- Email: [email protected]
Generation of novel sequence tagged sites (STSs) from discrete chromosomal regions using Alu-PCR
GENOMICS
10,816-826
Generation
(1991)
of Novel Sequence Tagged Sites. (STSs) from Chromosomal Regions Using A/u-PCR C. G. COLE,* P. N. GoomLLow,t
Discrete
M. BOBROW,* AND D. R. BENTLEY*
*Paediatric Research Unit, Division of Medical and Molecular Genetics, United Medical and Dental Schools of Guy’s and St. Thomas’ Hospitals, 8th Floor, Guy’s Tower, London Bridge, London SE 1 9RT, United Kingdom; and tlmperial Cancer Research Fund, P.O. Box 123, Lincoln’s Inn Fields, London WC2A 3PX, United Kingdom Received
January
somal regions. A number of methods for the generation and transfer of chromosome fragments have been developed, for instance, chromosome-mediated gene transfer (CMGT) (reviewed in Goodfellow and Pritchard, 1988) or irradiation-fusion gene transfer (IFGT). In a modification of the IFGT experiments of Goss and Harris (1975,1977), irradiated hybrids containing the chromosome or region of interest are fused with a rodent parent. The resulting fusion hybrids retain one or more discrete human fragments (Graw et al., 1988; Cox et al., 1989; Benham et aZ., 1989). Markers generated from these hybrids can be localized to one or the other of the distinct regions using suitable mapping panels. Previous strategies for isolating human DNA from hybrids have relied on preparing lambda or cosmid libraries from DNA of the hybrid and selecting human clones from the rodent background by hybridization to repetitive sequence probes (Gusella et al., 1980). A quicker and less labor-intensive method, which generates a subset of human sequences from the rodent background without cloning, is interspersed repetitive sequence PCR (IRS-PCR) (Ledbetter et aZ., 1990), for instance, Alu-PCR (Nelson et aZ., 1989). By designing PCR primers that amplify out from the ends of Alu-repeat units (Jelinek and Haynes, 1983), it becomes possible selectively to amplify human DNA only. The resulting fragments are a potential source of region-specific sequence data and therefore STSs. In this study we have undertaken to test the feasibility of generating STSs from defined chromosomal regions using Alu-PCR. We have constructed a series of irradiation-fusion hybrids selected for the retention of human chromosomal DNA in the region of the hypoxanthine phosphoribosyltransferase (HPRT) gene on the X chromosome. The Alu-PCR technique was optimized to allow efficient amplification from both ends of the repeat unit individually or in a combined reaction, and used to amplify a large number of hu-
Human DNA segments from discrete chromosomal regions were generated by utilizing Ah-element-based polymerase chain reaction (ALPCR) of an irradiation-fusion hybrid containing approximately 10 to 15 Mb of human DNA. Following cloning into a plasmid vector, a subset of the clones was used to generate sequence tagged sites (STSs) de nouo. By means of a panel of hybrids containing portions of the human X chromosome, the STSs were shown to localize to two chromosomal regions, Xq24-Xq26 and Xcen-Xq13, reflecting the presence in the irradiation-fusion hybrid of two human chromosome fragments. These results demonstrate that high densities of STSs can be rapidly and efficiently generated from defined regions of the human genome using Ah-PCR. o 1991 Academic PRXB, Inc.
INTRODUCTION
Construction of physical maps from defined regions of complex genomes requires large numbers of evenly spaced DNA markers from the given region. Sequence tagged sites (STSs) (Olson et al., 1989) are short tracts of operationally unique DNA sequence that can be detected via PCR (Saiki et aZ., 1988) and can act as basic landmarks on a physical map. The “STS content mapping” strategy has been used successfully to generate a l&Mb yeast artificial chromosome (YAC) contig of the cystic fibrosis transmembrane receptor (CFTR) gene region (Green and Olson, 1990a) and a 3-Mb contig spanning the dystrophin gene (Coffey et aZ., manuscript in preparation). However, all STSs that have been used in mapping projects to date have been derived from well-characterized DNA probes or sequences. For mapping less well-characterized regions of the genome using this approach, it will be necessary to generate high densities of novel STSs from undefined DNA fragments that are specific to a selected chromosomal region. Somatic cell hybrids can be used as sources of human fragments that are specific for given chromo088%x43/91 Copyright All rights
$3.00 0 1991 by Academic Press, Inc. of reproduction in any form reserved.
30, 1991
816
NOVEL
REGION-SPECIFIC
man-specific sequences flanked by Alu repeats in any of the three possible orientations. The amplification products from one hybrid, containing a small amount of human DNA, were cloned and the ends sequenced to generate a set of region-specific novel STSs. MATERIALS
AND
METHODS
Cell Lines Wg3-h is an HPRT-deficient hamster cell line (Westerveld et al., 1971). C12D, a human-hamster hybrid, contains a single human X chromosome (Goss and Harris, 1977). 4BA1, a naturally occurring variant of the established human-mouse hybrid Horl9X (Goodfellow et al., 1985), retains Xcen-Xqter only (F. Giannelli and J. Crolla, personal communication). MCP-6 is a human-mouse hybrid retaining Xq13Xqter (Goodfellow et al., 1982). X3000-11.1, a derivative of human-hamster hybrid 4.12, retains Xq24Xqter only (Nussbaum et al., 1986). PIP, a humanmouse hybrid, retains Xpter-Xpl14 and distal Xq26-Xqter (Boyd, f987). HorlSIlR8B is a humanmouse hybrid retaining Xpter-Xq22 (Boyd, 1987), and IRE3 is a mouse cell line (Nabholz et al., 1969). Irradiation
and Fusion
and Southern
Blot Analysis
Cells were simultaneously cultured for use in both in situ hybridization and DNA preparation for Southern blot analysis. GTG-bandedchromosomes were hybridized to biotinylated total human DNA or the alphoid-centromeric repeat-derived probe pSV2X5 (for method see Benham et al., 1989). For Southern blot analysis 5-10 pugof DNA was digested with the appropriate restriction endonuclease, electrophoresed through 0.8% agarose gels, and transferred to a nylon membrane (Hybond N, Amersham). DNA probes were labeled by random hexanucleotide priming (Feinberg and Vogelstein, 1983) and hybridized and washed to 0.2-0.5X SSC, 65”C, using standard procedures (Maniatis et al., 1982). Amplification
USING
817
Ah-PCR
25-75 ng DNA was amplified in a 25-111 reaction which contained 1.3 PM each oligonucleotide primers (2.6 PM total for single primer reactions), 67 mM Tris-Cl, pH 8.8,16.6 mM (NH&SO,, 6.7 mM MgCl,, 0.5 mM deoxyribonucleoside triphosphates (dATP, dCTP, dGTP, dTTP), 1.5 units Amplitaq (Cetus, Inc.). Then, 10 mM 2-mercaptoethanol and 170 fig/ml bovine serum albumin (Sigma, A-4628) were added freshly when each set of reactions was assembled. All reactions were preceded by an initial denaturing step of 5 min at 94°C and followed by a final 5-min extension step at the appropriate temperature. For AluPCR, amplifications with primers ALE1 alone or ALE1 plus ALE34 (ALE34 sequence from P. de Jong, PDJ34, personal communication) were cycled using the Techne PHCl only, with 30 cycles of 1 min at 93”C, followed by between 3 and 7 min at 76°C. Amplifications with ALE34 or ALE3 were cycled on either the Techne PHCl or PHCB, using 30 cycles of 1 min at 93’C and 3 min at 75°C (ALE34) or 73°C (ALE3). PCR reactions not involving AZu primers were cycled on the Techne PHCB, using 30 cycles of 1 min at 93”C, 1 min annealing (see Table 1 for temperatures), and 2 min (except 3/22, 1.75 min) at 72’C. Use of ALI Internal Alu Primers DNA Content of Hybrids
Gene Transfer
The X-only human-hamster hybrid C12D was irradiated with 6000 rads and fused with its HPRT-deficient rodent parent cell line, Wg3-h, using a modification of the method of Pontecorvo (1975; Benham et al., 1989). The resulting IFGT hybrids were selected in HAT and grown in DMEM (Flow laboratories) supplemented with 10% fetal calf serum, penicillin, and streptomycin as described in Benham et al. (1989). In Situ Hybridization
STSs
of Genomic DNA
Primer sequences and annealing temperatures are shown in Table 1. PCR was carried out as follows:
to Estimate
Human
Amplification of a 236-bp segment of the human Alu repeat element using ALI primers (Table 1) was performed on a Techne PHC2 by 21 cycles of 1 min at 93°C 0.8 min at 65”C, and 1.75 min at 72°C. Doubling dilutions of the following hybrid DNAs were amplified: C12D, X3000-11.1, F2, Wg3-h. Starting concentrations for the doubling dilutions, measured on a DNA fluorometer (Hoefer Scientific Instruments, TKO loo), were 40, 160, 800, and 800 ng, respectively. Use of Alu-PCR
Products
as Hybridization
Probes
AZu PCR products were electrophoresed on 3% NuSieve agarose (FMC), 1X TBE (Maniatis et al., 1982), 20 x 20-cm gels, and the relevant fragments were cut out and rerun on a second gel. A toothpick was touched just into the agarose at the position of the relevant fragment and stirred in a 25~1 PCR reaction containing the same primer used to generate the fragment. Following PCR (20 cycles), the products were purified using GeneClean (Bio lOl), resuspended in TE (10 mM Tris-Cl, 0.1 mM EDTA, pH 7.8), and used as hybridization probes. Approximately 10 ng of fragments of 1.3-1.6 kb was labeled using random oligonucleotide priming (Feinberg and Vogelstein, 1983) and prereassociated with sheared total human placental DNA at 65°C prior to hybridization in a sodium phosphate-based buffer at 68°C for 18 h (Blon-
See text
See text 65
59 68 65 65 65 65 68 68 65 65 56.5 65 66 68 64 65 68 65
ALE3”
ALE1 ALI”
PSP65 l/l
’ Degeneracies * Approximate
l/17 l/29 l/44 l/67 3/2 3/10 3/14 3/15 3/19 3/21 3/22 3131 3/40 3/50
Primer
Annealing 1 (5’ +
3’)
Temperatures,
TGAGCCGAGATCGCGCCACTGCACTCCAGCCTGGG TAT TATA T CCACTGCACTCCAGCCTGGG T GCCTCCCAAAGTGCTGGGATTACAG TGGAGTGCAGTGGCGCGATCTCGG A TATA ATA CATACGATTTAGGTGACAC GTCAGATCGAATTATGACCCATAC GTCTGCCCTATAGCCTCCCTAC ACCATTATAGAGAAGTGACAC CTCGGTGCCTAACTGAGGCAC GGGCATGGAAGTCTCTGGCTGAC TCCTTAGGAATTCTGGGCTCC CTACACATATGGGCTGATGGAC CTTAGCATTTGAGAAACTAC GACCTGGGTTTATGCCTCAAC GGCTAACTGCGTATATCCTC GTCAACCTCTATCTGTTAAAG GCCCATGAATTGAAATGAATGCC TGGAACTCTTGTGAACTGC GTAAACATACACAAGAAGATAC CTGCTTCAGACAACTGAAGCAGG TTGTGGAGACAGAATCTCACTG GTTGAAGAATTCCCCTTCTATTTG
Sequences,
indicated on second line. size based on gel electrophoresis.
See text
ALE34”
w l/6
Temp 03
Primer
Primer
TABLE and Product
1 Sizes
OR ALE1
Primer
2 (5’ *
and Sequencing
ALE1 OR ALE34 TCACGCCTGTAATCCCAGCACTTT TA GCGGATAACAATTTCACAC ACGCCCAGTACCTCAGAATGTGAC TCTGCTAGCTCCTTACGGTCAG GGGTCACATAGCTGGTAAATGGC TTGCATTGGTGGTCTTCTCTGGG ATCTTCTTGAAGGTGCAGATTAAAG GTCATTCTCCTAGAAAATTCAGC CCTGGATTAACTCACAGACTCC CAGAATCTCACTGTTTTGTCCAAGC TCACCTTTCTAGGACAATC TAAATCACTTTCAAAATGTAG GGCTCAAGGAATCCACCCCTC CAGTGTTTCAGTCTTCACCAGGAC CACCAAGTATCTGCTTGAGTCCC GAGAGAGGGTGCTCTCCAG GAAGTGGCTTCAGACACATTCAGG CATTTGAGAAACTACACAGACTCC GAGCATTTGAGAAGCTTTAACACC
ALE3
ALE34
for PCR 3’)
F 2906 93
79
158 222 100 127 127 171 222 100b 166
8 & M 4
98 116’ 148* 93 300*
236
-
-
Size (bp)
NOVEL
den et al., SSC, 65°C.
1989).
Cloning of Alu-PCR
Filters
were
REGION-SPECIFIC
washed
to 0.5X
Products
PCR products from ALEl-amplified and ALE3amplified F2 were extracted with chloroform and fractionated on a Sephacryl S-300 (Pharmacia) column. Appropriate fractions were pooled and the DNA (approximately 500 ng at 10 ng/pl) was phosphorylated using T4 polynucleotide kinase. On completion, the reaction was extracted sequentially with phenol, chloroform, and ether, and the DNA was separated from nucleotides by fractionation on a spun Sephadex G50 (medium, Pharmacia) column. The DNA was then ligated overnight to HincII-digested, phosphatased pSP65 vector and transformed into DH5a Escherichia coli competent cells. Amplification and Sequencing Products to Generate STSs
of Cloned Alu-PCR
Colonies were toothpicked into 500 ~1 TE and boiled for 10 min, and 5 ~1 was used directly in PCR (Gussow and Clackson, 1989). For initial characterization of clones, colonies were amplified with the appropriate AZu primer (reaction conditions as above), and 5 ~1 of the PCR product was digested with BstNI, Hinf’I, or DdeI. For subsequent analysis, selected clones were amplified by PCR with vector-specific primers (for conditions see above and Table 1, PSP65 primers). The products were purified using GeneClean (Bio lOl), and 50 to 100 ng DNA was sequenced directly (Green et aZ., 1989) from each end using the PSP65 primers with the inclusion of DMSO in the sequencing reactions (Winship, 1989). Primer pairs generated from this sequence data (Table 1,1/l to 3/50) were tested using 50-75 ng genomic DNA per 25-~1 reaction. Amplification conditions were as above, with annealing temperatures as detailed in Table 1. Five microliters of each reaction was analyzed by electrophoresis on 3% NuSieve agarose or 2.5% agarose gels. RESULTS
Construction Hybrids
and Analysis
of Irradiation-Fusion
IFGT hybrids retaining the HPRT gene were generated by fusion of the irradiated hybrid C12D, which contained only the human X chromosome, with the hamster cell line Wg3-h, followed by selection in HAT medium. DNA was extracted from eight hybrids (Bl-F2) and analyzed by Southern blotting using 21 X-linked DNA markers (see Table 2). All hybrids were positive for the HPRT probe pB1.7. The number
STSs
USING
Ah-PCR
819
of apparently contiguous loci transferred with HPRT ranged from none of those tested to all of those present in a region spanning Xq24-27. In addition, three lines were positive at Xp loci and a single line was positive at all loci tested. In all but one case alphoid centromeric sequences were retained as detected by Southern blot hybridization. In situ hybridization, using total human DNA or a human alphoid repeat probe, showed that many of the lines represented two or more cell populations and in some cases two inserts were retained within a single cell, accounting for the apparent discontinuity of human sequences. A single hybrid (F2) was devoid of human alphoid centromeric sequences, as assessed using Southern blotting and in situ hybridization, although PCR with a primer specific for X-chromosome alphoid sequences (Ian Dunham, personal communication) indicated that a small number of alphoid sequences may have been retained. This hybrid was positive only for the HPRT probe pB1.7. From the results of in situ hybridization it appeared that this cell line carried two small human fragments, each at or near one end of two distinct hamster chromosomes. To assess the total human DNA content of F2, PCR was performed on F2 and on hybrids retaining known segments of the X chromosome (Fig. 1) using AL1 primers, which recognize highly conserved regions of the human Alu repeat and which direct amplification of a 236-bp segment of the human Alu element only. The amount of product obtained by amplification of 40 ng X-only hybrid C12D was equivalent to the amount obtained by amplification of 160 ng X300011.1 or 800 ng F2 (see Fig. 1). Karyotype analysis of F2 indicated that it was virtually tetraploid with respect to hamster chromosomal material, but haploid with respect to the human fragments. This affects the relative number of human fragments/unit mass of hybrid DNA. After this was taken into account, F2 was judged to contain 10 to 15 Mb of human DNA. In common with all methods that assess the human content of hybrids on the basis of analysis of repeat elements, this estimation will be affected by the nonrandom distribution of AZu elements (Korenberg and Rykowsky, 1988; Moyzis et al., 1989; Chen and Manuelidis, 1989). However, this PCR-based method, which is highly sensitive and not affected by rodent Alu-like sequences, can rapidly and consistently detect human sequences in hybrids retaining only small amounts of human DNA (Cole et al., manuscript in preparation).
Alu-PCR To maximize the number of Alu-PCR products obtained from a given hybrid, Alu-PCR primers that di-
820
COLE
ET
TABLE Human
DNA
Markers
Present
AL.
2 in Irradiation-Fusion
Hybrids Hybrid
Locus
Ref.
DXYS14 DXS31 DXS41 DXS269 DXS270 DXS164 DXS206 DXS7 DXS146 DXZl PGKl DXYSl DXS3 DXSll DXSlOO HPRT DXS144 F9 DXS15 GGPD F8C
(8) (30)
(2) (48) (36)
(36) (47) (11) (1)
(52) (30)
(42) (2) (2) (53)
(28) (26) b
(50) (43) (14)
Note. +, strongly positive; D Although no hybridization * Probe 6-11 (J. Montandon,
Chromosomal location Xp22.3 Xp22.3 xp22.1 xp21.2 xp21.2 xp21.2 xp21.2 xp11.3 xp11.2 XCen xq13 xq21.31 xq21.3 Xq24-26 Xq25-26 Xq26 Xq26 xq27.1 Xq28 Xq28 Xq28
Bl
B2
Cl
c2
Dl
El
E2
F2
-
+ + + + + + + + + + + + + + + + + + + + +
-
+ + + -
-
+/+/+ -
-
-
-
+ + -
+ -
-a -
+ -
+ + -
+ -
+ + + + + + + + + +/+/+ + -
+ + + + + -
+ + + + + + -
+ + + + + -
+/-, weakly positive; -, negative. signal visible, see Results. personal communication).
rected amplification away from either end of the Alu repeat and that could be combined in a single reaction were used. The right-hand AZu-PCR primer, ALE34, directs amplification from a human-specific site 23 bases left of the poly(A) tail (right- and left-hand orientations are as described in Kariya et al., 1987). ALE3 is a truncated version of ALE34 (Table 1). The left-hand primer, ALEl, anneals to a conserved re-
c
236
bp
FIG. 1. Estimation of the human DNA content of hybrid F2 using “internal” Alu-PCR primers, ALL Lanes l-4 show the products of four reactions from doubling dilutions of DNA (starting concentrations are given in parentheses: C12D (40 ng), X3000-11.1 (160 ng), F2 (800 ng), R = Wg3-h (800 ng, only the highest and lowest shown), M = 1-kb ladder. The amount of product obtained by amplification of 40 ng C12D is equivalent to the amount obtained by amplification of 160 ng of X3000-11.1 or 800 ng of F2 (compare lanes 1 from each set). A similar result is observed in the corresponding doubling dilutions. The same results were obtained when all PCR assays were made up to 800 ng by the addition of hamster (Wg3-h) DNA.
gion of the human Ah consensus (Kariya et al., 1987) and contains a mismatch with the hamster Ah equivalent (Jelinek and Haynes, 1983) at its 3’ end. Amplification of a panel of hybrid and total human genomic DNAs with ALE1 (Fig. 2a) or ALE34 (Fig. 2b) produced an increasing number of bands as the human DNA content increased. Fragments corresponding in size to those amplified from hybrid F2 were present in El (Fig. 2a). The additional fragments in El are presumed to be derived from the additional proximal Xq region present only in El or additional sequences at or near the Xq26 region (see Table 2). Amplification of Cl also gives a pattern resembling that of El. The patterns of DNA fragments amplified in hybrids Dl and E2 (Fig. 2a) were similar and included the majority of bands present in F2 and El. The Alu-PCR products of the remaining hybrids gave more complex related patterns, with that of B2 clearly resembling that of C12D. This was consistent with the presence in B2 of all X-chromosome markers tested. It is evident from these results that specific regions give characteristic patterns of bands. These results confirm the possibility of using Alu-PCR as a method for fingerprinting hybrids or cloned material (Ledbetter et al., 1990). One hybrid, F2, was selected as a source of material suitable for generating region-specific hybridization
NOVEL
REGION-SPECIFIC
STSs
USING
821
Atu-PCR
bD
1600 1000
516 394 344 29s 220 200
CL2D abc
o
bc
Wg3-h ___
M
bD
abc
1600 1000
516 394 344 298
220 200
FIG. 2. Alu-PCR using the left-hand primer ALE1 (a) or right-hand primer ALE34 (b) on IFGT hybrids (B2-F2), total human male (H), parental X-only hybrid C12D (X), Xq-only murine hybrid 4BAl (Q), hamster parent Wg3-h (W3), mouse IRE3 (IR), TE control (C), and 1-kb ladder (M). Samples have been arranged in descending order of human DNA content as judged from Southern blot analysis. (c) A comparison of primer ALE1 alone (lanes marked a), ALE34 alone (lanes marked c), and ALE1 plus ALE34 combined (lanes marked b) on IFGT hybrid F2, the X-only hybrid C12D, and hamster Wg3-h. Gels are ethidium bromide-stained minigels, 2.5% agarose (a, b) and Nusieve agarose (c).
probes and ST% by Alu-PCR. Amplification of hybrid F2 with either primer ALE1 or ALE34 produced a minimum of 18 and 25 fragments, respectively, when electrophoresed and visualized on ethidium bromide-stained minigels (Fig. 2c, F2 lanes a and c; see also Figs. 2a and 2b). When the primers were combined, at least 20 additional products were present (Fig. 2c, F2 lane b). Some of the weaker single-primer amplification products are not visible in the combined reaction, presumably as a result of competition with the greater number of strongly amplifying products. For comparison with F2, amplification of the X-only hybrid C12D in the same experiment is also shown, with ALE1 (Fig. 2c, CLBD lane a) and ALE34 (C12D lane c) alone or with both primers combined (C12D lane b).
Evaluation
of Ah-PCR
Products
Using Hybridization
Alu-PCR products from hybrids may be used successfully as hybridization probes in Southern blot analysis (Ledbetter et al., 1990; Cotter et al., 1990; Brooks-Wilson et al., 1990). The localizations of three Alu-PCR products from F2 were determined by hybridization as follows. The Alu-PCR products were gel-purified as described under Materials and Methods and used as probes in Southern blot analysis of a hybrid panel. Probes 1 and 2 detected a 2- and a 6-kb Hind111 fragment, respectively, in hybrid 4BA1, but were negative with the hybrids PIP and HorlSllR8B (Figs. 3a and 3b), and thus could be localized to Xq22-Xq26. Probe 3 detected a 4.6-kb fragment in 4BAl and HorlSllR8B but was negative in PIP and
822
COLE
a. Cl
C2
Dl
El
Dl
El
E2
F2
X
:,
,”
FH
W3
F H
M H
F H
W3lR
IR
Q
P
R
Cl
P
R
kb
b. Cl
C2
E2
F2
X
-
kb 23
-
9.4
-
6.7
-
4.4
-
2.3
-
2.0
FIG. 3. Hybridization of two gel-purified Alu-PCR products from IFGT hybrid F2, to a panel of HindHI-cut DNAs: Cl-F2, irradiation-fusion hybrids; X, C12D; H (F), total human (female); H (M), total human (male); W3, Wg3-h (hamster); IR, IRE3 (mouse); Q, 4BAl; P, PIP; R, HorlSllR3B; Probe 1 (a) andprobe 2 (b) recognize a 2- and a 6-kb fragment, respectively, both of which map to Xq22-Xq26. The 3.5kb fragment cross-hybridizing with probe 2 in total human (lanes marked H) but not the X-only hybrid (lane X) is presumed to be an autosomal sequence.
therefore mapped to Xcen-Xq22. These results are consistent with the presence within F2 of two distinct human chromosome fragments as suggested by in situ results.
Generation
of Sequence Tagged Sites
Alu-PCR was performed on F2 using primers ALE3 and ALE1 individually. Following cloning of the ALE3/F2 and ALEl/FB products as described under Materials and Methods, amplified inserts of all positive colonies were analyzed with one or more of the restriction enzymes BstNI, Hinf I, and DdeI. From these results, many clones whose inserts co-migrated were found to represent different Alu-PCR fragments by restriction analysis, Hence, a total of 50 ALE3/F2 clones that were divided into 13 groups on the basis of insert size alone were shown to represent twice as many distinct clones following restriction analysis. Twenty-six of 50 clones analyzed from the ALE3/F2
ET
AL.
experiment, and 10 of 15 ALEl/FB clones analyzed, contained different Alu-PCR fragments. Twenty ALE3/F2 and 10 ALEl/F2 clones were selected to generate STSs. These were reamplified with vector-specific primers, the resulting PCR products were then sequenced, and the data obtained were used to generate 15 and 9 pairs of primers, respectively. Primer pairs were not generated from the remaining 6 sequencing reactions, as the result of either small insert size (one case) or an internal Ah repeat (2 cases) or because an extended poly(dA) tract at each end of ALE3/F2 clones prevented sequence data from being obtained (three cases). The 24 primer pairs obtained were tested against total human (male) DNA, an independent panel of hybrids containing various regions of the X chromosome, and hybrid F2 (Table 3 and Fig. 4). Seventeen primer pairs gave products of the expected size in the hybrid F2 and only in the presence of human chromosomal material (see Table 3). This therefore defines 17 novel STSs, which corresponds to a conversion rate from DNA sequence to STS of 70%. Eleven STSs mapped within Xq24-Xq26 (examples in Figs. 4a and 4b), while six mapped within Xcen-Xq13 (examples in Figs. 4c and 4d), consistent with Alu-PCR amplification of human DNA from two regions of the genome corresponding to the two human chromosomal fragments present in F2. These results were in agreement with the mapping data generated using gel-purified Alu-PCR amplification products as hybridization probes, two of which mapped to Xq22-Xq26 while one mapped to Xcen-Xq13. One STS (3/21, Fig. 4~) amplified equally a hamster-specific band and the expected, human-specific product and may therefore represent a conserved sequence. The majority (11) of these STSs gave a single amplification product of the expected size in human DNA. Four, however, showed low levels of additional amplification product(s), and two cases amplified comparable levels of such product(s). Provided that the STS was used in a PCRbased gel assay, these extra products did not interfere with the function of the STS to identify a unique product within a given DNA source. Of the 24 primer pairs synthesized, 7 failed to produce STSs. Two, both originating from small inserts, failed to amplify the hybrid F2,4BAl, or the X-only parent of F2, C12D, but did produce a product of the expected size in total human male DNA. These are assumed to be the result of contamination with total human Alu-PCR products during cloning. One ALEl/F2-derived pair yielded the expected product only in the presence of hamster DNA and was therefore assumed to be derived from a hamster Alu-equivalent amplified fragment. In two cases the expected products were so short (~60 bp) that they were obscured by primer dimers in the gel assay. One pair
NOVEL
I
+
I
+
I
t
I
+
I
+
I
+
+
I
+
I
+
I
+
I
+
I
+
I
+
I
+
I
+
I
+
I
+
I
REGION-SPECIFIC
STSs
USING
823
Ah-PCR
resulted in multiple bands in both species, failed to amplify any sample tested.
and one
DISCUSSION The value of Alu-PCR for generating markers, and specifically STSs, for mapping projects depends first on the number and distribution of the Alu-PCR products and second on efficient conversion of these products to STSs. Maximum amplification should be obtained by using primers directed away from both ends of the Alu repeats, since, assuming that Alus are randomly distributed and orientated, such a combined reaction should result in twice the total number of products achieved from the combined single-primer amplifications. If, as has been reported within the HPRT gene (Edwards et al., 1990) and in analysis of GenBank sequences (Moyzis et al., 1989), Ah repeats are not randomly orientated within a given region but are found in blocks of the same orientation, this would further increase the proportion of products arising from the combined reaction and hence both left and right Alu-PCR primers should be used to maximize representation. We have obtained a large number of Alu-PCR products using primers ALE1 and ALE34, both separately and in combination. Amplification of the estimated lo-15 Mb of human DNA present in F2 generated a minimum of 18 and 25 fragments using ALE1 or ALE34 alone. When both primers were used in the same reaction, at least a further 20 novel products were visible. However, this is likely to be an underrepresentation of the true number because of the limitations in gel resolution of the large number of products (Fig. 2c, lane 2). In addition, restriction analysis of amplified inserts distinguished clones of similar insert size, leading to a twofold increase in the number of distinct clones. Therefore, we estimate that AluPCR amplification of hybrid F2 with ALE1 and ALE34 separately and in combination generated in excess of 130 different human-specific products, i.e., one Alu-PCR fragment per 75-100 kb. To justify the investment involved in converting a random clone to an STS, a high proportion of clones must generate successful STSs. We have demonstrated that sequences derived from Alu-PCR products were successfully converted to STSs in 17/24 (70%) of cases. Sequence suitable for designing primers could not be obtained from 6/30 (20%) of the clones. It is probable that this latter figure could be considerably improved. In this study we investigated conversion of ALE1 (left-hand) only and ALE3 (right-hand) only generated clones independently. ALE3 amplifications resulted in a greater number of products than ALEl. As a result of this, and a higher cloning efficiency of the ALE3 products in this exper-
824
COLE
ET
AL.
b.
0. t-I 0
P6
X3
R P
F2 Wg IR C
M
H 0
P6
X3
R P
F2 Wg IR C
M
H 0
P6
X3
R P
F2 Wg IR C
M
d.
c. H 0
P6
X3
R
P F2 Wg IR
C
M
FIG. 4. PCR analysis using four STSs, derived from the cloned Alu-PCR products of IFGT hybrid F2, on a panel of independent hybrids: H, total human (male) DNA, Q, 4BAl; P6, MCP-6; X3, X3000-11.1; R, HorlSllRSB; P, PIP; F2, IFGT hybridF2; Wg, Wg3-h (hamster); IR, IRE3 (mouse); C, TE control; M, 1-kb ladder. STSs 3/19 (a) and l/44 (b) localize to Xq24-Xq26. STSs 3/21 (c) and l/2 (d) localize to Xcen-Xql3. STS 3/21 (c) amplifies a hamster-specific fragment of approximately 230 bp in addition to the expected 171-bp human-specific product. The lower fragment observed in all lanes of STS l/2 (d) is assumed to be primer dimer.
iment, two-thirds of the clones originated from ALE3 amplifications. Both ends of these clones can have long poly(dA) tracts resulting from the variable Arich region at the right-hand end of Ah repeats. These not only can prevent sequence data being obtained but also can restrict choice of primers in small clones and therefore increase potential problems caused by primer dimers. Hence, the conversion rate from cloned ALE3/F2 product to STS was only 50%, while ALEl/F2 products, which have no A-rich ends, resulted in STSs from 70% of clones. Three-quarters of the products originating from the combined reaction would have at least one end that lacked the poly(dA) tract. Thus, the conversion rate from cloned product to STS, if both primers are used, would be expected to be in excess of 60%. Given one Alu-PCR product per 100 kb and a conversion rate to STS of 60%, the density of STSs that could be obtained by this approach in this region of the genome is approximately one STS per 170 kb. This is a reasonable approximation of the number of randomly generated STSs required to create YAC contigs from a library with a mean insert size of 300 kb or more. Although the distribution of STSs is likely to be nonrandom, many of the remaining gaps could be closed by generating new STSs at the ends of existing YAC contigs (Riley et al., 1990) and rescreening the library. Our preliminary results (unpublished data) show that all Alu-PCR-generated STSs tested
to date can successfully identify YACs from libraries by using PCR analysis of YAC pools (Green and Olson, 1990b). It has been suggested that Ah repeats are found more often in light G-bands, with LINE repeats preferentially localized in the dark G-bands (Korenberg and Rykowski, 1988; Moyzis et al., 1989; Chen and Manuelidis, 1989). Line sequences have been used successfully either alone or in combination with Ah primers (Ledbetter et al., 1990) to generate human fragments from hybrids. When a region appears depleted for sufficient Alu-primed fragments, this approach, or the use of other repeat sequences, could be used to increase representation of PCR products and therefore STSs. It has been proposed that STSs should be organized into a database to assist researchers involved in the genome mapping project. Any database of this kind would require strict guidelines to ensure adequate performance of the STSs included. However, it is important that potentially valuable STSs are not lost as a result of excessive stringency. There are two operational criteria that determine the utility of a particular STS: (i) An STS may be used as a specific PCR assay, in which case only the sequences comprising the primer sites (approximately 40 bp) must be unique. (ii) The amplified STS product may be used as a hybridization probe (Green and Olson, 199Ob). This demands that a significant proportion of the se-
NOVEL
REGION-SPECIFIC
quence between the primers is also unique. If all STSs are required to satisfy both criteria, this would prevent the inclusion of some small STSs, which form a significant proportion of the STSs generated from the products of Alu-PCR and also many microdissection clones (Liidecke et al., 1989). It is likely that many applications will not require the use of an STS as a hybridization probe. For example, by adopting a system of PCR on pooled rows and columns (J. Collins and D. R. Bentley, unpublished results), it is possible to eliminate the final hybridization step currently used (Green and Olson, 1990b) to localize positive YAC clones, thus permitting the use of STSs that do not satisfy the second criterion to be used to screen YAC libraries. In conclusion, we have demonstrated that Ah-PCR fragments derived from an irradiation-fusion hybrid containing a small amount of human DNA can be efficiently converted to STSs. These have been shown to map to discrete chromosomal regions. In addition, sufficient numbers of STSs can be generated to form the basis for a physical map, and preliminary data indicate that they can be used successfully to identify YACs from libraries and therefore to form the basis of a YAC contig.
STSs
Note added in proof: 3/40 has been found to represent a co-cloning of 3/2 (class 4) and 3/31 (class 2) clones. As a result 3/2 and 3/40 represent the same STS. This does not alter the overall success rate or the conclusions drawn.
REFERENCES 1.
2.
3.
4.
5.
AHRENS, P., ALBERTSEN, H., RIIS VESTERGAARD, S., BoLUND, L., AND KRUSE, T. A. (1985). Anonymous X-chromosomal probes revealing DNA polymorphisms one of which is a deletion of more than 3 kb. Cytogenet. Cell. Genet. 40: 567. ALJJRIDGE, J., KUNKEL, L., BRUNS, G., TANTRAVAHI, U., LALANDE, M., BREWSTER, T., MOREAU, E., WILSON, M., BROMLEY, W., RODERICK, T., AND LAW, S. A. (1984) A strategy to reveal high-frequency RFLPs along the human X-chromosome. Am. J. Hum. Genet. 36: 546-564. BENHAM, F., HART, K., CROLLA, J., BOBROW, M., FRANCAVILLA, M., AND GOODFELLOW, P. N. (1989). A method for generating hybrids containing nonselected fragments of human chromosomes. Genomics 4: 509-51’7. BLONDEN, L. A. J., DEN DUNNEN, J. T., VAN PAASSEN, H. M. B., WAPENAAR, M. C., GROOTSCHOLTEN, P. M., GINJAAR, H. B., BAKKER, E., PEARSON, P. L., AND VAN OMMEN, G. J. B. (1989). High resolution deletion breakpoint mapping in the DMD gene by whole cosmid hybridization. Nucleic Acids Res. 17: 5611-5621. BOND, Y. (1987). Characterization and use of somatic cell hy-
Alu-PCR
brids with interspecific X chromosome. Ann.
825 translocations involving Hum. Genet. 51: 13-26.
the human
6.
BROOKS-WILSON, A. R., GOODFELLOW, P. N., POVEY, S., NEVANLINNA, H. A., DE JONG, P. J., AND GOODFELLOW, P. J. (1990). Rapid cloning and characterization of new chromosome 10 markers by Ah element-mediated PCR. Genomics 7: 614-620.
7.
CHEN, T. L., AND -LIDIS, L. (1989). SINES and LINES cluster in distinct DNA fragments of Giemsa band size. Chromasoma 98: 309-316.
8.
COOKE, H. J., BROWN, W. R. A., AND RAPPOLD, G. A. (1985). Hypervariable telomeric sequences from the human sex chromosomes are pseudoautosomal. Nature fLondon) 317: 687692.
9.
CO?TER, F. E., HAMPTON, G. M., NASIPURI, S., BODMER, W. F., AND YOUNG, B. D. (1990). Rapid isolation of human chromosome-specific DNA probes from a somatic cell hybrid. Genomics 7: 257-263. Cox, D. R., PRITCHARD, C. A., UGLUM, E., CASHER, D., KoBORI, J., AND MYERS, R. M. (1989). Segregation of the Huntington disease region of human chromosome 4 in a somatic cell hybrid. Genomics 4: 397-407.
10.
11.
DAVIES, J. M., (1983). ing the of the 2312.
12.
EDWARDS, A., Voss, H., RICE, P., CIVITELLO, A., STJZGEMANN, J., SCHWAGER, C., ZIMMERMANN, J., ERFLE, H., CASKEY, C. T., AND ANSORGE, W. (1990). Automated DNA sequencing of the human HPRT locus. Genomics 6: 593-608. FEINBERG, A. P., AND VOGELSTEIN, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13. GITSCHIER, J., DRAYNA, D., TIJDDENHAM, E. G. D., WHITE, R. L., AND LAWN, R. M. (1985). Genetic mapping and diagnosis of haemophilia A achieved through a BclI polymorphism in the factor VIII gene. Nature (London) 314: 738-740.
ACKNOWLEDGMENTS We are indebted to John Crolla for the karyotype analysis and in situ hybridization. We also thank Professor Francesco Giannelli for discussion and support of this work, Dr. M. Francavilla for help in construction of the IFGT hybrids, and Dr. Ian Dunham for critical review of the manuscript. This work was supported by the Generation Trust and Spastics Society.
USING
13.
14.
K. E., PEARSON, P. L., HARPER, P. S., MURRAY, O’BRIEN, T., SARFARAZI, M., ANLI WILLIAMSON, R. Linkage analysis of two cloned DNA sequences flankDuchenne muscular dystrophy locus on the short arm human X chromosome. Nucleic Acids Res. 8: 2303-
15.
GOODFELLOW, P. N., BANTING, G., TROWSDALE, J., CHAMBERS, S., AND SOLOMON, E. (1982). Introduction of a human X-6 translocation chromosome into a mouse teratocarcinoma: Investigation of control of HLA-A, B, C expression. Proc. Natl. Acad. Sci. USA 79: 1190-1194.
16.
GOODFELLOW, P., DARLING, S., AND WOLFE, J. (1985). human Y chromosome. J. Med. Gerwt. 22: 329-344.
17.
GOODFELLOW, P. N., AND PRITCHARD, C. A. (1988). Chromosome fragmentation by chromosome mediated gene transfer. Cancer Surv. 7: 251-265.
18.
Goss, genes 684.
19.
Goss, S. J., AND HARRIS, H. (1977). of cell fusion. J. Cell. Sci. 25: 17-37.
20.
GRAW, S., DAVIDSON, J., GUSELLA, J., WATKINS, P., TANZI, R., NEVE, R., AND PATERSON, D. (1988). Irradiation-reduced human chromosome 21 hybrids. Somat. Cell Mol. Genet. 14: 233-242. GREEN, P. M., BENTLEY, D. R., MIBASHAN, R. S., NILSSON, I. M., AND GIANNELLI, F. (1989). Molecular pathology of haemophilia B. EMBO J. 8: 1067-1072. GREEN, E. D., AND OLSON, M. V. (199Oa). Chromosomal region of the cystic fibrosis gene in yeast artificial chromosomes: A model for human genome mapping. Science 250: 94-98.
21.
22.
S. J., AND HARRIS, H. (1975). New method in human chromosomes. Nature bwzdon) Gene
transfer
The
for mapping 265: 680by means
826
COLE
ET
AL.
23. GREEN, E. D., AND OLSON,
24.
M. V. (1990b). Systematic screening of yeast artificial-chromosome libraries using the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 87: 1213-1217.
40.
GUSELLA, J. F., KEYS, C., VARSANYI-BREINER, A., KAO, F-T., JONES, C., PUCK, T. T., AND HOUSMAN, D. (1980). Isolation and localization of DNA segments from specific human chromosomes. Proc. Natl. Acad. Sci. USA 77: 2829-2833.
41.
25. G&sow, terization reaction.
D., AND CLACKSON, T. (1989). Direct clone from plaques and colonies by the polymerase Nucleic Acids Res. 17: 4000.
characchain
42.
26. HANAUER,
27.
A., MANDEL, J. L., AND MA?TEI, M. G. (1985). X linked and autosomal sequences corresponding to glutamate dehydrogenase (GLUD) and to an anonymous cDNA. Cytogenet. Cell. Genet. 40: 647. JELINEK, W. R., AND HAYNES, S. R. (1983). The mammalian Alu family of dispersed repeats. Cold Spring Harbor Symp. Quunt. Biul. 47: 1123-1130.
43.
28. JOLLY, D. J., ESTY, A. C., BERNARD,
H. U., AND FRIEDMANN, T. (1982). Isolation of a genomic clone partially encoding human hypoxanthine phosphorihosyltransferase. Proc. Natl. Acad. Sci. USA 79: 5038-5041.
29.
KARIYA, Y., KATO, K., HAYASHIZAKI, Y., HIMENO, S., TARUI, S., AND MATSUBARA, K. (1987). Revision of consensus sequence of human Alu repeats-a review. Gene 63: l-10.
30.
KEITH, D. H., SINGER-SAM, J., AND RIGGS, A. (1986). Active X chromosome DNA is unmethylated at eight CCGG sites clustered in a guanine-plus-cytosine-rich island at the 5’ end of the gene for phosphoglycerate kinase. Mol. Cell Biol. 6:
PONTECORVO, G. (1975). Production cell hybrids by means of polyethylene mat. Cell Genet. 1: 397-400.
45.
RILEY, J., BUTLER, R., OGILVJE, D., FIN-, R., JENNER, D., POWELL, S., ANAND, R., SMITH, J. C., AND m, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: 2887-2890.
46.
SAIKI, R. K., GELFAND, D. H., STOFFEL, S., SCHARF, S. J., HIGUCHI, R., HORN, G. T., MULLIS, K. B., AND ERLICH, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491.
47.
THOMPSON, M. GAN, C., Oss, I., of polymorphisms the breakpoint linked muscular
31. KOENIG,
4109. 32.
KORENBERG, J. R., AND RYKOWSKI, M. C. (1988). Human nome organization: Alu, Lines, and the molecular structure metaphase chromosome bands. Cell 53: 391-400.
geof
33.
LEDBETTER, S. A., NELSON, D. L., WARREN, S. T., AND LEDBETTER, D. H. (1990). Rapid isolation of DNA probes within specific chromosome regions by interspersed repetitive sequence polymerase chain reaction. Genomics 6: 475-481.
34.
L~DECKE, H-J., SENGER, G., CLAUSSEN, U., AND HORSTHEMKE, B. (1989). Cloning defined regions of the human genome by microdissection of banded chromosomes and enzymatic amplification. Nature (London) 338: 348-350.
35. MANIATIS,
T., FRITSCH, E. F., AND SAMBROOK, J. (1982). “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
37. MOYZIS,
38. 39.
R. K., TORNEY, D. C., MEYNE, J., BUCKINGHAM, J. M., WV, J-R., BURKS, C., SIROTKIN, K. M., AND GOAD, W. B. (1989). The distribution of interspersed repetitive DNA sequences in the human genome. Gerwmics 4: 273-289. NAEJHOLZ, M., MIGGIANO, V., AND BODMER, W. (1969). Genetic analysis with human-mouse somatic cell hybrids. Nature (London) 223: 358-363.
NELSON, D. L., LEDBETTER, S. A., CORBO, L., VICTORIA, M. F., RAMIREZ-SOLIS, R., WEBSTER, T. D., LEDBE=, D. H., AND CASKEY, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human-specific se-
of mammalian somatic glycol treatment. So-
W., RAY, P. N., BELFALL, B., DUFF, C., LoAND WORTON, R. G. (1986). Linkage analysis within the DNA fragment XJ cloned from of an X21 translocation associated with X dystrophy. J. Med. Gem%. 23: 548-555.
48. WAPENAAR,
M. C., KIEVITS, T., HART, K. A., ABBS, S., BLONDEN, L. A. J., DEN DUNNEN, J. T., GROOTSCHOLTEN, P. M., BAKKER, E., VERELLEN-DUMOULIN, CH., BOBROW, M., VAN OMMEN, G. J. B., AND PEARSON, P. L. (1988). A deletion hot spot in the Duchenne muscular dystrophy gene. Genomics 2:
101-108. 49.
WESTERVELD, A., VISSER, R. P. L. S., MEERA KHAN, P., AND BOOTSMA, D. (1971). Loss of human genetic markers in manChinese hamster somatic cell hybrids. Nature New Biol. 234:
20-24. 50. WIEAKER,
P., DAVIES, K. E., COOKE, H. J., PEARSON, P. L., WILLIAMSON, R., BHATTACHARYA, S., ZIMMER, J., AND ROPERS, H-H. (1984). Toward a complete linkage map of the human X chromosome: Regional assignment of 16 cloned single-copy DNA sequences employing a panel of somatic cell hybrids. Am. J. Hum. Genet. 36: 265-276.
36. MONACO,
A. P., BERTELSON, C. J., COLLE’ITI-FEENER, C., AND KUNKEL, L. M. (1987). Localization and cloning of Xp21 deletion breakpoints involved in muscular dystrophy. Hum. Genet. 75: 221-227.
PAGE, D. C., HARPER, M. E., LOVE, J., AND BOTSTEIN, D. (1984). Occurrence of a transposition from the X-chromosome long arm to the Y-chromosome short arm during human evolution. Nature (London) 311: 119-123. PERSICO, M. G., VIGLIE’ITO, G., MARTINI, G., TONIOLO, D., PAONESSA, G., MOSCATELLI, C., DONO, R., VULLIAMY, T., LUZZA~O, L., AND D’UR~O, M. (1986). Isolation of human glucose-6-phosphate dehydrogenase (GGPD) cDNA clones: Primary structure of protein and unusual 5’ non-coding region. Nucleic Acids Res. 14: 2511-2522.
44.
4122-4125. M., CAMERINO, G., HEILIG, R., AND MANDEL, J.-L. (1984). A DNA fragment from the human X chromosome short arm which detects a partially homologous sequence on the Y chromosome long arm. Nucleic Acids Res. 12: 4097-
quences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86: 6686-6690. NUSSBAUM, R. L., AIRHART, S. D., AND LEDBETTER, D. H. (1986). A rodent-human hybrid containing Xq24-Xqter translocated to a hamster chromosome expresses the Xq27 folate-sensitive fragile site. Am. J. Med. Genet. 23: 457-466. OLSON, M., HOOD, L., CANTOR, C., AND BOTSTEIN, D. (1989). A common language for physical mapping of the human genome. Science 246: 1434-1435.
51. WINSHIP,
P. R. (1989). quencing PCR amplified Nucleic Acids Res. 17:
An improved method for directly sematerial using dimethyl sulphoxide.
1266.
52. WOLFE,J., DARLING,
S. M., ERICKSON, R. P., CRAIG, I. W., BUCKLE, V. J., RIGBY, P. W. J., WILLARD, H. F., AND GOODFELLOW, P. N. (1985). Isolation and characterization of an alphoid centromeric repeat family from the human Y chromosome. J. Mol. Biol. 182: 447-485.
53.
WROGEMANN, K., ARVEILER, B., OBERLJ?., I., MULLIGAN, L. M., HOLDEN, J. A., FOFISTER-GIBSON, C. J., AND WHITE, B. N. (1986). A Taq RFLP in Xq26-Xqter detected by pX45h (HGM8 No. DXSlOOh). Nucleic Acids Res. 14: 5572.
10,816-826
Generation
(1991)
of Novel Sequence Tagged Sites. (STSs) from Chromosomal Regions Using A/u-PCR C. G. COLE,* P. N. GoomLLow,t
Discrete
M. BOBROW,* AND D. R. BENTLEY*
*Paediatric Research Unit, Division of Medical and Molecular Genetics, United Medical and Dental Schools of Guy’s and St. Thomas’ Hospitals, 8th Floor, Guy’s Tower, London Bridge, London SE 1 9RT, United Kingdom; and tlmperial Cancer Research Fund, P.O. Box 123, Lincoln’s Inn Fields, London WC2A 3PX, United Kingdom Received
January
somal regions. A number of methods for the generation and transfer of chromosome fragments have been developed, for instance, chromosome-mediated gene transfer (CMGT) (reviewed in Goodfellow and Pritchard, 1988) or irradiation-fusion gene transfer (IFGT). In a modification of the IFGT experiments of Goss and Harris (1975,1977), irradiated hybrids containing the chromosome or region of interest are fused with a rodent parent. The resulting fusion hybrids retain one or more discrete human fragments (Graw et al., 1988; Cox et al., 1989; Benham et aZ., 1989). Markers generated from these hybrids can be localized to one or the other of the distinct regions using suitable mapping panels. Previous strategies for isolating human DNA from hybrids have relied on preparing lambda or cosmid libraries from DNA of the hybrid and selecting human clones from the rodent background by hybridization to repetitive sequence probes (Gusella et al., 1980). A quicker and less labor-intensive method, which generates a subset of human sequences from the rodent background without cloning, is interspersed repetitive sequence PCR (IRS-PCR) (Ledbetter et aZ., 1990), for instance, Alu-PCR (Nelson et aZ., 1989). By designing PCR primers that amplify out from the ends of Alu-repeat units (Jelinek and Haynes, 1983), it becomes possible selectively to amplify human DNA only. The resulting fragments are a potential source of region-specific sequence data and therefore STSs. In this study we have undertaken to test the feasibility of generating STSs from defined chromosomal regions using Alu-PCR. We have constructed a series of irradiation-fusion hybrids selected for the retention of human chromosomal DNA in the region of the hypoxanthine phosphoribosyltransferase (HPRT) gene on the X chromosome. The Alu-PCR technique was optimized to allow efficient amplification from both ends of the repeat unit individually or in a combined reaction, and used to amplify a large number of hu-
Human DNA segments from discrete chromosomal regions were generated by utilizing Ah-element-based polymerase chain reaction (ALPCR) of an irradiation-fusion hybrid containing approximately 10 to 15 Mb of human DNA. Following cloning into a plasmid vector, a subset of the clones was used to generate sequence tagged sites (STSs) de nouo. By means of a panel of hybrids containing portions of the human X chromosome, the STSs were shown to localize to two chromosomal regions, Xq24-Xq26 and Xcen-Xq13, reflecting the presence in the irradiation-fusion hybrid of two human chromosome fragments. These results demonstrate that high densities of STSs can be rapidly and efficiently generated from defined regions of the human genome using Ah-PCR. o 1991 Academic PRXB, Inc.
INTRODUCTION
Construction of physical maps from defined regions of complex genomes requires large numbers of evenly spaced DNA markers from the given region. Sequence tagged sites (STSs) (Olson et al., 1989) are short tracts of operationally unique DNA sequence that can be detected via PCR (Saiki et aZ., 1988) and can act as basic landmarks on a physical map. The “STS content mapping” strategy has been used successfully to generate a l&Mb yeast artificial chromosome (YAC) contig of the cystic fibrosis transmembrane receptor (CFTR) gene region (Green and Olson, 1990a) and a 3-Mb contig spanning the dystrophin gene (Coffey et aZ., manuscript in preparation). However, all STSs that have been used in mapping projects to date have been derived from well-characterized DNA probes or sequences. For mapping less well-characterized regions of the genome using this approach, it will be necessary to generate high densities of novel STSs from undefined DNA fragments that are specific to a selected chromosomal region. Somatic cell hybrids can be used as sources of human fragments that are specific for given chromo088%x43/91 Copyright All rights
$3.00 0 1991 by Academic Press, Inc. of reproduction in any form reserved.
30, 1991
816
NOVEL
REGION-SPECIFIC
man-specific sequences flanked by Alu repeats in any of the three possible orientations. The amplification products from one hybrid, containing a small amount of human DNA, were cloned and the ends sequenced to generate a set of region-specific novel STSs. MATERIALS
AND
METHODS
Cell Lines Wg3-h is an HPRT-deficient hamster cell line (Westerveld et al., 1971). C12D, a human-hamster hybrid, contains a single human X chromosome (Goss and Harris, 1977). 4BA1, a naturally occurring variant of the established human-mouse hybrid Horl9X (Goodfellow et al., 1985), retains Xcen-Xqter only (F. Giannelli and J. Crolla, personal communication). MCP-6 is a human-mouse hybrid retaining Xq13Xqter (Goodfellow et al., 1982). X3000-11.1, a derivative of human-hamster hybrid 4.12, retains Xq24Xqter only (Nussbaum et al., 1986). PIP, a humanmouse hybrid, retains Xpter-Xpl14 and distal Xq26-Xqter (Boyd, f987). HorlSIlR8B is a humanmouse hybrid retaining Xpter-Xq22 (Boyd, 1987), and IRE3 is a mouse cell line (Nabholz et al., 1969). Irradiation
and Fusion
and Southern
Blot Analysis
Cells were simultaneously cultured for use in both in situ hybridization and DNA preparation for Southern blot analysis. GTG-bandedchromosomes were hybridized to biotinylated total human DNA or the alphoid-centromeric repeat-derived probe pSV2X5 (for method see Benham et al., 1989). For Southern blot analysis 5-10 pugof DNA was digested with the appropriate restriction endonuclease, electrophoresed through 0.8% agarose gels, and transferred to a nylon membrane (Hybond N, Amersham). DNA probes were labeled by random hexanucleotide priming (Feinberg and Vogelstein, 1983) and hybridized and washed to 0.2-0.5X SSC, 65”C, using standard procedures (Maniatis et al., 1982). Amplification
USING
817
Ah-PCR
25-75 ng DNA was amplified in a 25-111 reaction which contained 1.3 PM each oligonucleotide primers (2.6 PM total for single primer reactions), 67 mM Tris-Cl, pH 8.8,16.6 mM (NH&SO,, 6.7 mM MgCl,, 0.5 mM deoxyribonucleoside triphosphates (dATP, dCTP, dGTP, dTTP), 1.5 units Amplitaq (Cetus, Inc.). Then, 10 mM 2-mercaptoethanol and 170 fig/ml bovine serum albumin (Sigma, A-4628) were added freshly when each set of reactions was assembled. All reactions were preceded by an initial denaturing step of 5 min at 94°C and followed by a final 5-min extension step at the appropriate temperature. For AluPCR, amplifications with primers ALE1 alone or ALE1 plus ALE34 (ALE34 sequence from P. de Jong, PDJ34, personal communication) were cycled using the Techne PHCl only, with 30 cycles of 1 min at 93”C, followed by between 3 and 7 min at 76°C. Amplifications with ALE34 or ALE3 were cycled on either the Techne PHCl or PHCB, using 30 cycles of 1 min at 93’C and 3 min at 75°C (ALE34) or 73°C (ALE3). PCR reactions not involving AZu primers were cycled on the Techne PHCB, using 30 cycles of 1 min at 93”C, 1 min annealing (see Table 1 for temperatures), and 2 min (except 3/22, 1.75 min) at 72’C. Use of ALI Internal Alu Primers DNA Content of Hybrids
Gene Transfer
The X-only human-hamster hybrid C12D was irradiated with 6000 rads and fused with its HPRT-deficient rodent parent cell line, Wg3-h, using a modification of the method of Pontecorvo (1975; Benham et al., 1989). The resulting IFGT hybrids were selected in HAT and grown in DMEM (Flow laboratories) supplemented with 10% fetal calf serum, penicillin, and streptomycin as described in Benham et al. (1989). In Situ Hybridization
STSs
of Genomic DNA
Primer sequences and annealing temperatures are shown in Table 1. PCR was carried out as follows:
to Estimate
Human
Amplification of a 236-bp segment of the human Alu repeat element using ALI primers (Table 1) was performed on a Techne PHC2 by 21 cycles of 1 min at 93°C 0.8 min at 65”C, and 1.75 min at 72°C. Doubling dilutions of the following hybrid DNAs were amplified: C12D, X3000-11.1, F2, Wg3-h. Starting concentrations for the doubling dilutions, measured on a DNA fluorometer (Hoefer Scientific Instruments, TKO loo), were 40, 160, 800, and 800 ng, respectively. Use of Alu-PCR
Products
as Hybridization
Probes
AZu PCR products were electrophoresed on 3% NuSieve agarose (FMC), 1X TBE (Maniatis et al., 1982), 20 x 20-cm gels, and the relevant fragments were cut out and rerun on a second gel. A toothpick was touched just into the agarose at the position of the relevant fragment and stirred in a 25~1 PCR reaction containing the same primer used to generate the fragment. Following PCR (20 cycles), the products were purified using GeneClean (Bio lOl), resuspended in TE (10 mM Tris-Cl, 0.1 mM EDTA, pH 7.8), and used as hybridization probes. Approximately 10 ng of fragments of 1.3-1.6 kb was labeled using random oligonucleotide priming (Feinberg and Vogelstein, 1983) and prereassociated with sheared total human placental DNA at 65°C prior to hybridization in a sodium phosphate-based buffer at 68°C for 18 h (Blon-
See text
See text 65
59 68 65 65 65 65 68 68 65 65 56.5 65 66 68 64 65 68 65
ALE3”
ALE1 ALI”
PSP65 l/l
’ Degeneracies * Approximate
l/17 l/29 l/44 l/67 3/2 3/10 3/14 3/15 3/19 3/21 3/22 3131 3/40 3/50
Primer
Annealing 1 (5’ +
3’)
Temperatures,
TGAGCCGAGATCGCGCCACTGCACTCCAGCCTGGG TAT TATA T CCACTGCACTCCAGCCTGGG T GCCTCCCAAAGTGCTGGGATTACAG TGGAGTGCAGTGGCGCGATCTCGG A TATA ATA CATACGATTTAGGTGACAC GTCAGATCGAATTATGACCCATAC GTCTGCCCTATAGCCTCCCTAC ACCATTATAGAGAAGTGACAC CTCGGTGCCTAACTGAGGCAC GGGCATGGAAGTCTCTGGCTGAC TCCTTAGGAATTCTGGGCTCC CTACACATATGGGCTGATGGAC CTTAGCATTTGAGAAACTAC GACCTGGGTTTATGCCTCAAC GGCTAACTGCGTATATCCTC GTCAACCTCTATCTGTTAAAG GCCCATGAATTGAAATGAATGCC TGGAACTCTTGTGAACTGC GTAAACATACACAAGAAGATAC CTGCTTCAGACAACTGAAGCAGG TTGTGGAGACAGAATCTCACTG GTTGAAGAATTCCCCTTCTATTTG
Sequences,
indicated on second line. size based on gel electrophoresis.
See text
ALE34”
w l/6
Temp 03
Primer
Primer
TABLE and Product
1 Sizes
OR ALE1
Primer
2 (5’ *
and Sequencing
ALE1 OR ALE34 TCACGCCTGTAATCCCAGCACTTT TA GCGGATAACAATTTCACAC ACGCCCAGTACCTCAGAATGTGAC TCTGCTAGCTCCTTACGGTCAG GGGTCACATAGCTGGTAAATGGC TTGCATTGGTGGTCTTCTCTGGG ATCTTCTTGAAGGTGCAGATTAAAG GTCATTCTCCTAGAAAATTCAGC CCTGGATTAACTCACAGACTCC CAGAATCTCACTGTTTTGTCCAAGC TCACCTTTCTAGGACAATC TAAATCACTTTCAAAATGTAG GGCTCAAGGAATCCACCCCTC CAGTGTTTCAGTCTTCACCAGGAC CACCAAGTATCTGCTTGAGTCCC GAGAGAGGGTGCTCTCCAG GAAGTGGCTTCAGACACATTCAGG CATTTGAGAAACTACACAGACTCC GAGCATTTGAGAAGCTTTAACACC
ALE3
ALE34
for PCR 3’)
F 2906 93
79
158 222 100 127 127 171 222 100b 166
8 & M 4
98 116’ 148* 93 300*
236
-
-
Size (bp)
NOVEL
den et al., SSC, 65°C.
1989).
Cloning of Alu-PCR
Filters
were
REGION-SPECIFIC
washed
to 0.5X
Products
PCR products from ALEl-amplified and ALE3amplified F2 were extracted with chloroform and fractionated on a Sephacryl S-300 (Pharmacia) column. Appropriate fractions were pooled and the DNA (approximately 500 ng at 10 ng/pl) was phosphorylated using T4 polynucleotide kinase. On completion, the reaction was extracted sequentially with phenol, chloroform, and ether, and the DNA was separated from nucleotides by fractionation on a spun Sephadex G50 (medium, Pharmacia) column. The DNA was then ligated overnight to HincII-digested, phosphatased pSP65 vector and transformed into DH5a Escherichia coli competent cells. Amplification and Sequencing Products to Generate STSs
of Cloned Alu-PCR
Colonies were toothpicked into 500 ~1 TE and boiled for 10 min, and 5 ~1 was used directly in PCR (Gussow and Clackson, 1989). For initial characterization of clones, colonies were amplified with the appropriate AZu primer (reaction conditions as above), and 5 ~1 of the PCR product was digested with BstNI, Hinf’I, or DdeI. For subsequent analysis, selected clones were amplified by PCR with vector-specific primers (for conditions see above and Table 1, PSP65 primers). The products were purified using GeneClean (Bio lOl), and 50 to 100 ng DNA was sequenced directly (Green et aZ., 1989) from each end using the PSP65 primers with the inclusion of DMSO in the sequencing reactions (Winship, 1989). Primer pairs generated from this sequence data (Table 1,1/l to 3/50) were tested using 50-75 ng genomic DNA per 25-~1 reaction. Amplification conditions were as above, with annealing temperatures as detailed in Table 1. Five microliters of each reaction was analyzed by electrophoresis on 3% NuSieve agarose or 2.5% agarose gels. RESULTS
Construction Hybrids
and Analysis
of Irradiation-Fusion
IFGT hybrids retaining the HPRT gene were generated by fusion of the irradiated hybrid C12D, which contained only the human X chromosome, with the hamster cell line Wg3-h, followed by selection in HAT medium. DNA was extracted from eight hybrids (Bl-F2) and analyzed by Southern blotting using 21 X-linked DNA markers (see Table 2). All hybrids were positive for the HPRT probe pB1.7. The number
STSs
USING
Ah-PCR
819
of apparently contiguous loci transferred with HPRT ranged from none of those tested to all of those present in a region spanning Xq24-27. In addition, three lines were positive at Xp loci and a single line was positive at all loci tested. In all but one case alphoid centromeric sequences were retained as detected by Southern blot hybridization. In situ hybridization, using total human DNA or a human alphoid repeat probe, showed that many of the lines represented two or more cell populations and in some cases two inserts were retained within a single cell, accounting for the apparent discontinuity of human sequences. A single hybrid (F2) was devoid of human alphoid centromeric sequences, as assessed using Southern blotting and in situ hybridization, although PCR with a primer specific for X-chromosome alphoid sequences (Ian Dunham, personal communication) indicated that a small number of alphoid sequences may have been retained. This hybrid was positive only for the HPRT probe pB1.7. From the results of in situ hybridization it appeared that this cell line carried two small human fragments, each at or near one end of two distinct hamster chromosomes. To assess the total human DNA content of F2, PCR was performed on F2 and on hybrids retaining known segments of the X chromosome (Fig. 1) using AL1 primers, which recognize highly conserved regions of the human Alu repeat and which direct amplification of a 236-bp segment of the human Alu element only. The amount of product obtained by amplification of 40 ng X-only hybrid C12D was equivalent to the amount obtained by amplification of 160 ng X300011.1 or 800 ng F2 (see Fig. 1). Karyotype analysis of F2 indicated that it was virtually tetraploid with respect to hamster chromosomal material, but haploid with respect to the human fragments. This affects the relative number of human fragments/unit mass of hybrid DNA. After this was taken into account, F2 was judged to contain 10 to 15 Mb of human DNA. In common with all methods that assess the human content of hybrids on the basis of analysis of repeat elements, this estimation will be affected by the nonrandom distribution of AZu elements (Korenberg and Rykowsky, 1988; Moyzis et al., 1989; Chen and Manuelidis, 1989). However, this PCR-based method, which is highly sensitive and not affected by rodent Alu-like sequences, can rapidly and consistently detect human sequences in hybrids retaining only small amounts of human DNA (Cole et al., manuscript in preparation).
Alu-PCR To maximize the number of Alu-PCR products obtained from a given hybrid, Alu-PCR primers that di-
820
COLE
ET
TABLE Human
DNA
Markers
Present
AL.
2 in Irradiation-Fusion
Hybrids Hybrid
Locus
Ref.
DXYS14 DXS31 DXS41 DXS269 DXS270 DXS164 DXS206 DXS7 DXS146 DXZl PGKl DXYSl DXS3 DXSll DXSlOO HPRT DXS144 F9 DXS15 GGPD F8C
(8) (30)
(2) (48) (36)
(36) (47) (11) (1)
(52) (30)
(42) (2) (2) (53)
(28) (26) b
(50) (43) (14)
Note. +, strongly positive; D Although no hybridization * Probe 6-11 (J. Montandon,
Chromosomal location Xp22.3 Xp22.3 xp22.1 xp21.2 xp21.2 xp21.2 xp21.2 xp11.3 xp11.2 XCen xq13 xq21.31 xq21.3 Xq24-26 Xq25-26 Xq26 Xq26 xq27.1 Xq28 Xq28 Xq28
Bl
B2
Cl
c2
Dl
El
E2
F2
-
+ + + + + + + + + + + + + + + + + + + + +
-
+ + + -
-
+/+/+ -
-
-
-
+ + -
+ -
-a -
+ -
+ + -
+ -
+ + + + + + + + + +/+/+ + -
+ + + + + -
+ + + + + + -
+ + + + + -
+/-, weakly positive; -, negative. signal visible, see Results. personal communication).
rected amplification away from either end of the Alu repeat and that could be combined in a single reaction were used. The right-hand AZu-PCR primer, ALE34, directs amplification from a human-specific site 23 bases left of the poly(A) tail (right- and left-hand orientations are as described in Kariya et al., 1987). ALE3 is a truncated version of ALE34 (Table 1). The left-hand primer, ALEl, anneals to a conserved re-
c
236
bp
FIG. 1. Estimation of the human DNA content of hybrid F2 using “internal” Alu-PCR primers, ALL Lanes l-4 show the products of four reactions from doubling dilutions of DNA (starting concentrations are given in parentheses: C12D (40 ng), X3000-11.1 (160 ng), F2 (800 ng), R = Wg3-h (800 ng, only the highest and lowest shown), M = 1-kb ladder. The amount of product obtained by amplification of 40 ng C12D is equivalent to the amount obtained by amplification of 160 ng of X3000-11.1 or 800 ng of F2 (compare lanes 1 from each set). A similar result is observed in the corresponding doubling dilutions. The same results were obtained when all PCR assays were made up to 800 ng by the addition of hamster (Wg3-h) DNA.
gion of the human Ah consensus (Kariya et al., 1987) and contains a mismatch with the hamster Ah equivalent (Jelinek and Haynes, 1983) at its 3’ end. Amplification of a panel of hybrid and total human genomic DNAs with ALE1 (Fig. 2a) or ALE34 (Fig. 2b) produced an increasing number of bands as the human DNA content increased. Fragments corresponding in size to those amplified from hybrid F2 were present in El (Fig. 2a). The additional fragments in El are presumed to be derived from the additional proximal Xq region present only in El or additional sequences at or near the Xq26 region (see Table 2). Amplification of Cl also gives a pattern resembling that of El. The patterns of DNA fragments amplified in hybrids Dl and E2 (Fig. 2a) were similar and included the majority of bands present in F2 and El. The Alu-PCR products of the remaining hybrids gave more complex related patterns, with that of B2 clearly resembling that of C12D. This was consistent with the presence in B2 of all X-chromosome markers tested. It is evident from these results that specific regions give characteristic patterns of bands. These results confirm the possibility of using Alu-PCR as a method for fingerprinting hybrids or cloned material (Ledbetter et al., 1990). One hybrid, F2, was selected as a source of material suitable for generating region-specific hybridization
NOVEL
REGION-SPECIFIC
STSs
USING
821
Atu-PCR
bD
1600 1000
516 394 344 29s 220 200
CL2D abc
o
bc
Wg3-h ___
M
bD
abc
1600 1000
516 394 344 298
220 200
FIG. 2. Alu-PCR using the left-hand primer ALE1 (a) or right-hand primer ALE34 (b) on IFGT hybrids (B2-F2), total human male (H), parental X-only hybrid C12D (X), Xq-only murine hybrid 4BAl (Q), hamster parent Wg3-h (W3), mouse IRE3 (IR), TE control (C), and 1-kb ladder (M). Samples have been arranged in descending order of human DNA content as judged from Southern blot analysis. (c) A comparison of primer ALE1 alone (lanes marked a), ALE34 alone (lanes marked c), and ALE1 plus ALE34 combined (lanes marked b) on IFGT hybrid F2, the X-only hybrid C12D, and hamster Wg3-h. Gels are ethidium bromide-stained minigels, 2.5% agarose (a, b) and Nusieve agarose (c).
probes and ST% by Alu-PCR. Amplification of hybrid F2 with either primer ALE1 or ALE34 produced a minimum of 18 and 25 fragments, respectively, when electrophoresed and visualized on ethidium bromide-stained minigels (Fig. 2c, F2 lanes a and c; see also Figs. 2a and 2b). When the primers were combined, at least 20 additional products were present (Fig. 2c, F2 lane b). Some of the weaker single-primer amplification products are not visible in the combined reaction, presumably as a result of competition with the greater number of strongly amplifying products. For comparison with F2, amplification of the X-only hybrid C12D in the same experiment is also shown, with ALE1 (Fig. 2c, CLBD lane a) and ALE34 (C12D lane c) alone or with both primers combined (C12D lane b).
Evaluation
of Ah-PCR
Products
Using Hybridization
Alu-PCR products from hybrids may be used successfully as hybridization probes in Southern blot analysis (Ledbetter et al., 1990; Cotter et al., 1990; Brooks-Wilson et al., 1990). The localizations of three Alu-PCR products from F2 were determined by hybridization as follows. The Alu-PCR products were gel-purified as described under Materials and Methods and used as probes in Southern blot analysis of a hybrid panel. Probes 1 and 2 detected a 2- and a 6-kb Hind111 fragment, respectively, in hybrid 4BA1, but were negative with the hybrids PIP and HorlSllR8B (Figs. 3a and 3b), and thus could be localized to Xq22-Xq26. Probe 3 detected a 4.6-kb fragment in 4BAl and HorlSllR8B but was negative in PIP and
822
COLE
a. Cl
C2
Dl
El
Dl
El
E2
F2
X
:,
,”
FH
W3
F H
M H
F H
W3lR
IR
Q
P
R
Cl
P
R
kb
b. Cl
C2
E2
F2
X
-
kb 23
-
9.4
-
6.7
-
4.4
-
2.3
-
2.0
FIG. 3. Hybridization of two gel-purified Alu-PCR products from IFGT hybrid F2, to a panel of HindHI-cut DNAs: Cl-F2, irradiation-fusion hybrids; X, C12D; H (F), total human (female); H (M), total human (male); W3, Wg3-h (hamster); IR, IRE3 (mouse); Q, 4BAl; P, PIP; R, HorlSllR3B; Probe 1 (a) andprobe 2 (b) recognize a 2- and a 6-kb fragment, respectively, both of which map to Xq22-Xq26. The 3.5kb fragment cross-hybridizing with probe 2 in total human (lanes marked H) but not the X-only hybrid (lane X) is presumed to be an autosomal sequence.
therefore mapped to Xcen-Xq22. These results are consistent with the presence within F2 of two distinct human chromosome fragments as suggested by in situ results.
Generation
of Sequence Tagged Sites
Alu-PCR was performed on F2 using primers ALE3 and ALE1 individually. Following cloning of the ALE3/F2 and ALEl/FB products as described under Materials and Methods, amplified inserts of all positive colonies were analyzed with one or more of the restriction enzymes BstNI, Hinf I, and DdeI. From these results, many clones whose inserts co-migrated were found to represent different Alu-PCR fragments by restriction analysis, Hence, a total of 50 ALE3/F2 clones that were divided into 13 groups on the basis of insert size alone were shown to represent twice as many distinct clones following restriction analysis. Twenty-six of 50 clones analyzed from the ALE3/F2
ET
AL.
experiment, and 10 of 15 ALEl/FB clones analyzed, contained different Alu-PCR fragments. Twenty ALE3/F2 and 10 ALEl/F2 clones were selected to generate STSs. These were reamplified with vector-specific primers, the resulting PCR products were then sequenced, and the data obtained were used to generate 15 and 9 pairs of primers, respectively. Primer pairs were not generated from the remaining 6 sequencing reactions, as the result of either small insert size (one case) or an internal Ah repeat (2 cases) or because an extended poly(dA) tract at each end of ALE3/F2 clones prevented sequence data from being obtained (three cases). The 24 primer pairs obtained were tested against total human (male) DNA, an independent panel of hybrids containing various regions of the X chromosome, and hybrid F2 (Table 3 and Fig. 4). Seventeen primer pairs gave products of the expected size in the hybrid F2 and only in the presence of human chromosomal material (see Table 3). This therefore defines 17 novel STSs, which corresponds to a conversion rate from DNA sequence to STS of 70%. Eleven STSs mapped within Xq24-Xq26 (examples in Figs. 4a and 4b), while six mapped within Xcen-Xq13 (examples in Figs. 4c and 4d), consistent with Alu-PCR amplification of human DNA from two regions of the genome corresponding to the two human chromosomal fragments present in F2. These results were in agreement with the mapping data generated using gel-purified Alu-PCR amplification products as hybridization probes, two of which mapped to Xq22-Xq26 while one mapped to Xcen-Xq13. One STS (3/21, Fig. 4~) amplified equally a hamster-specific band and the expected, human-specific product and may therefore represent a conserved sequence. The majority (11) of these STSs gave a single amplification product of the expected size in human DNA. Four, however, showed low levels of additional amplification product(s), and two cases amplified comparable levels of such product(s). Provided that the STS was used in a PCRbased gel assay, these extra products did not interfere with the function of the STS to identify a unique product within a given DNA source. Of the 24 primer pairs synthesized, 7 failed to produce STSs. Two, both originating from small inserts, failed to amplify the hybrid F2,4BAl, or the X-only parent of F2, C12D, but did produce a product of the expected size in total human male DNA. These are assumed to be the result of contamination with total human Alu-PCR products during cloning. One ALEl/F2-derived pair yielded the expected product only in the presence of hamster DNA and was therefore assumed to be derived from a hamster Alu-equivalent amplified fragment. In two cases the expected products were so short (~60 bp) that they were obscured by primer dimers in the gel assay. One pair
NOVEL
I
+
I
+
I
t
I
+
I
+
I
+
+
I
+
I
+
I
+
I
+
I
+
I
+
I
+
I
+
I
+
I
+
I
REGION-SPECIFIC
STSs
USING
823
Ah-PCR
resulted in multiple bands in both species, failed to amplify any sample tested.
and one
DISCUSSION The value of Alu-PCR for generating markers, and specifically STSs, for mapping projects depends first on the number and distribution of the Alu-PCR products and second on efficient conversion of these products to STSs. Maximum amplification should be obtained by using primers directed away from both ends of the Alu repeats, since, assuming that Alus are randomly distributed and orientated, such a combined reaction should result in twice the total number of products achieved from the combined single-primer amplifications. If, as has been reported within the HPRT gene (Edwards et al., 1990) and in analysis of GenBank sequences (Moyzis et al., 1989), Ah repeats are not randomly orientated within a given region but are found in blocks of the same orientation, this would further increase the proportion of products arising from the combined reaction and hence both left and right Alu-PCR primers should be used to maximize representation. We have obtained a large number of Alu-PCR products using primers ALE1 and ALE34, both separately and in combination. Amplification of the estimated lo-15 Mb of human DNA present in F2 generated a minimum of 18 and 25 fragments using ALE1 or ALE34 alone. When both primers were used in the same reaction, at least a further 20 novel products were visible. However, this is likely to be an underrepresentation of the true number because of the limitations in gel resolution of the large number of products (Fig. 2c, lane 2). In addition, restriction analysis of amplified inserts distinguished clones of similar insert size, leading to a twofold increase in the number of distinct clones. Therefore, we estimate that AluPCR amplification of hybrid F2 with ALE1 and ALE34 separately and in combination generated in excess of 130 different human-specific products, i.e., one Alu-PCR fragment per 75-100 kb. To justify the investment involved in converting a random clone to an STS, a high proportion of clones must generate successful STSs. We have demonstrated that sequences derived from Alu-PCR products were successfully converted to STSs in 17/24 (70%) of cases. Sequence suitable for designing primers could not be obtained from 6/30 (20%) of the clones. It is probable that this latter figure could be considerably improved. In this study we investigated conversion of ALE1 (left-hand) only and ALE3 (right-hand) only generated clones independently. ALE3 amplifications resulted in a greater number of products than ALEl. As a result of this, and a higher cloning efficiency of the ALE3 products in this exper-
824
COLE
ET
AL.
b.
0. t-I 0
P6
X3
R P
F2 Wg IR C
M
H 0
P6
X3
R P
F2 Wg IR C
M
H 0
P6
X3
R P
F2 Wg IR C
M
d.
c. H 0
P6
X3
R
P F2 Wg IR
C
M
FIG. 4. PCR analysis using four STSs, derived from the cloned Alu-PCR products of IFGT hybrid F2, on a panel of independent hybrids: H, total human (male) DNA, Q, 4BAl; P6, MCP-6; X3, X3000-11.1; R, HorlSllRSB; P, PIP; F2, IFGT hybridF2; Wg, Wg3-h (hamster); IR, IRE3 (mouse); C, TE control; M, 1-kb ladder. STSs 3/19 (a) and l/44 (b) localize to Xq24-Xq26. STSs 3/21 (c) and l/2 (d) localize to Xcen-Xql3. STS 3/21 (c) amplifies a hamster-specific fragment of approximately 230 bp in addition to the expected 171-bp human-specific product. The lower fragment observed in all lanes of STS l/2 (d) is assumed to be primer dimer.
iment, two-thirds of the clones originated from ALE3 amplifications. Both ends of these clones can have long poly(dA) tracts resulting from the variable Arich region at the right-hand end of Ah repeats. These not only can prevent sequence data being obtained but also can restrict choice of primers in small clones and therefore increase potential problems caused by primer dimers. Hence, the conversion rate from cloned ALE3/F2 product to STS was only 50%, while ALEl/F2 products, which have no A-rich ends, resulted in STSs from 70% of clones. Three-quarters of the products originating from the combined reaction would have at least one end that lacked the poly(dA) tract. Thus, the conversion rate from cloned product to STS, if both primers are used, would be expected to be in excess of 60%. Given one Alu-PCR product per 100 kb and a conversion rate to STS of 60%, the density of STSs that could be obtained by this approach in this region of the genome is approximately one STS per 170 kb. This is a reasonable approximation of the number of randomly generated STSs required to create YAC contigs from a library with a mean insert size of 300 kb or more. Although the distribution of STSs is likely to be nonrandom, many of the remaining gaps could be closed by generating new STSs at the ends of existing YAC contigs (Riley et al., 1990) and rescreening the library. Our preliminary results (unpublished data) show that all Alu-PCR-generated STSs tested
to date can successfully identify YACs from libraries by using PCR analysis of YAC pools (Green and Olson, 1990b). It has been suggested that Ah repeats are found more often in light G-bands, with LINE repeats preferentially localized in the dark G-bands (Korenberg and Rykowski, 1988; Moyzis et al., 1989; Chen and Manuelidis, 1989). Line sequences have been used successfully either alone or in combination with Ah primers (Ledbetter et al., 1990) to generate human fragments from hybrids. When a region appears depleted for sufficient Alu-primed fragments, this approach, or the use of other repeat sequences, could be used to increase representation of PCR products and therefore STSs. It has been proposed that STSs should be organized into a database to assist researchers involved in the genome mapping project. Any database of this kind would require strict guidelines to ensure adequate performance of the STSs included. However, it is important that potentially valuable STSs are not lost as a result of excessive stringency. There are two operational criteria that determine the utility of a particular STS: (i) An STS may be used as a specific PCR assay, in which case only the sequences comprising the primer sites (approximately 40 bp) must be unique. (ii) The amplified STS product may be used as a hybridization probe (Green and Olson, 199Ob). This demands that a significant proportion of the se-
NOVEL
REGION-SPECIFIC
quence between the primers is also unique. If all STSs are required to satisfy both criteria, this would prevent the inclusion of some small STSs, which form a significant proportion of the STSs generated from the products of Alu-PCR and also many microdissection clones (Liidecke et al., 1989). It is likely that many applications will not require the use of an STS as a hybridization probe. For example, by adopting a system of PCR on pooled rows and columns (J. Collins and D. R. Bentley, unpublished results), it is possible to eliminate the final hybridization step currently used (Green and Olson, 1990b) to localize positive YAC clones, thus permitting the use of STSs that do not satisfy the second criterion to be used to screen YAC libraries. In conclusion, we have demonstrated that Ah-PCR fragments derived from an irradiation-fusion hybrid containing a small amount of human DNA can be efficiently converted to STSs. These have been shown to map to discrete chromosomal regions. In addition, sufficient numbers of STSs can be generated to form the basis for a physical map, and preliminary data indicate that they can be used successfully to identify YACs from libraries and therefore to form the basis of a YAC contig.
STSs
Note added in proof: 3/40 has been found to represent a co-cloning of 3/2 (class 4) and 3/31 (class 2) clones. As a result 3/2 and 3/40 represent the same STS. This does not alter the overall success rate or the conclusions drawn.
REFERENCES 1.
2.
3.
4.
5.
AHRENS, P., ALBERTSEN, H., RIIS VESTERGAARD, S., BoLUND, L., AND KRUSE, T. A. (1985). Anonymous X-chromosomal probes revealing DNA polymorphisms one of which is a deletion of more than 3 kb. Cytogenet. Cell. Genet. 40: 567. ALJJRIDGE, J., KUNKEL, L., BRUNS, G., TANTRAVAHI, U., LALANDE, M., BREWSTER, T., MOREAU, E., WILSON, M., BROMLEY, W., RODERICK, T., AND LAW, S. A. (1984) A strategy to reveal high-frequency RFLPs along the human X-chromosome. Am. J. Hum. Genet. 36: 546-564. BENHAM, F., HART, K., CROLLA, J., BOBROW, M., FRANCAVILLA, M., AND GOODFELLOW, P. N. (1989). A method for generating hybrids containing nonselected fragments of human chromosomes. Genomics 4: 509-51’7. BLONDEN, L. A. J., DEN DUNNEN, J. T., VAN PAASSEN, H. M. B., WAPENAAR, M. C., GROOTSCHOLTEN, P. M., GINJAAR, H. B., BAKKER, E., PEARSON, P. L., AND VAN OMMEN, G. J. B. (1989). High resolution deletion breakpoint mapping in the DMD gene by whole cosmid hybridization. Nucleic Acids Res. 17: 5611-5621. BOND, Y. (1987). Characterization and use of somatic cell hy-
Alu-PCR
brids with interspecific X chromosome. Ann.
825 translocations involving Hum. Genet. 51: 13-26.
the human
6.
BROOKS-WILSON, A. R., GOODFELLOW, P. N., POVEY, S., NEVANLINNA, H. A., DE JONG, P. J., AND GOODFELLOW, P. J. (1990). Rapid cloning and characterization of new chromosome 10 markers by Ah element-mediated PCR. Genomics 7: 614-620.
7.
CHEN, T. L., AND -LIDIS, L. (1989). SINES and LINES cluster in distinct DNA fragments of Giemsa band size. Chromasoma 98: 309-316.
8.
COOKE, H. J., BROWN, W. R. A., AND RAPPOLD, G. A. (1985). Hypervariable telomeric sequences from the human sex chromosomes are pseudoautosomal. Nature fLondon) 317: 687692.
9.
CO?TER, F. E., HAMPTON, G. M., NASIPURI, S., BODMER, W. F., AND YOUNG, B. D. (1990). Rapid isolation of human chromosome-specific DNA probes from a somatic cell hybrid. Genomics 7: 257-263. Cox, D. R., PRITCHARD, C. A., UGLUM, E., CASHER, D., KoBORI, J., AND MYERS, R. M. (1989). Segregation of the Huntington disease region of human chromosome 4 in a somatic cell hybrid. Genomics 4: 397-407.
10.
11.
DAVIES, J. M., (1983). ing the of the 2312.
12.
EDWARDS, A., Voss, H., RICE, P., CIVITELLO, A., STJZGEMANN, J., SCHWAGER, C., ZIMMERMANN, J., ERFLE, H., CASKEY, C. T., AND ANSORGE, W. (1990). Automated DNA sequencing of the human HPRT locus. Genomics 6: 593-608. FEINBERG, A. P., AND VOGELSTEIN, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13. GITSCHIER, J., DRAYNA, D., TIJDDENHAM, E. G. D., WHITE, R. L., AND LAWN, R. M. (1985). Genetic mapping and diagnosis of haemophilia A achieved through a BclI polymorphism in the factor VIII gene. Nature (London) 314: 738-740.
ACKNOWLEDGMENTS We are indebted to John Crolla for the karyotype analysis and in situ hybridization. We also thank Professor Francesco Giannelli for discussion and support of this work, Dr. M. Francavilla for help in construction of the IFGT hybrids, and Dr. Ian Dunham for critical review of the manuscript. This work was supported by the Generation Trust and Spastics Society.
USING
13.
14.
K. E., PEARSON, P. L., HARPER, P. S., MURRAY, O’BRIEN, T., SARFARAZI, M., ANLI WILLIAMSON, R. Linkage analysis of two cloned DNA sequences flankDuchenne muscular dystrophy locus on the short arm human X chromosome. Nucleic Acids Res. 8: 2303-
15.
GOODFELLOW, P. N., BANTING, G., TROWSDALE, J., CHAMBERS, S., AND SOLOMON, E. (1982). Introduction of a human X-6 translocation chromosome into a mouse teratocarcinoma: Investigation of control of HLA-A, B, C expression. Proc. Natl. Acad. Sci. USA 79: 1190-1194.
16.
GOODFELLOW, P., DARLING, S., AND WOLFE, J. (1985). human Y chromosome. J. Med. Gerwt. 22: 329-344.
17.
GOODFELLOW, P. N., AND PRITCHARD, C. A. (1988). Chromosome fragmentation by chromosome mediated gene transfer. Cancer Surv. 7: 251-265.
18.
Goss, genes 684.
19.
Goss, S. J., AND HARRIS, H. (1977). of cell fusion. J. Cell. Sci. 25: 17-37.
20.
GRAW, S., DAVIDSON, J., GUSELLA, J., WATKINS, P., TANZI, R., NEVE, R., AND PATERSON, D. (1988). Irradiation-reduced human chromosome 21 hybrids. Somat. Cell Mol. Genet. 14: 233-242. GREEN, P. M., BENTLEY, D. R., MIBASHAN, R. S., NILSSON, I. M., AND GIANNELLI, F. (1989). Molecular pathology of haemophilia B. EMBO J. 8: 1067-1072. GREEN, E. D., AND OLSON, M. V. (199Oa). Chromosomal region of the cystic fibrosis gene in yeast artificial chromosomes: A model for human genome mapping. Science 250: 94-98.
21.
22.
S. J., AND HARRIS, H. (1975). New method in human chromosomes. Nature bwzdon) Gene
transfer
The
for mapping 265: 680by means
826
COLE
ET
AL.
23. GREEN, E. D., AND OLSON,
24.
M. V. (1990b). Systematic screening of yeast artificial-chromosome libraries using the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 87: 1213-1217.
40.
GUSELLA, J. F., KEYS, C., VARSANYI-BREINER, A., KAO, F-T., JONES, C., PUCK, T. T., AND HOUSMAN, D. (1980). Isolation and localization of DNA segments from specific human chromosomes. Proc. Natl. Acad. Sci. USA 77: 2829-2833.
41.
25. G&sow, terization reaction.
D., AND CLACKSON, T. (1989). Direct clone from plaques and colonies by the polymerase Nucleic Acids Res. 17: 4000.
characchain
42.
26. HANAUER,
27.
A., MANDEL, J. L., AND MA?TEI, M. G. (1985). X linked and autosomal sequences corresponding to glutamate dehydrogenase (GLUD) and to an anonymous cDNA. Cytogenet. Cell. Genet. 40: 647. JELINEK, W. R., AND HAYNES, S. R. (1983). The mammalian Alu family of dispersed repeats. Cold Spring Harbor Symp. Quunt. Biul. 47: 1123-1130.
43.
28. JOLLY, D. J., ESTY, A. C., BERNARD,
H. U., AND FRIEDMANN, T. (1982). Isolation of a genomic clone partially encoding human hypoxanthine phosphorihosyltransferase. Proc. Natl. Acad. Sci. USA 79: 5038-5041.
29.
KARIYA, Y., KATO, K., HAYASHIZAKI, Y., HIMENO, S., TARUI, S., AND MATSUBARA, K. (1987). Revision of consensus sequence of human Alu repeats-a review. Gene 63: l-10.
30.
KEITH, D. H., SINGER-SAM, J., AND RIGGS, A. (1986). Active X chromosome DNA is unmethylated at eight CCGG sites clustered in a guanine-plus-cytosine-rich island at the 5’ end of the gene for phosphoglycerate kinase. Mol. Cell Biol. 6:
PONTECORVO, G. (1975). Production cell hybrids by means of polyethylene mat. Cell Genet. 1: 397-400.
45.
RILEY, J., BUTLER, R., OGILVJE, D., FIN-, R., JENNER, D., POWELL, S., ANAND, R., SMITH, J. C., AND m, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: 2887-2890.
46.
SAIKI, R. K., GELFAND, D. H., STOFFEL, S., SCHARF, S. J., HIGUCHI, R., HORN, G. T., MULLIS, K. B., AND ERLICH, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491.
47.
THOMPSON, M. GAN, C., Oss, I., of polymorphisms the breakpoint linked muscular
31. KOENIG,
4109. 32.
KORENBERG, J. R., AND RYKOWSKI, M. C. (1988). Human nome organization: Alu, Lines, and the molecular structure metaphase chromosome bands. Cell 53: 391-400.
geof
33.
LEDBETTER, S. A., NELSON, D. L., WARREN, S. T., AND LEDBETTER, D. H. (1990). Rapid isolation of DNA probes within specific chromosome regions by interspersed repetitive sequence polymerase chain reaction. Genomics 6: 475-481.
34.
L~DECKE, H-J., SENGER, G., CLAUSSEN, U., AND HORSTHEMKE, B. (1989). Cloning defined regions of the human genome by microdissection of banded chromosomes and enzymatic amplification. Nature (London) 338: 348-350.
35. MANIATIS,
T., FRITSCH, E. F., AND SAMBROOK, J. (1982). “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
37. MOYZIS,
38. 39.
R. K., TORNEY, D. C., MEYNE, J., BUCKINGHAM, J. M., WV, J-R., BURKS, C., SIROTKIN, K. M., AND GOAD, W. B. (1989). The distribution of interspersed repetitive DNA sequences in the human genome. Gerwmics 4: 273-289. NAEJHOLZ, M., MIGGIANO, V., AND BODMER, W. (1969). Genetic analysis with human-mouse somatic cell hybrids. Nature (London) 223: 358-363.
NELSON, D. L., LEDBETTER, S. A., CORBO, L., VICTORIA, M. F., RAMIREZ-SOLIS, R., WEBSTER, T. D., LEDBE=, D. H., AND CASKEY, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human-specific se-
of mammalian somatic glycol treatment. So-
W., RAY, P. N., BELFALL, B., DUFF, C., LoAND WORTON, R. G. (1986). Linkage analysis within the DNA fragment XJ cloned from of an X21 translocation associated with X dystrophy. J. Med. Gem%. 23: 548-555.
48. WAPENAAR,
M. C., KIEVITS, T., HART, K. A., ABBS, S., BLONDEN, L. A. J., DEN DUNNEN, J. T., GROOTSCHOLTEN, P. M., BAKKER, E., VERELLEN-DUMOULIN, CH., BOBROW, M., VAN OMMEN, G. J. B., AND PEARSON, P. L. (1988). A deletion hot spot in the Duchenne muscular dystrophy gene. Genomics 2:
101-108. 49.
WESTERVELD, A., VISSER, R. P. L. S., MEERA KHAN, P., AND BOOTSMA, D. (1971). Loss of human genetic markers in manChinese hamster somatic cell hybrids. Nature New Biol. 234:
20-24. 50. WIEAKER,
P., DAVIES, K. E., COOKE, H. J., PEARSON, P. L., WILLIAMSON, R., BHATTACHARYA, S., ZIMMER, J., AND ROPERS, H-H. (1984). Toward a complete linkage map of the human X chromosome: Regional assignment of 16 cloned single-copy DNA sequences employing a panel of somatic cell hybrids. Am. J. Hum. Genet. 36: 265-276.
36. MONACO,
A. P., BERTELSON, C. J., COLLE’ITI-FEENER, C., AND KUNKEL, L. M. (1987). Localization and cloning of Xp21 deletion breakpoints involved in muscular dystrophy. Hum. Genet. 75: 221-227.
PAGE, D. C., HARPER, M. E., LOVE, J., AND BOTSTEIN, D. (1984). Occurrence of a transposition from the X-chromosome long arm to the Y-chromosome short arm during human evolution. Nature (London) 311: 119-123. PERSICO, M. G., VIGLIE’ITO, G., MARTINI, G., TONIOLO, D., PAONESSA, G., MOSCATELLI, C., DONO, R., VULLIAMY, T., LUZZA~O, L., AND D’UR~O, M. (1986). Isolation of human glucose-6-phosphate dehydrogenase (GGPD) cDNA clones: Primary structure of protein and unusual 5’ non-coding region. Nucleic Acids Res. 14: 2511-2522.
44.
4122-4125. M., CAMERINO, G., HEILIG, R., AND MANDEL, J.-L. (1984). A DNA fragment from the human X chromosome short arm which detects a partially homologous sequence on the Y chromosome long arm. Nucleic Acids Res. 12: 4097-
quences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86: 6686-6690. NUSSBAUM, R. L., AIRHART, S. D., AND LEDBETTER, D. H. (1986). A rodent-human hybrid containing Xq24-Xqter translocated to a hamster chromosome expresses the Xq27 folate-sensitive fragile site. Am. J. Med. Genet. 23: 457-466. OLSON, M., HOOD, L., CANTOR, C., AND BOTSTEIN, D. (1989). A common language for physical mapping of the human genome. Science 246: 1434-1435.
51. WINSHIP,
P. R. (1989). quencing PCR amplified Nucleic Acids Res. 17:
An improved method for directly sematerial using dimethyl sulphoxide.
1266.
52. WOLFE,J., DARLING,
S. M., ERICKSON, R. P., CRAIG, I. W., BUCKLE, V. J., RIGBY, P. W. J., WILLARD, H. F., AND GOODFELLOW, P. N. (1985). Isolation and characterization of an alphoid centromeric repeat family from the human Y chromosome. J. Mol. Biol. 182: 447-485.
53.
WROGEMANN, K., ARVEILER, B., OBERLJ?., I., MULLIGAN, L. M., HOLDEN, J. A., FOFISTER-GIBSON, C. J., AND WHITE, B. N. (1986). A Taq RFLP in Xq26-Xqter detected by pX45h (HGM8 No. DXSlOOh). Nucleic Acids Res. 14: 5572.