicate no potential conflicts of interest. Acknowledgments
[16]
[17] [18]
The authors would like to thank FAPESP (2011/22915-5), FAPESP/BEPE (2012/09631-0), UGPN/USP (13.1.4148.1.5) and FAPESP (2015/09575-1) for financial support. References mez DA, [1] Vaags AK, Rosic-Kablar S, Gartley CJ, Zheng YZ, Chesney A, Villago et al. Derivation and characterization of canine embryonic stem cell lines with in vitro and in vivo differentiation potential. Stem Cells 2009;27:329e40. [2] Yamanaka S. Strategies and new developments in the generation of patients pecific pluripotent stem cells. Cell Stem Cell 2007;1:39e49. [3] Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006;126: 663e76. [4] Takahashi K, Tanabe K, Ohnuki M, Ichisaka T, Tomoda K, Yamanaka S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131:861e72. [5] Shimada H, Nakada A, Hashimoto Y, Shigeno K, Shionoya Y, Nakamura T. Generation of canine-induced pluripotent stem cells by retroviral transduction and chemical inhibitors. Mol Reprod Dev 2010;77:2. [6] Luo J, Suhr ST, Chang EA, Wang K, Ross PJ, Nelson LL, et al. Generation of leukemia inhibitory factor and basic fibroblast growth factor-dependent induced pluripotent stem cells from canine adult somatic cells. Stem cells Dev 2011;20:1669e78. [7] Whitworth DJ, Ovchinnikov DA, Wolvetang EJ. Generation and characterization of LIF-dependent canine induced pluripotent stem cells from adult dermal fibroblasts. Stem Cells Dev 2012;21:2288e97. [8] Koh S, Thomas R, Tsai S, Bischoff S, Lim JH, Breen M, et al. Growth requirements and chromosomal instability of induced pluripotent stem cells generated from adult canine fibroblasts. Stem Cells Dev 2013;22:951e63. [9] Nishimura K, Takahashi J. Therapeutic application of stem cell technology toward the treatment of Parkinson's disease. Biol Pharm Bull 2013;36:171e5. [10] Fiester A, Scholer H, Caplan A. Stem cell therapies: time to talk to the animals. Cloning Stem Cells 2014;6:3e4. [11] Starkey MP, Scase TJ, Mellersh CS, Murphy S. Dogs really are man's best frienddcanine genomics has applications in veterinary and human medicine! Brief Funct Genomic Proteom 2005;4:112e28. [12] Nguyen HN, Reijo Pera RA. Metaphase spreads and spectral karyotyping of human embryonic stem cells. CSH Protoc 2008;3(9). http://dx.doi.org/ 10.1101/pdb.prot5047. [13] Nardone R, Holler Y, Taylor AC, Lochner P, Tezzon SG, Golaszewski S, et al. Canine degenerative myelopathy: a model of human amyotrophic lateral sclerosis. Zoology 2016;119:64e73. http://dx.doi.org/10.1016/j.zool.2015.09. 003. [14] Sommer CA, Stadtfeld M, Murphy GJ, Hochedlinger K, Kotton DN, Mostoslavsky G. Induced pluripontent stem cell generation using a single lentiviral stem cell cassette. Stem Cells 2009;27:543e9. [15] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30] [31]
[32]
[33]
time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25: 402e8. Miething F, Hering S, Hanschke B, Dressler J. Effect of fixation to the degradation of nuclear and mitochondrial DNA in different tissues. J Histochem Cytochem 2006;54:371e4. Breen M, Langford CF, Carter NP, Holmes NG, Dickens HF, Thomas R, et al. Fish mapping and identification of canine chromosomes. J Hered 1999;90:27e30. Hatoya S, Torii R, Kondo Y, Okuno T, Kobayashi K, Wijewardana V. Isolation and characterization of embryonic stem-like cells from canine blastocysts. Mol Reprod Dev 2006;73:298e305. Schneider MR, Adler H, Braun J, Kienzle B, Wolf E, Kolb HJ. Canine embryoderived stem cellsdtoward clinically relevant animal models for evaluating efficacy and safety of cell therapies. Stem Cells, 25: 1850e1851. Hayes B, Fagerlie SR, Ramakrishnan A, Bara S, Harkey M, Graf L. Derivation, characterization, and in vitro differentiation of canine embryonic stem cells. Stem Cells 2008;26:465e73. Wilcox JT, Semple E, Gartley C, Brisson BA, Perrault SD, Villagomez DA. Characterization of canine embryonic stem cell lines derived from different niche microenvironments. Stem Cells Dev 2009;18:1167e78. Lee AS, Xu D, Plews JR, Nguyen PK, Nag D, Lyons JK, et al. Preclinical derivation and imaging of autologously transplanted canine induced pluripotent stem cells. J Biol Chem 2011;286:32697e704. sio CE, Piedrahita JA. Stem cells and regenerative Gonçalves NN, Ambro medicine in domestic and companion animals: a multispecies perspective. Reprod Domest Anim 2014;49:2e10. Gonçalves NJN, Bressan FF, Souza AF, Martins DS, Miglino MA, Meirelles FV, et al. Canine fibroblasts expressing human transcription factors: what is in the route for the production of canine induced pluripotent stem cells. Reprod Domest Anim 2012;47(Suppl. 6):84e7. http://dx.doi.org/10.1111/rda.12002. Yu J, Hu K, Smuga-Otto K, Tian S, Stewart R, Slukvin LI, et al. Human induced pluripotent stem cells free of vector and transgene sequences. Science 2009;324:797e801. Baker DE, Harrison NJ, Maltby E, Smith K, Moore HD, Shaw PJ, et al. Adaptation to culture of human embryonic stem cells and oncogenesis in vivo. Nat Biotechnol 2007;25:207e15. Lefort N, Feyeux M, Bas C, Feraud O, Bennaceur-Griscelli A, Tachdjian G, et al. Human embryonic stem cells reveal recurrent genomic instability at 20q11.21. Nat Biotechnol 2008;26:1364e6. Spits C, Mateizel I, Geens M, Mertzanidou A, Staessen C, Vandeskelde Y, et al. Recurrent chromosomal abnormalities in human embryonic stem cells. Nat Biotechnol 2008;26:1361e3. Mayshar Y, Ben-David U, Lavon N, Biancotti JC, Yakir B, Clark AT, et al. WE Lowry and N Benvenisty. Identification and classification of chromosomal aberrations in human induced pluripotent stem cells. Cell Stem Cell 2011;7: 521e31. Koressaar T, Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007;23(10):1289e91. Manzoni EFM, Pennarossa G, de Eguileor M, Tettamanti G, Gandolfi F, Brevini TAL. 5-azacytidine affects TET2 and histone transcription and reshapes morphology of human skin fibroblasts. Sci Rep 2016;6(37017):1e13. Pennarossa G, Maffei S, Campagnol M, Rahman MM, Brevini TAL, Gandolfi F. Reprogramming of pig dermal fibroblast into insulin secreting cells by a brief exposure to 5-aza-cytidine. Stem Cell Rev Rep 2014;10:31e43. Brevini TAL, Pennarossa G, Acocella F, Brizzola S, Zenobi A, Gandolfi F. Epigenetic conversion of adult dog skin fibroblasts into insulin-secreting cells. Vet J 2016;211:52e6.