- Email: [email protected]
promoter in heterozygous or compound heterozygous state
Stem Cell Research 39 (2019) 101517
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Multiple Cell Lines
Generation of two H1 hESC sublines carrying deletions of RB1 exon 1/ promoter in heterozygous or compound heterozygous state Julia Mengesa, Martina Cremannsb,c, Laura Steenpassa,
T
⁎
a
Institute of Human Genetics, University Hospital Essen, University of Duisburg-Essen, Hufelandstr. 55, 45147 Essen, Germany Institute of Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Hufelandstr. 55, 45147 Essen, Germany c Department of Medical Microbiology, Ruhr-University Bochum, Universitätsstraße 150, 44801 Bochum, Germany b
ABSTRACT
Biallelic inactivation of the retinoblastoma tumor suppressor gene (RB1) causes formation of retinoblastoma, a retinal eye tumor occurring in early childhood. Using the CRISPR/Cas9 nickase system, exon 1 of RB1 was deleted, including the RB1 promoter. As a result, sublines were generated carrying deletions of RB1 exon 1/ promoter on one or both alleles.
Resource utility To study retinoblastoma formation in vitro, modified hESCs carrying mutations of RB1 can be differentiated into neural retina using 3D organoid or monolayer models. To abolish RB1 transcription and expression, the RB1 exon 1/promoter was deleted in H1 hESCs using the CRISPR/Cas9 nickase system. Resource details Using the CRISPR/Cas9 nickase system, H1 hESCs were modified by deleting RB1 exon 1 including the RB1 promoter. Four guide RNAs flanking RB1 exon 1 were designed (Fig. 1A, guide RNAs 1–4 in blue) using the tool provided at www.crispr.mit.edu and were cloned into plasmids pSpCas9n(BB)-2A-GFP and pSPgRNA (Addgene #48140, #47108) (Ran et al., 2013). These plasmids were introduced into H1 hESCs by nucleofection. Seven days after low density seeding, single cell clones were isolated manually. Analysis of 55 clones by PCR revealed deletion of RB1 exon 1/promoter on one allele in 16 and on both alleles in 2 clones, respectively. One heterozygous and one clone with a biallelic deletion were selected for further analyses (clones E9, D6; Fig. 1). The exact sizes of the deletion were determined by next-generation amplicon sequencing for wildtype and deletion fragments. The wildtype fragment was sequenced as separate 5′- and 3′-fragments because of size restrictions. Clone D6 carries deletions of 400 and 416 bp (allele 1: L11910.1:g.1843_2242del; allele 2: L11910.1:g.1848_2262delinsA) and E9 carries one wildtype allele and a deletion of 365 bp (L11910.1:g.1882_2246del) (Fig. 1A, B). Modified D6 and E9 cell lines showed stem cell morphology (Fig. 1C; scale bar
⁎
250 μm). Western blot analysis of clone D6 showed absence of RB1 protein, whereas in E9, RB1 could be detected (Fig. 1D). By RT-qPCR analysis, RNA expression of RB1 was reduced in clone E9 and absent in clone D6 (Fig. 1E; normalized to GAPDH, calibrated to expression in H1 hESCs). Karyotyping of both subclones confirmed a karyotype of 46, XY (Fig. 1F, Supplementary file). Derivation of these subclones from H1 hESCs was proven by STR analysis (STR file). Pluripotency of subclones D6 and E9 was demonstrated by immunofluorescent staining and FACS analysis of pluripotency-associated proteins (OCT4, SOX2, NANOG, SSEA4, TRA-1-60) (Fig. 1G,H; scale bar 50 μm). Directed monolayer differentiation proved capacity of differentiation into derivatives of all three germ layers analysed by FACS analysis of marker protein expression (ectoderm: NESTIN, PAX6; endoderm: CXCR4, SOX17; mesoderm: CXCR4, T; Fig. 1I). Material and methods Cell culture and nucleofection H1 hESCs (Thomson et al., 1998; www.wicell.org) were cultured feeder-independent in mTeSR1 on Vitronectin XF-coated tissue culture plates at 37 °C and 5% CO2 in a humidified incubator. Passaging was performed in a ratio of 1/10 every 5–7 days using Gentle Cell Dissociation Reagent (Stemcell Technologies). 8 × 105 cells were transfected with 1 μg of each Cas9 plasmid (Human Stem Cell Nucleofector Kit 2, Nucleofector II, program B-016). 1/8 of the transfected cells were seeded onto a Vitronectin XF-coated 10 cm Petridish in mTeSR1 supplemented with 10 μM of ROCK inhibitor Y-27632. Medium was changed daily. Single cell clones were isolated manually 7 days after
Corresponding author. E-mail address: [email protected] (L. Steenpass).
https://doi.org/10.1016/j.scr.2019.101517 Received 17 June 2019; Received in revised form 17 July 2019; Accepted 25 July 2019 Available online 29 July 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 39 (2019) 101517
J. Menges, et al.
Fig. 1. Characterisation of H1 hESC sublines carrying RB1 exon1/promoter deletions.
2
Stem Cell Research 39 (2019) 101517
J. Menges, et al.
Table 1 Summary of lines. PSC line names
Abbreviation in figures
Gender
Age
Ethnicity
Genotype of locus
Disease
H1_RB1ex1_D6 (WAe001-A-31) H1_RB1ex1_E9 (WAe001-A-32)
D6 E9
male male
blastocyst blastocyst
N/A N/A
RB1 −/− RB1 +/−
Retinoblastoma Retinoblastoma
seeding Tables 1–3.
FACS analysis
Short tandem repeat analysis
Surface proteins were stained on single cells prepared with 1× trypsin-EDTA. Cells were resuspended in PBS and incubated with antibodies and isotype controls for 20 min at 4 °C. For staining of intracellular markers, single cells were prepared using Accutase, fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.1% Triton X-100 for 15 min. Antibody/isotype control staining was performed in PBS with 10% FCS for 1 h at room temperature. FACS analysis was done using the FACSAria II (BD) and Kaluza software (Beckman Coulter) for surface proteins and the CytoFLEX flow cytometer and CytExpert software (Beckman Coulter) for intracellular markers.
STR analysis was performed using the Powerplex 16 HS System (Promega) according to manufacturer's instructions. Fragment lengths were analysed on an ABI Genetic Analyzer 3130XL using GeneMarker program. Karyotyping Karyotype analysis was performed in total passage 81. A minimum of eleven metaphases were analysed. Report in Supplementary file. Next-generation amplicon sequencing
Key resources table
Next-generation amplicon sequencing was performed as described (Steenpass, 2017).
Unique stem cell lines identifier Alternative names of stem cell lines Institution Contact information of distributor
RNA and protein analysis 50 ng of RNA (RNeasy Mini Kit, QIAGEN) was treated with RQ1DNaseI (Promega), reverse transcribed into cDNA using GeneAmp RNA PCR Core Kit (Thermo) and used for qPCR amplification of RB1 exons 4–5 using the UPL system and LightCycler 480 (Roche). Nuclear protein fraction (NE-PER Nuclear and Cytoplasmic Extraction reagent, Thermo) was separated by SDS-PAGE and blotted semi-dry to nitrocellulose membrane. The membrane was blocked with 5% milk powder (at room temperature, 1 h) and incubated over night with primary antibody at 4 °C. Horseradish peroxidase-coupled secondary antibodies were added for 1 h. Signals were detected with ChemoStar Touch device (Intas).
Type of cell lines Origin Cell Source Clonality Method of reprogramming Multiline rationale Gene modification Type of modification
Immunofluorescence Cells were seeded to Vitronectin XF-coated 10–12 mm coverslips in 24-well tissue culture plates and cultivated for 3–5 days. Cells were fixed with 4% paraformaldehyde for 15 min, permeabilized for 5 min using 0.3% Triton X-100 and blocked in 5% BSA for 1 h. Primary antibodies were added over night at 4 °C. Secondary antibody incubation was performed for 2 h at room temperature. Images were taken with a Zeiss Axioplan microscope using Metasystems ISIS software. Contrast was enhanced for better visibility.
Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
Directed differentiation Directed differentiation into derivatives of all germ layers was performed with the STEMdiff Trilineage Differentiation Kit (Stemcell Technologies) according to manufacturer's instructions.
3
WAe001-A-31 (synonym UDEe011-A-31) WAe001-A-32 (synonym UDEe011-A-32) WAe001-A-31: H1_RB1ex1_D6 (in article D6) WAe001-A-32: H1_RB1ex1_E9 (in article E9) University Hospital Essen, University Duisburg-Essen PD Dr. Laura Steenpass [email protected] Julia Menges [email protected] human embryonic stem cell hESC line H1 H1 hESC line purchased from WiCell Institute clonal N/A CRISPR/Cas9 mutagenesis using four guide RNAs flanking RB1 exon 1, isolation of lines with monoallelic and biallelic deletions YES D6: deletion of RB1 exon 1/promoter on both alleles (400 bp and 416 bp) E9: heterozygous deletion of RB1 exon 1/promoter (365 bp) retinoblastoma RB1 CRISPR/Cas9 nickase, NHEJ None None D6: archived: November 9th 2016, stock: May 27th 2017 E9: archived: November 9th 2016, stock: May 28th 2017 None Approval obtained from the Robert-Koch Institute, Berlin, Germany (Az.3.04.02/0101) and from the local Ethical Review Board University Duisburg-Essen (16–7215-BO)
Stem Cell Research 39 (2019) 101517
J. Menges, et al.
Table 2 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Immunocytochemistry Flow cytometry
Fig. 1C Fig. 1G Fig. 1H
Genotype
Karyotype (G-banding) and resolution
normal, roundish colonies, high nuclear to cytoplasmic ratio Assess staining/expression of pluripotency markers: OCT4, NANOG, SOX2 Staining/expression of surface pluripotency markers: SSEA4 and TRA-160 46XY, Resolution 500
Identity Mutation analysis (IF APPLICABLE)
Microsatellite PCR (mPCR) STR analysis Sequencing
Microbiology and virology Differentiation potential
Southern Blot OR WGS Mycoplasma Directed differentiation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
N/A Powerplex 16 HS system; matched E9: heterozygous deletion of ∆ 365, spanning RB1 exon 1 D6: biallelic deletion of ∆ 400 and ∆ 416, both spanning RB1 exon 1 N/A Mycoplasma testing by PCR, negative STEMdiff Trilineage Differentiation Kit (Stemcell) FACS analysis of ectoderm (PAX6/NESTIN) mesoderm (SOX17/CXCR4) andendoderm (T/CXCR4) derivatives N/A N/A N/A
Fig. 1F Supplementary file N/A STR file Fig. 1A N/A Supplementary file Fig. 1I
N/A N/A N/A
Table 3 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
Western blot RB1 Secondary antibody Pluripotency-associated markers StemLight Pluripotency antibody Kit Secondary antibody FACS FACS FACS FACS Differentiation-associated markers FACS FACS FACS FACS FACS FACS FACS FACS FACS FACS Primers Next generation amplicon sequencing
Antibody
Dilution
Company Cat # and RRID
Mouse anti-RB1 Mouse anti- HRP
1:1000 1:1000
CST Cat# 9309, RRID: AB_823629 Thermo Fisher Scientific Cat# 32430, RRID: AB_1185566
Rabbit anti-Oct4 Rabbit anti-Nanog Rabbit anti-Sox2 Goat anti-rabbit IgG (Alexa Fluor 555 conjugate) Mouse anti-human SSEA4 Mouse IgG3κ, SSEA4 isotype Mouse anti-human TRA1–60 Mouse IGMκ TRA1–60 isotype
1:200
Cell Signaling Technology Cat# 9656S, RRID: AB_10692662
1:1000
Cell Signaling Technology Cat# 4413S, RRID: AB_10694110
5 μl/106 cells 5 μl/106 cells 10 μl/106 cells 10 μl/106 cells
BioLegend Cat# 330408 RRID: AB_1089200 BioLegend Cat# 401321 RRID: AB_10683445 BioLegend Cat# 330610 RRID: AB_2119065 BioLegend: Cat# 401611 RRID: not listed
10 μl/106 10 μl/106 10 μl/106 10 μl/106
Miltenyi Biotec Cat# 130–107-775 RRID: AB_2653167 Miltenyi Biotec Cat# 130–104-613 RRID: AB_2661678 Invitrogen Cat# MA5–23650 RRID: AB_2608686 Invitrogen Cat# MA5–18093 RRID: AB_2539476
Anti-human PAX6 REA(I) control, PAX6 istoype Anti-human NESTIN Mouse IgG1, NESTIN isotype control Anti-human T Normal goat IgG, T isotype
5 μl/106 cells 5 μl/106 cells
anti-human SOX17 REA(I) control, SOX17 isotype Mouse anti-human CD184 (CXCR4) Mouse IgG2aκ CD184 isotype
2 μl/106 cells 2 μl/106 cells 5 μl/106 cells
R&D Systems Cat# IC2085G RRID: not listed R&D Systems Cat# IC108G RRID: AB_10890944 Miltenyi Biotec Cat# 130–111-032 RRID: AB_2653493 Miltenyi Biotec Cat# 130–104-613 RRID: AB_2661678 Stemcell Technologies Cat# 60089AZ RRID: not listed
5 μl/106 cells
Stemcell Technologies Cat# 60071AZ RRID: not listed
Target RB1 exon 1
Forward/Reverse primer (5′-3′) Deletion fragment: cttgcttcctggcacgag-GTGGTTCTGGGTAGAAG/caggaaacagctatgacCCCTCGCCCAAGAACCCAGAATC wildtype 5′ fragment: cttgcttcctggcacgag-GTGGTTCTGGGTAGAAG/ caggaaacagctatgac-TGTCCTGCTCTGGGTCCTC wildtype 3′ fragment: cttgcttcctggcacgagGTTTTTCTCAGGGGACGTTG/caggaaacagctatgac-CCCTCGCCCAAGAACCCAGAATC TCAGCAAATTGGAAAGGACA/AACTTTTAGCACCAATGCAGAAT UPL: 3 CCCGCGGCGTCACGTCCGCG AAGTGACGTTTTCCCGCGGT CTTCCCGCGTGAGGCGACGG GCCCCGGGTGTGCGTAGGGC
RT-qPCR
RB1 exon 4–5
guide guide guide guide
RB1 RB1 RB1 RB1
1 2 3 4
cells cells cells cells
exon exon exon exon
1 1 1 1
4
Stem Cell Research 39 (2019) 101517
J. Menges, et al.
Declaration of Competing Interest
doi.org/10.1016/j.scr.2019.101517.
None
References
Acknowledgments
Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., Zhang, F., 2013. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8 (11), 2281–2308. Steenpass, L., 2017. Generation of heterozygous and homozygous hESC H9 sublines carrying inactivating mutations in RB1. Stem Cell Res. 25, 270–273. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., Jones, J.M., 1998. Embryonic stem cell lines derived from human blastocysts. Science 282 (5391), 1145–1147.
This work was funded by the Deutsche Förderprogramm für Augenheilkunde (Germany). We thank Michaela Hiber and Elke Jürgens for their help in performing STR analysis and karyotyping. Appendix A. Supplementary data Supplementary data to this article can be found online at https://
5
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Multiple Cell Lines
Generation of two H1 hESC sublines carrying deletions of RB1 exon 1/ promoter in heterozygous or compound heterozygous state Julia Mengesa, Martina Cremannsb,c, Laura Steenpassa,
T
⁎
a
Institute of Human Genetics, University Hospital Essen, University of Duisburg-Essen, Hufelandstr. 55, 45147 Essen, Germany Institute of Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Hufelandstr. 55, 45147 Essen, Germany c Department of Medical Microbiology, Ruhr-University Bochum, Universitätsstraße 150, 44801 Bochum, Germany b
ABSTRACT
Biallelic inactivation of the retinoblastoma tumor suppressor gene (RB1) causes formation of retinoblastoma, a retinal eye tumor occurring in early childhood. Using the CRISPR/Cas9 nickase system, exon 1 of RB1 was deleted, including the RB1 promoter. As a result, sublines were generated carrying deletions of RB1 exon 1/ promoter on one or both alleles.
Resource utility To study retinoblastoma formation in vitro, modified hESCs carrying mutations of RB1 can be differentiated into neural retina using 3D organoid or monolayer models. To abolish RB1 transcription and expression, the RB1 exon 1/promoter was deleted in H1 hESCs using the CRISPR/Cas9 nickase system. Resource details Using the CRISPR/Cas9 nickase system, H1 hESCs were modified by deleting RB1 exon 1 including the RB1 promoter. Four guide RNAs flanking RB1 exon 1 were designed (Fig. 1A, guide RNAs 1–4 in blue) using the tool provided at www.crispr.mit.edu and were cloned into plasmids pSpCas9n(BB)-2A-GFP and pSPgRNA (Addgene #48140, #47108) (Ran et al., 2013). These plasmids were introduced into H1 hESCs by nucleofection. Seven days after low density seeding, single cell clones were isolated manually. Analysis of 55 clones by PCR revealed deletion of RB1 exon 1/promoter on one allele in 16 and on both alleles in 2 clones, respectively. One heterozygous and one clone with a biallelic deletion were selected for further analyses (clones E9, D6; Fig. 1). The exact sizes of the deletion were determined by next-generation amplicon sequencing for wildtype and deletion fragments. The wildtype fragment was sequenced as separate 5′- and 3′-fragments because of size restrictions. Clone D6 carries deletions of 400 and 416 bp (allele 1: L11910.1:g.1843_2242del; allele 2: L11910.1:g.1848_2262delinsA) and E9 carries one wildtype allele and a deletion of 365 bp (L11910.1:g.1882_2246del) (Fig. 1A, B). Modified D6 and E9 cell lines showed stem cell morphology (Fig. 1C; scale bar
⁎
250 μm). Western blot analysis of clone D6 showed absence of RB1 protein, whereas in E9, RB1 could be detected (Fig. 1D). By RT-qPCR analysis, RNA expression of RB1 was reduced in clone E9 and absent in clone D6 (Fig. 1E; normalized to GAPDH, calibrated to expression in H1 hESCs). Karyotyping of both subclones confirmed a karyotype of 46, XY (Fig. 1F, Supplementary file). Derivation of these subclones from H1 hESCs was proven by STR analysis (STR file). Pluripotency of subclones D6 and E9 was demonstrated by immunofluorescent staining and FACS analysis of pluripotency-associated proteins (OCT4, SOX2, NANOG, SSEA4, TRA-1-60) (Fig. 1G,H; scale bar 50 μm). Directed monolayer differentiation proved capacity of differentiation into derivatives of all three germ layers analysed by FACS analysis of marker protein expression (ectoderm: NESTIN, PAX6; endoderm: CXCR4, SOX17; mesoderm: CXCR4, T; Fig. 1I). Material and methods Cell culture and nucleofection H1 hESCs (Thomson et al., 1998; www.wicell.org) were cultured feeder-independent in mTeSR1 on Vitronectin XF-coated tissue culture plates at 37 °C and 5% CO2 in a humidified incubator. Passaging was performed in a ratio of 1/10 every 5–7 days using Gentle Cell Dissociation Reagent (Stemcell Technologies). 8 × 105 cells were transfected with 1 μg of each Cas9 plasmid (Human Stem Cell Nucleofector Kit 2, Nucleofector II, program B-016). 1/8 of the transfected cells were seeded onto a Vitronectin XF-coated 10 cm Petridish in mTeSR1 supplemented with 10 μM of ROCK inhibitor Y-27632. Medium was changed daily. Single cell clones were isolated manually 7 days after
Corresponding author. E-mail address: [email protected] (L. Steenpass).
https://doi.org/10.1016/j.scr.2019.101517 Received 17 June 2019; Received in revised form 17 July 2019; Accepted 25 July 2019 Available online 29 July 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 39 (2019) 101517
J. Menges, et al.
Fig. 1. Characterisation of H1 hESC sublines carrying RB1 exon1/promoter deletions.
2
Stem Cell Research 39 (2019) 101517
J. Menges, et al.
Table 1 Summary of lines. PSC line names
Abbreviation in figures
Gender
Age
Ethnicity
Genotype of locus
Disease
H1_RB1ex1_D6 (WAe001-A-31) H1_RB1ex1_E9 (WAe001-A-32)
D6 E9
male male
blastocyst blastocyst
N/A N/A
RB1 −/− RB1 +/−
Retinoblastoma Retinoblastoma
seeding Tables 1–3.
FACS analysis
Short tandem repeat analysis
Surface proteins were stained on single cells prepared with 1× trypsin-EDTA. Cells were resuspended in PBS and incubated with antibodies and isotype controls for 20 min at 4 °C. For staining of intracellular markers, single cells were prepared using Accutase, fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.1% Triton X-100 for 15 min. Antibody/isotype control staining was performed in PBS with 10% FCS for 1 h at room temperature. FACS analysis was done using the FACSAria II (BD) and Kaluza software (Beckman Coulter) for surface proteins and the CytoFLEX flow cytometer and CytExpert software (Beckman Coulter) for intracellular markers.
STR analysis was performed using the Powerplex 16 HS System (Promega) according to manufacturer's instructions. Fragment lengths were analysed on an ABI Genetic Analyzer 3130XL using GeneMarker program. Karyotyping Karyotype analysis was performed in total passage 81. A minimum of eleven metaphases were analysed. Report in Supplementary file. Next-generation amplicon sequencing
Key resources table
Next-generation amplicon sequencing was performed as described (Steenpass, 2017).
Unique stem cell lines identifier Alternative names of stem cell lines Institution Contact information of distributor
RNA and protein analysis 50 ng of RNA (RNeasy Mini Kit, QIAGEN) was treated with RQ1DNaseI (Promega), reverse transcribed into cDNA using GeneAmp RNA PCR Core Kit (Thermo) and used for qPCR amplification of RB1 exons 4–5 using the UPL system and LightCycler 480 (Roche). Nuclear protein fraction (NE-PER Nuclear and Cytoplasmic Extraction reagent, Thermo) was separated by SDS-PAGE and blotted semi-dry to nitrocellulose membrane. The membrane was blocked with 5% milk powder (at room temperature, 1 h) and incubated over night with primary antibody at 4 °C. Horseradish peroxidase-coupled secondary antibodies were added for 1 h. Signals were detected with ChemoStar Touch device (Intas).
Type of cell lines Origin Cell Source Clonality Method of reprogramming Multiline rationale Gene modification Type of modification
Immunofluorescence Cells were seeded to Vitronectin XF-coated 10–12 mm coverslips in 24-well tissue culture plates and cultivated for 3–5 days. Cells were fixed with 4% paraformaldehyde for 15 min, permeabilized for 5 min using 0.3% Triton X-100 and blocked in 5% BSA for 1 h. Primary antibodies were added over night at 4 °C. Secondary antibody incubation was performed for 2 h at room temperature. Images were taken with a Zeiss Axioplan microscope using Metasystems ISIS software. Contrast was enhanced for better visibility.
Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
Directed differentiation Directed differentiation into derivatives of all germ layers was performed with the STEMdiff Trilineage Differentiation Kit (Stemcell Technologies) according to manufacturer's instructions.
3
WAe001-A-31 (synonym UDEe011-A-31) WAe001-A-32 (synonym UDEe011-A-32) WAe001-A-31: H1_RB1ex1_D6 (in article D6) WAe001-A-32: H1_RB1ex1_E9 (in article E9) University Hospital Essen, University Duisburg-Essen PD Dr. Laura Steenpass [email protected] Julia Menges [email protected] human embryonic stem cell hESC line H1 H1 hESC line purchased from WiCell Institute clonal N/A CRISPR/Cas9 mutagenesis using four guide RNAs flanking RB1 exon 1, isolation of lines with monoallelic and biallelic deletions YES D6: deletion of RB1 exon 1/promoter on both alleles (400 bp and 416 bp) E9: heterozygous deletion of RB1 exon 1/promoter (365 bp) retinoblastoma RB1 CRISPR/Cas9 nickase, NHEJ None None D6: archived: November 9th 2016, stock: May 27th 2017 E9: archived: November 9th 2016, stock: May 28th 2017 None Approval obtained from the Robert-Koch Institute, Berlin, Germany (Az.3.04.02/0101) and from the local Ethical Review Board University Duisburg-Essen (16–7215-BO)
Stem Cell Research 39 (2019) 101517
J. Menges, et al.
Table 2 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Immunocytochemistry Flow cytometry
Fig. 1C Fig. 1G Fig. 1H
Genotype
Karyotype (G-banding) and resolution
normal, roundish colonies, high nuclear to cytoplasmic ratio Assess staining/expression of pluripotency markers: OCT4, NANOG, SOX2 Staining/expression of surface pluripotency markers: SSEA4 and TRA-160 46XY, Resolution 500
Identity Mutation analysis (IF APPLICABLE)
Microsatellite PCR (mPCR) STR analysis Sequencing
Microbiology and virology Differentiation potential
Southern Blot OR WGS Mycoplasma Directed differentiation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
N/A Powerplex 16 HS system; matched E9: heterozygous deletion of ∆ 365, spanning RB1 exon 1 D6: biallelic deletion of ∆ 400 and ∆ 416, both spanning RB1 exon 1 N/A Mycoplasma testing by PCR, negative STEMdiff Trilineage Differentiation Kit (Stemcell) FACS analysis of ectoderm (PAX6/NESTIN) mesoderm (SOX17/CXCR4) andendoderm (T/CXCR4) derivatives N/A N/A N/A
Fig. 1F Supplementary file N/A STR file Fig. 1A N/A Supplementary file Fig. 1I
N/A N/A N/A
Table 3 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
Western blot RB1 Secondary antibody Pluripotency-associated markers StemLight Pluripotency antibody Kit Secondary antibody FACS FACS FACS FACS Differentiation-associated markers FACS FACS FACS FACS FACS FACS FACS FACS FACS FACS Primers Next generation amplicon sequencing
Antibody
Dilution
Company Cat # and RRID
Mouse anti-RB1 Mouse anti- HRP
1:1000 1:1000
CST Cat# 9309, RRID: AB_823629 Thermo Fisher Scientific Cat# 32430, RRID: AB_1185566
Rabbit anti-Oct4 Rabbit anti-Nanog Rabbit anti-Sox2 Goat anti-rabbit IgG (Alexa Fluor 555 conjugate) Mouse anti-human SSEA4 Mouse IgG3κ, SSEA4 isotype Mouse anti-human TRA1–60 Mouse IGMκ TRA1–60 isotype
1:200
Cell Signaling Technology Cat# 9656S, RRID: AB_10692662
1:1000
Cell Signaling Technology Cat# 4413S, RRID: AB_10694110
5 μl/106 cells 5 μl/106 cells 10 μl/106 cells 10 μl/106 cells
BioLegend Cat# 330408 RRID: AB_1089200 BioLegend Cat# 401321 RRID: AB_10683445 BioLegend Cat# 330610 RRID: AB_2119065 BioLegend: Cat# 401611 RRID: not listed
10 μl/106 10 μl/106 10 μl/106 10 μl/106
Miltenyi Biotec Cat# 130–107-775 RRID: AB_2653167 Miltenyi Biotec Cat# 130–104-613 RRID: AB_2661678 Invitrogen Cat# MA5–23650 RRID: AB_2608686 Invitrogen Cat# MA5–18093 RRID: AB_2539476
Anti-human PAX6 REA(I) control, PAX6 istoype Anti-human NESTIN Mouse IgG1, NESTIN isotype control Anti-human T Normal goat IgG, T isotype
5 μl/106 cells 5 μl/106 cells
anti-human SOX17 REA(I) control, SOX17 isotype Mouse anti-human CD184 (CXCR4) Mouse IgG2aκ CD184 isotype
2 μl/106 cells 2 μl/106 cells 5 μl/106 cells
R&D Systems Cat# IC2085G RRID: not listed R&D Systems Cat# IC108G RRID: AB_10890944 Miltenyi Biotec Cat# 130–111-032 RRID: AB_2653493 Miltenyi Biotec Cat# 130–104-613 RRID: AB_2661678 Stemcell Technologies Cat# 60089AZ RRID: not listed
5 μl/106 cells
Stemcell Technologies Cat# 60071AZ RRID: not listed
Target RB1 exon 1
Forward/Reverse primer (5′-3′) Deletion fragment: cttgcttcctggcacgag-GTGGTTCTGGGTAGAAG/caggaaacagctatgacCCCTCGCCCAAGAACCCAGAATC wildtype 5′ fragment: cttgcttcctggcacgag-GTGGTTCTGGGTAGAAG/ caggaaacagctatgac-TGTCCTGCTCTGGGTCCTC wildtype 3′ fragment: cttgcttcctggcacgagGTTTTTCTCAGGGGACGTTG/caggaaacagctatgac-CCCTCGCCCAAGAACCCAGAATC TCAGCAAATTGGAAAGGACA/AACTTTTAGCACCAATGCAGAAT UPL: 3 CCCGCGGCGTCACGTCCGCG AAGTGACGTTTTCCCGCGGT CTTCCCGCGTGAGGCGACGG GCCCCGGGTGTGCGTAGGGC
RT-qPCR
RB1 exon 4–5
guide guide guide guide
RB1 RB1 RB1 RB1
1 2 3 4
cells cells cells cells
exon exon exon exon
1 1 1 1
4
Stem Cell Research 39 (2019) 101517
J. Menges, et al.
Declaration of Competing Interest
doi.org/10.1016/j.scr.2019.101517.
None
References
Acknowledgments
Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., Zhang, F., 2013. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8 (11), 2281–2308. Steenpass, L., 2017. Generation of heterozygous and homozygous hESC H9 sublines carrying inactivating mutations in RB1. Stem Cell Res. 25, 270–273. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., Jones, J.M., 1998. Embryonic stem cell lines derived from human blastocysts. Science 282 (5391), 1145–1147.
This work was funded by the Deutsche Förderprogramm für Augenheilkunde (Germany). We thank Michaela Hiber and Elke Jürgens for their help in performing STR analysis and karyotyping. Appendix A. Supplementary data Supplementary data to this article can be found online at https://
5