Genes induced by a high-oxygen environment in Entamoeba histolytica

Molecular & Biochemical Parasitology 133 (2004) 187–196

Genes induced by a high-oxygen environment in Entamoeba histolytica Md. Ali Akbar a , Nabendu Sekhar Chatterjee b , Paramita Sen a , Anjan Debnath a , Amit Pal c , Tanmoy Bera d , Pradeep Das a,∗ a

Department of Microbiology, National Institute of Cholera and Enteric Diseases, P-33 C.I.T. Road, Scheme-XM, Kolkata-700 010, West Bengal, India Department of Biochemistry, National Institute of Cholera and Enteric Diseases, P-33 C.I.T. Road, Scheme-XM, Kolkata-700 010, West Bengal, India Department of Pathophysiology, National Institute of Cholera and Enteric Diseases, P-33 C.I.T. Road, Scheme-XM, Kolkata-700 010, West Bengal, India d Department of Pharmaceutical Technology, Jadavpur University, Kolkata, India b

c

Received 3 June 2003; received in revised form 15 October 2003; accepted 16 October 2003

Abstract Entamoeba histolytica, although a microaerophilic protozoan parasite, encounters a high-oxygen environment, during invasive amoebiasis. The parasite requires specific regulation of certain proteins to maintain its physiological functions to survive in the more oxygenated condition. Our endeavor was to know how does amoeba adapt itself in a high-oxygen environment. Reactive oxygen species (ROS) was found to accumulate in an increasing concentration within the stressed trophozoites in a time-dependent manner. Increased cytopathic activity was detected at 2 h in high-oxygen-exposed E. histolytica lysate compared to lysate of normal E. histolytica trophozoites by Ussing chamber assay. The differential display and semi-quantitative polymerase chain reaction showed overexpression in the mRNA levels of thiol-dependent peroxidase (Eh29), superoxide dismutase (SOD), EhCP5, G protein, HSP70, and peptidylprolyl isomerase at different time periods of oxidative stressed trophozoites compared to normally cultured E. histolytica. Analyses of the up-regulated genes that are associated with stress response, viz., signal transduction, tissue destruction, and oxidative stress management, including enhanced expression of a 29-kDa Eh29, suggest that this organism has several protective mechanisms to deal with oxidative stress during invasion. © 2003 Elsevier B.V. All rights reserved. Keywords: Entamoeba histolytica; Oxidative stress; Ussing chamber; ROS; Semi-quantitative PCR; DD-PCR

1. Introduction The enteric protozoan parasite, Entamoeba histolytica is the causative agent of human amoebiasis, a disease that is surpassed only by malaria and trichomoniasis as a parasitic cause of death [1]. Normally, resident of large bowel, E. histolytica persists for month or even years as an asymptomatic luminal gut infection. However, occasionally, the parasite penetrates the intestinal mucosa and disseminate to other organs, most commonly to the liver where they induce abscess formation [2]. E. histolytica, a microaerophilic organism, does not usually tolerate elevated oxygen concentration. However, during tissue invasion, trophozoites are exposed to an increasing concentration of oxygen [3]. Living aerobic organisms, from prokaryotes to complex eukaryotes, have developed elaborate sequences of adaptive mechanisms to maintain oxygen homeostasis and equilibrium [4–6]. Any ∗ Corresponding author. Tel.: +91-33-2350-0448; fax: +91-33-2350-5066. E-mail address: [email protected] (P. Das).

0166-6851/$ – see front matter © 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.molbiopara.2003.10.006

deviation from homeostasis, or physiological change in oxygen pressure, is recognized as an exposure to oxidative stress [7–10]. Generation of reactive oxygen species (ROS) is a characteristic of oxidative stress in living systems. E. histolytica could avoid the oxidative burst through an iron-containing superoxide dismutase (SOD) that can be induced by superoxide anions to produce H2 O2 [11]. In addition, a bifunctional NADPH:flavin oxidoreductase containing NADPH-dependent disulfide reductase and H2 O2 forming NADPH oxidase activities could aid in the detoxification of hydroperoxides produced during an oxidative stress [12,13]. Evidence also exists that E. histolytica have no detectable amount of catalase but a cysteine-rich 29-kDa protein (thiol-dependent peroxidase, Eh29) which has been shown to eliminate H2 O2 [14–16]. In the present investigation, attempt has been made to know the genes necessary for E. histolytica survival in high-oxygen environment. Differential display RT–PCR method [17,18] and semi-quantitative RT–PCR techniques have been demonstrated as a sensitive approach to identify changes in gene expressions in eukaryotic as well as prokaryotic cells. Here, we have applied differential dis-

188

Md.A. Akbar et al. / Molecular & Biochemical Parasitology 133 (2004) 187–196

play and semi-quantitative RT–PCR techniques to compare RNA expression among E. histolytica grown under normal culture conditions and trophozoites exposed for different hours in high-oxygenated environment. The results obtained highlight the genes that are differentially expressed in high-oxygen environment-exposed cells and their possible role in survival of the parasite in high-oxygen environment during invasion.

2. Materials and methods 2.1. Cultivation and oxidative stress of Entamoeba histolytica Trophozoites of E. histolytica isolate HM1:IMSS were cultured axenically in TYI-S-33 medium supplemented with 10% heat-inactivated bovine sera and 3% complete vitamin mix at 35 ◦ C [19]. For stress experiments, trophozoites in logarithmic growth phase were washed once with pre-warmed complete TYI-S-33 medium and chilled on ice for 5 min to dislodge the cells from tube surfaces. Briefly, 2 × 106 trophozoites in 20 ml complete TYI-S-33 medium were transferred to a 90-mm tissue culture petri dish aseptically and kept at 35 ◦ C for different time periods (1–8 h). After each exposure, culture medium was decanted and the adhered amoeba were collected. The viability of trophozoites was examined by Trypan blue exclusion principle (0.5 mg/ml). Only those time periods were considered where the cell viability was more than 90%. 2.2. Detection of ROS production Control and stress-derived E. histolytica trophozoites were incubated with 0.4 mM (final concentration) 2 ,7 dichlorofluorescin diacetate (H2 DCFDA, Sigma) for 15 min in dark. The cells were washed twice in PBS (pH 7.4) and immediately examined under a confocal microscope (ZEISS, LSM510) [20]. 2.3. Electrophysiological effect of pathogenic factors of Entamoeba histolytica Ussing chamber was used to assay pathogenic effect of control and different hours stressed trophozoites. All experiments were performed on segments of large intestine of adult albino rats weighing 300–350 g. Animals were sacrificed under pentobarbital anesthesia. A 10-cm long segment of large intestine was removed, rinsed free of its intestinal contents, opened along the mesenteric border. Four sheets of mucosa so prepared were then mounted in leucite Ussing chamber CHM2 (World Precision Instrument, USA) having a 90-mm aperture diameter, bathed by freshly prepared buffer containing (mM): NaCl 115, NaHCO3 2.5, K2 HPO4 2.4, KH2 PO4 0.4, MgCl2 1.2, and CaCl2 1.2. The bathing solution was maintained at 37 ◦ C with water-jacketed reser-

voirs connected to a constant temperature circulating pump and gassed with 5% CO2 . Potential volts difference (PD) and start circuit current (Isc ) were measured as previously described [21]. Once the PD reached a steady state, different concentrations of test materials were added to the luminal surface. Amoeba lysates were prepared by freeze and thawing of 50,000 trophozoites from control and stressed trophozoites, finally resuspended in 2 ml of Ringer’s solution at 37 ◦ C to obtain 20,000 lysed trophozoites/ml. At the end of the experiment, 200 ␮l of 0.5 M glucose was added to the mucosal side of each chamber. Only those tissues, which showed an increase in Isc in response to glucose indicating tissue viability, were included in the analysis. The institutional Animal Review Board approved the use of rat in this study, and animal experiments were conducted following all regulatory guidelines. 2.4. Isolation of total RNA Total RNA was isolated from control and 1, 2, and 3 h of high-oxygen-exposed trophozoites of E. histolytica using TRIZOL reagent (Gibco BRL, USA) following the manufacturer’s protocol. 2.5. Differential display PCR Differential display was performed using the RNA image kit (GenHunter, USA) essentially following the manufacturer’s instructions. Briefly, 0.2 ␮g of total RNA was reverse transcribed using 100 U ExpandTM Reverse Transcriptase (Roche, Germany) and three different onebase-anchored H-T11 M primers (where M may be A, G, or C) for 60 min at 42 ◦ C with a final denaturation for 2 min at 95 ◦ C. An aliquot of the first strand was subjected to PCR employing the corresponding one base (0.2 ␮M) or two-base-anchored oligonucleotide (1 ␮M) along with either one of the random primers, dNTPs, 1 U. Taq polymerase (Qiagen, Germany) and 60 nM [␣-33 P]dATP (2500 Ci/mmol) in a 20 ␮l final volume. Subsequent to an initial 30-s denaturation at 94 ◦ C, 40 amplification cycles were performed (30 s at 94 ◦ C, 2 min at 40 ◦ C, 30 s at 72 ◦ C, then a final 5 min at 72 ◦ C). Two controls (an RT negative control containing RNA instead of cDNA and a PCR negative control containing neither cDNA nor RNA) were included in the study for both normal and high-oxygen-exposed E. histolytica. Both RT and PCR were performed in duplicate. An aliquot of the PCR amplified product was mixed with formamide loading dye and analyzed on a 6% urea–TBE polyacrylamide sequencing gel. After electrophoresis, the gel was transferred onto 3-mm Whatman paper, dried at 80 ◦ C for 1 h, and exposed to X-ray film (Kodak, Japan). After autoradiogram analyses, fragments of interest were excised from the gel and soaked in sterile water for 10 min to allow gel rehydration. The cDNAs were allowed to diffuse out from the gel after boiling for 15 min, and precipitated with ethanol at −80 ◦ C for 30 min. Pellets were washed

Md.A. Akbar et al. / Molecular & Biochemical Parasitology 133 (2004) 187–196

189

in 85% ice-cold ethanol and resuspended in sterile water. Eluted cDNA was reamplified with the same primer by PCR under the same cycle conditions used in initial DD-PCR.

Table 1 Oligonucleotides used in differential RT–PCR experiments Primer name

Sequence

Accession number

2.6. Cloning and sequencing of amplicons

eh29 F eh29 R sod F sod R fer F fer R apB F apB R apC F apC R ehcp5 F ehcp5 R act F act R

5 TCAATCAGTCAAATGTCTTGC3 5 GAATGTCAACTTTCCTACTCC3 5 AATGCTCTTGAGCCTCA3 5 CTTCCAGTTGACTACATTCC3 5 CATCAATTTGGGGAGCTAC3 5 CAACAGCTCCAAGATTGGT3 5 GCAACAAGAGAAGGAGCTA3 5 CAAAGAGTTCCAAGGAATCC3 5 CAACAAGACAGAGAAATTCC3 5 ATGCATGAATCAACCCACA3 5 GTTGATGAACATTCTTTACTATT3 5 GTTGATGAACATTCTTTACTATT3 5 GAGGATATGCTTTCACCACT3 5 ATAGCTGGTCCAGATTCATC3

X70996

The reamplified DNA was purified, cloned in TOPO TA vector (Invitrogen, USA) and the transformants were analyzed by PCR. Cloned inserts were then sequenced by automated DNA sequencer (ABI Prism 310 system, Perkin-Elmer). The sequencing reaction was done using BigDyeTM Terminator Cycle Sequencing Kit (Applied Biosystems, USA). 2.7. Northern blot analysis Twenty micrograms of total RNA from control and stressed E. histolytica trophozoites was denatured in formaldehyde–formamide buffer and subjected to electrophoresis on 1% denaturing agarose–formaldehyde gel. The gel was stained with ethidium bromide (EtBr) to ensure equal loading. Size-fractionated RNAs were then transferred to Nytran membrane (Hybond N+ , Amersham) and hybridized at 42 ◦ C following the standard procedure [22]. All the differentially identified cDNA fragments were released from TA vector by EcoRI digestion and eh29 fragment generated by PCR were gel purified by Qiagen kit (Qiagen) following the manufacturer’s instructions and quantified in GenQuant Pro spectrophotometer (Amersham Bioscience, USA). Various fragments of different genes were then radiolabeled with [␣-32 P]dCTP (3000 Ci/mmol) using Random Primer DNA Labeling Kit (Roche) and were used as probes. In the case of differentially expressed cDNAs, the corresponding oligo dT was added during labeling to improve radionucleotide incorporation and also to enhance the signal. The overnight hybridized membranes were washed twice for 15 min at room temperature with 1× SSC containing 0.1% SDS, and once for 20 min at 55 ◦ C with 0.25× SSC containing 0.1% SDS. Finally, the dried membranes were exposed to X-ray film with an intensifying screen at −80 ◦ C. All the Northern blots were performed by sequential hybridization. After developing the film the membrane was deprobed by treating with 0.1N NaOH at room temperature for 5 min, followed by extensive rinsing in 1× SSC. In order to ensure an equivalent quantity of RNA on the blots, the deprobed membrane was then hybridized with labeled E. histolytica actin DNA. 2.8. Semi-quantitative RT–PCR Reverse transcription was performed as mentioned above using 0.2 ␮g of total RNA from different hours oxygenexposed trophozoites. An aliquot of synthesized cDNAs were amplified by PCR using same master mix for each time point. Details of the genes that were amplified, PCR conditions and the primers used are summarized in Tables 1 and 2.

M63816 Z50193 X76904 X76903 X91644 M16341

All the primers were synthesized from Sigma-Biogenesis. eh29, thiol-dependent peroxidase; sod, superoxide dismutase; fer, pyruvate:ferredoxin oxidoreductase; apB, amoebapore B; apC, amoebapore C; act, actin; and ehcp5, cysteine protease 5 of Entamoeba histolytica. F and R represent forward and reverse primers, respectively.

The linear range of the PCR amplification has been verified by quantifying the cDNA-PCR product obtained after amplifications for 15–30 cycles (data not shown). All PCRs were performed for 25 cycles, which was within the linear range of amplification of the corresponding mRNA species. The products were run on 1% agarose gel, stained with ethidium bromide, and finally quantitated using Quantity One software (Bio-Rad, USA). All the amplified RT–PCR products were normalized with respect to actin RT–PCR product. 2.9. Immunoblot assay Electrophoretically, 80 ␮g of proteins from control and high-oxygen-exposed trophozoites lysate were resolved in 10% acrylamide gel and transferred onto nitrocellulose membrane. The membrane was washed with TBS, pH 7.2, and blocked with 3% BSA (Sigma) at 37 ◦ C for 2 h and reacted with 1:1000 dilution of NICED 11 ascites [23] Table 2 PCR conditions used for detection of different mRNA species induced during exposure in higher oxygen environment Primer combination

Annealing temperature (◦ C)

Expected PCR product (bp)

eh29 F + eh29 R fer F + fer R sod F + sod R act F + act R ehcp5 F + ehcp5 R apB F + apB R apC F + apC R

55 55 50 55 50 55 55

422 519 516 519 377 149 244

Description of the primers is listed in Table 1. Primer combination, annealing temperature, and expected product size are listed. In all PCR, after initial denaturation at 94 ◦ C for 5 min, targeted genes were amplified by 25 amplification cycles (94 ◦ C for 30 s, 55 or 50 ◦ C for 30 s, and 72 ◦ C for 1 min) followed by a final extension at 72 ◦ C for 5 min.

190

Md.A. Akbar et al. / Molecular & Biochemical Parasitology 133 (2004) 187–196

and anti-fibronectin monoclonal antibody (1:500 dilution) [24]. The antigen–antibody reaction was probed with an anti-mouse IgG conjugate (Jacson Immuno Research, USA). The color reaction was developed with 0.5% diaminobenzedene tetrahydrochloride (Sigma) containing 0.03% H2 O2 .

suggesting that this lysate has a maximum cytopathic effect on the intestinal tissue mounted in leucite Ussing chamber. Electrical property and tissue viability of the colonic preparation were checked by adding glucose at the end of the experiment to the Ussing hemichamber (data not shown).

2.10. Densitometric analysis

3.3. Identification and characterization of differential amplicons

All the Northern films and semi-quantitative RT–PCR gels were photographed and analyzed using Quantity One software (Bio-Rad). 2.11. Statistical analysis Data are mean ± S.E.M. of multiple experiments. Statistical differences were analyzed by one-way ANOVA with statistical significance being set at 0.01 (P < 0.01).

3. Results 3.1. ROS response in high-oxygen pressure The response of E. histolytica trophozoites to high-oxygen environment was investigated with respect to ROS level. The level of ROS was determined within the live trophozoites using H2 DCFDA, which was converted into highly fluorescent dichlorofluorescein (DCF) in the presence of ROS. The increase of fluorescence is an indication of an increase in ROS level. Confocal microscope picture of live E. histolytica cells clearly showed very little fluorescence in control trophozoites (Fig. 1, Panel A, Plate C) and intense fluorescence in oxygen-exposed trophozoites. The fluorescence intensity increased with the oxygen exposure time periods (Fig. 1, Panel A, Plates 1–3). The maximum fluorescence intensity was observed at 3-h oxygen-exposed trophozoites as compared to control. The order of fluorescence intensity observed in E. histolytica trophozoites was 3 h > 2 h > 1 h > control. 3.2. Electrophysiological effect of pathogenic factors of Entamoeba histolytica Amoebic lysates from control and oxygen-exposed trophozoites were tested in Ussing chamber. Transepithelial potential difference (PD) and short circuit current (Isc ) were measured before and after the addition of these lysates. The change in potential difference (PD) in millivolt (mV) of the negative (−Ve), 0.23 ± 0.047; C, 0.6 ± 0.081; 1 h, 0.93 ± 0.047; 2 h, 1.2 ± 0.057; 3 h, 1.0 ± 0.081, respectively, and change in Isc (␮A/cm2 ) of negative (−Ve), 4.3 ± 0.94; C, 8.7±1.7; 1 h, 16.7±1.7; 2 h, 21.3±2.05; 3 h, 18.7±1.25, respectively. After lysate addition, the PD and Isc were stable for about 20 min and then decreased immediately and significantly (P < 0.05) (Fig. 2). The change in both PD and Isc was more in 2-h stressed lysate of E. histolytica,

Comparisons of DD-PCR between control and oxygenexposed E. histolytica revealed complex patterns by the different primer combinations. Six amplicons (three from HAP18/HT11 A, two from HAP20/HT11 C, and one from HAP19/HT11 G primer sets, GenHunter) that showed greatest difference in intensity in oxygen-exposed trophozoites were selected for analysis. The expression of other genes was stable or appeared to be downregulated. These were not considered for further analysis. Only AE5 band was chosen because this was specifically downregulated at 2-h exposure. Those bands showing the greatest difference in intensity in the test lanes compared to control lane (Fig. 3, bands AE1–AE6), were excised from the gel, reamplified, subcloned, and sequenced. The length of the various fragments ranged between 200 and 450 bp, and were flanked by the respective arbitrary and degenerate one-base-anchored oligo dT. BLAST searches with the E. histolytica genome database revealed that all the amplicons corresponded to five independent amoeba genes. Primary amino acid sequence deduced from all clones showed that two of them (AE2 and AE3) were same. Therefore, five clones could be attributed to already known four different proteins of E. histolytica and one with an unknown function (Table 3). 3.4. Northern blot analysis The specificity of up-regulation of the transcripts identified by differential display was confirmed by Northern hybridization (Fig. 4). All the blots were performed with probes prepared from cDNA fragments, designated AE1, AE2, AE4, AE5, and AE6. Northern hybridization with probes prepared from clones AE1 and AE2 showed pronounced increase in mRNA levels following 2-h exposure to high-oxygen environment. Probe prepared from AE4 showed more signals in 1-h stressed cells compared to control in Northern blot. No signal was detected with probe AE5. The probe prepared from AE6 showed enhancement of this transcript level in both 1- and 2-h stressed cells compared to control. All the differentially expressed amplicons chosen showed a pronounced increase in mRNA levels in the Northern blot experiments, confirming the differential display results. 3.5. Semi-quantitative RT–PCR Expression levels of conventional oxidative stress management genes as well as pore forming genes were mea-

Md.A. Akbar et al. / Molecular & Biochemical Parasitology 133 (2004) 187–196

191

Fig. 1. Visualization of reactive oxygen species (ROS) production. Control and stressed Entamoeba histolytica trophozoites were incubated with H2 DCFDA and examined under confocal microscope (see Section 2.2). C, control; 1, 2, and 3, represent E. histolytica trophozoites that were exposed for 1, 2, and 3 h in high-oxygen environment, respectively. (Panel A) Relative expression of ROS in E. histolytica trophozoites as viewed under laser confocal microscope. (Panel B) Densitometric analysis of relative fluorescence intensity of some trophozoites in C, 1, 2, and 3. C represents control and 1, 2, and 3 represent 1-, 2-, and 3-h stressed cells, respectively. Data represent mean ± S.E.M. of three independent experiments; P < 0.05. Table 3 High-oxygen-induced genes of Entamoeba histolytica showed similarity to different proteins in the protein database Clone

Putative identity

Function

Protein accession number

AE1 AE2 and AE3 AE4 AE5 AE6

DnaK-type molecular chaperone Hsp70 Peptidylprolyl isomerase Cysteine proteinase Unknown G protein beta family

Stress response cis/trans conversion of X-probond Degradation of extracellular matrix components – Signal transduction

A48439 NP 189160 CAA62835 – NP 565615

The identities of the clones after database search are listed.

192

Md.A. Akbar et al. / Molecular & Biochemical Parasitology 133 (2004) 187–196

control (Fig. 5C and D). So, the change in mRNA level was prominent at 1 h of exposure to high-oxygen environment. These RT–PCR results were verified with Northern blots and are in well accordance with our findings (data not shown). 3.6. Immunoblot assay In immunoblot analysis, the amount of Eh29 was always more in high-oxygen-exposed trophozoites compared to control. The level of fibronectin, used as internal control, remains same in all the samples (Fig. 6). 4. Discussion

Fig. 2. Effect of Entamoeba histolytica control and high-oxygen-exposed trophozoite lysates on the electrophysiological property of rat colon. Effect of control (C) and high-oxygen-exposed trophozoite lysates (1, 2, and 3 represents high-oxygen exposure for 1, 2, and 3 h, respectively) were examined by Ussing chamber. Ringer’s solution alone was used as negative control (−Ve). Both hemichambers were first filled with Ringer’s solutions and gas was charged after each sheet of colon was mounted. Once steady state was reached, 50,000 lysed trophozoites from each test sample was added to the mucosal hemichamber and only Ringer’s solution to the serosal hemichamber. Both the hemichambers were gassed with O2 /CO2 . (Panel A) The change in potential difference (PD) in millivolt (mV) and (Panel B) the change in Isc (␮A/cm2 ) with respect to high-oxygen exposure time periods.

sured by semi-quantitative PCR. The enzymes SOD and Eh29 were found to be increased by 1.7- and 2.1-fold, respectively, in 1-h high-oxygen-exposed trophozoites as compared to control, but no significant change was observed in pyruvate:ferredoxin oxidoreductase mRNA level (Fig. 5A and B). The mRNA level of amoebapore C gene was found to be similar in control as well as in high-oxygen-exposed trophozoites. In case of amoebapore B gene, mRNA level was found to decrease during 1 h of exposure, whereas in 2 and 3 h, mRNA level was more or less similar to that of

In the present investigation an attempt was made to characterize the high-oxygen environment-regulated genes in E. histolytica trophozoites in an effort to understand the survival of the parasite in high-oxygen environment particularly in extraintestinal amoebiasis. The balance between survival of the infecting E. histolytica trophozoites and the combined effect of oxidative stress plus mucosal immunity presumably determines the degree of extraintestinal amoebiasis by the parasite. To avoid the oxidative burst during and after invasion, trophozoites require the specific regulation of number of proteins. Information on these molecules would be important for the understanding of E. histolytica pathogenesis. Shifting of the trophozoites from microaerophilic environment (low oxygen pressure) to high-oxygen environment produced ROS and it was visualized with fluorescent microscopy using 2 ,7 -dichlorofluorescin diacetate (H2 DCFDA) as a probe. The activation of H2 DCF is relatively specific for the detection of H2 O2 and for secondary and tertiary peroxides. The comparative analysis of ROS levels in stressed trophozoites demonstrated 2-, 2.75-, and 3.5-fold increase in 1-, 2-, and 3-hr high-oxygen-exposed trophozoites compared to normally grown trophozoites (Fig. 1, Panel B). These results are in accordance with a higher loss of cellular viability after the stress on cells in higher oxygenated conditions (data not shown).

Fig. 3. Differential RNA expression in control and stress-derived Entamoeba histolytica. cDNA from control (C), 1-, 2-, and 3-h high-oxygen exposure E. histolytica were used as template for amplification with different sets of arbitrary primers in DD-PCR. The detail procedure is described in text. Panels A, B, and C represent the different autoradiogram regions obtained after DD-RT–PCR. Amplicons obtained by PCR that were further analyzed are indicated by arrows (AE1–AE6). The data shown are representatives of different independent PCR experiments; each experiment was performed twice using cDNA from two different RNA preparations.

Md.A. Akbar et al. / Molecular & Biochemical Parasitology 133 (2004) 187–196

193

Fig. 4. Northern analysis of high-oxygen-induced mRNA. Northern blot was performed as described in Section 2.7 using total RNA from control (C), 1, 2, and 3, which represents 1, 2, and 3 h of high-oxygen exposure of Entamoeba histolytica. (Panel A) Northern blot analysis. Probes used for hybridization were labeled with 32 P. The data shown are representatives of three independent experiments. Identity of these clones is indicated in Table 3. (Panel B) Densitometric analysis of relative intensity of the induced mRNA.

The differentially overexpressed genes among E. histolytica, grown under normal culture conditions and cells exposed to higher oxygen environment for different hours, revealed specific regulation of six genes. Among them, Hsp70 (AE1), was overexpressed in 2-h stressed trophozoites. The heat shock protein 70 kDa (HSP70) has a great importance as molecular chaperones in protein folding, transport and are abundant under conditions of cellular stress. The E. histolytica Hsp70, similar to the higher eukary-

otic cytoplasmic sequences [25], induced humoral immune response in a group of patients with invasive amoebiasis suggesting that this protein has an important role in amoebiasis and also in E. histolytica biology [26]. This correlates well with our present finding. Sequence analysis showed that AE2 and AE3 were identical. This could be due to the fact that the poly(A) tail of mRNA is not always added at a fixed position downstream of the polyadenylation signal [27]. Both the clones AE2 and AE3, which encode for peptidylprolyl iso-

194

Md.A. Akbar et al. / Molecular & Biochemical Parasitology 133 (2004) 187–196

Fig. 5. Semi-quantitative RT–PCR analysis. Entamoeba histolytica trophozoites exposed to high-oxygen environment for different hours were analyzed by RT–PCR. The PCR products were separated on (1%) agarose gel and stained with EtBr. Primers used are described in Table 1; PCR conditions are mentioned in Table 2. C, 1, 2, and 3 represent control, 1, 2, and 3 h of high-oxygen exposure of E. histolytica, respectively. (Panels A and C) PCR products as seen on agarose gel. The data shown here are representatives of three independent experiments. (Panels B and D) EtBr-stained PCR products were photographed, and then images were analyzed. PCR products were quantitated and expressed as the ratio of each product with respect to actin band density. Data represent mean ± S.E.M. of three independent experiments. ∗ P < 0.05. Control (dotted bar), 1 h (hatched bar), 2 h (horizontal bar), and 3 h (gray bar) of high-oxygen-exposed E. histolytica.

merase (PPIase) were also found to be overexpressed in 2-h stressed cells. PPIase is essential for protein folding in vivo. Recently, PPIase activity was suggested in playing a role in regulation of transcription, differentiation [28] and involvement in oxygen stress [29]. Increased level of PPIase gene by oxygen stress suggests its involvement in oxidative defense in E. histolytica. The clone AE6, which encodes for G protein beta family, was found to be overexpressed in 1-h as well as 2-h high-oxygen-exposed trophozoites. Exposure of cells to oxidative stress can induce alterations in various signal transduction cascades that lead to changes in the activity of related transcription factors. G protein regulates expression of a wide range of cellular genes, which have an important role in maintaining proper cellular functions to overcome

stress responses. Clone AE4, which was overexpressed at 1h exposure to high-oxygen environment, coded for cp5 gene. CP5 has been suggested to have a potential role in tissue destruction and also in liver abscess formation. Que et al. [30] showed that CP5 may block the host inflammatory response by inactivating IL-18. Here, in our study, overexpression of CP5 during high-oxygen exposure suggests that it has an important role both in gut invasion as well as inflammation. In Ussing chamber, changes in transepithelial potential difference (PD) and short circuit current (Isc ) were observed. These changes may be due to either proteases and/or pore forming proteins. The pore forming peptide amoebapore of E. histolytica is implicated in the killing of phagocytosed bacteria and in the cytolytic reaction of amoeba in the host

Md.A. Akbar et al. / Molecular & Biochemical Parasitology 133 (2004) 187–196

Fig. 6. Detection of Eh29 level in control and high-oxygen-exposed Entamoeba histolytica trophozoite lysate. Immunoblot was prepared by resolving amoeba lysates from control and different hours of high-oxygen-exposed cells. The blot was developed with Eh29 specific monoclonal antibody (NICED 11) and anti-fibronectin monoclonal antibody; C, control; 1, 2, and 3 represent 1, 2, and 3 h of high-oxygen-exposed E. histolytica trophozoites, respectively.

195

conditions to prevent deleterious production of H2 O2 . This result is in accordance with our finding that remarkable change in expression of this protein was detected by Western blot among the control and different hours oxygen-exposed cells using MAb specific for Eh29-kDa as probe. Our findings strongly support the synchronous involvement of SOD and Eh29 in detoxification of ROS. In summary, we have demonstrated that during oxidative stress in E. histolytica, and probably during invasive amoebiasis, different genes are overexpressed, which have an important role in pathogenesis and survival of the parasite.

Acknowledgements cells [31]. In semi-quantitative RT–PCR, no changes in pore forming peptide genes were observed. These findings clearly suggest that the change in transepithelial potential difference (PD) and short circuit current (Isc ) in Ussing chamber are due to proteases. Earlier observations [32,33] indicated that the cysteine proteases were primarily responsible for cytopathic activity of E. histolytica. So, the enhanced cytopathic activity in Ussing chamber may be due to the cysteine proteases. The overexpression of ehcp5 in DD-PCR and enhanced cytopathic effect in Ussing chamber experiment indicate the correlation of cysteine proteases with the pathology of invasion. The DD-PCR technique has a limitation in detection of global gene expression of a system, so the relative expression of some important genes was verified by semi-quantitative PCR. In RT–PCR experiments, we found differential expression at mRNA levels of detoxification enzymes, namely, pyruvate:ferredoxin oxidoreductase, SOD, and Eh29, which are major components of oxidative stress. The SOD enzymes are a family of metalloenzymes responsible for quenching of the potentially deleterious effects of the superoxide radical [34]. Differential inducibility of this enzyme in response to oxidative stress has been demonstrated in several organisms [35]. In E. histolytica, elevated level of superoxide radicals results in higher expression of iron-containing SOD [11]. Based upon our observations along with results from other investigators, it appears that induction of SOD activity is due to changes in mRNA levels, either due to increased transcription initiation or mRNA stability. We observed that the NICED 11 MAb produced against the highly immunogenic soluble fraction of E. histolytica lysate [23], reacted with a single polypeptide of 29-kDa size in whole E. histolytica extract and has the ability to detect and differentiate current amoebic infection from past directly in stool samples by ELISA [36]. The screening of E. histolytica cDNA library by NICED 11 MAb and nucleotide sequencing of the positive plaque showed homology with Eh29 (Ali et al., manuscript under preparation). Recombinant Eh29 protein has been used to accurately serodiagnose amoebiasis without cross-reactivity from other parasites [37]. One of the major conclusions of the present work is the importance of overexpression of Eh29 under oxidative stress

This work was supported by the Council of Scientific & Industrial Research (CSIR) and Department of Biotechnology (DBT), India.

References [1] World Health Organization. The world health report 1998. Life in the 21st century: a vision for all. Geneva: World Health Organization. [2] Ravdin JI. Human infection by Entamoeba histolytica. In: Ravdin JI, editor. Amoebiasis: human infection. New York: Wiley; 1988. p. 166–76. [3] Martinez-Palomo A, Espinosa Cantellano M. Intestinal amoebae. In: Collier L, Balows A, Sussman M, editors. Topley and Wilson’s microbiology and microbial infections. 9th ed., vol. 5. Parasitology. London, UK: Arnold; 1998. p. 157–77. [4] Acker H. Mechanisms and meaning of cellular oxygen sensing in the organism. Respir Physiol 1994;95:1–10. [5] Peers C, Kemp PJ. Acute oxygen sensing: diverse but convergent mechanisms in airway and arterial chemoreceptors. Respir Res 2001;2:145–9. [6] Wenger RH. Mammalian oxygen sensing, signaling and gene regulations. J Exp Biol 2000;203:1253–63. [7] Arrigo AP. Gene expression and the thiol redox state. Free Radic Biol Med 1999;27:936–44. [8] Bickler PE, Buck LT. Adaptations of vertebrate neurons to hypoxia and anoxia: maintaining critical Ca2+ concentrations. J Exp Biol 1998;201:1141–52. [9] Richalet JP. Oxygen sensors in the organism: examples of regulation under altitude hypoxia in mammals. Comp Biochem Physiol A Physiol 1997;118:9–14. [10] Sen CK, Packer L. Antioxidant and redox regulation of gene transcription. FASEB J 1996;10:709–20. [11] Bruchhaus I, Tannich E. Induction of the iron-containing superxoide dismutase in Entamoeba histolytica by a superoxide anion-generating system or by iron chelation. Mol Biochem Parasitol 1994;67:281–8. [12] Bruchhaus I, Tannich E. Identification of an Entamoeba histolytica gene encoding a protein homologous to prokaryotic disulphide oxidoreductases. Mol Biochem Parasitol 1995;70:187–91. [13] Bruchhaus I, Richter S, Tannich E. Recombinant expression and biochemical characterization of an NADPH:flavin oxidoreductase from Entamoeba histolytica. Biochem J 1998;330:1217–21. [14] Flores BM, Batzer MA, Stein MA, Petersen C, Diedrich DL, Torian BE. Structural analysis and demonstration of the 29-kDa antigen of pathogenic Entamoeba histolytica as the major accessible free thiolcontaining surface protein. Mol Microbiol 1993;7:755–63.

196

Md.A. Akbar et al. / Molecular & Biochemical Parasitology 133 (2004) 187–196

[15] Bruchhaus I, Tannich E. Analysis of the genomic sequence encoding the 29-kDa cysteine-rich protein of Entamoeba histolytica. Trop Med Parasitol 1993;44:116–8. [16] Bruchhaus I, Richter S, Tannich E. Removal of hydrogen peroxide by the 29-kDa protein of Entamoeba histolytica. Biochem J 1997;326:785–9. [17] Liang P, Pardee AB. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 1992;257:967–71. [18] Liang P, Pardee AB. Recent advances in differential display. Curr Opin Immunol 1995;7:274–80. [19] Diamond LS, Harlow DR, Cunnick CC. A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans R Soc Trop Med Hyg 1978;72:431–2. [20] Bourre L, Thibaut S, Briffaud A, Rousset N, Eleouet S, Lajat Y, et al. Indirect detection of photosensitizer ex vivo. J Photochem Photobiol B 2002;67:23–31. [21] Navarrogarcia F, Lopez-Revilla R, Tsutsumi V, Luis reyes L. Entamoeba histolytica: electrophysiologic and morphologic effects of trophozoite lysates on rabbit colon. Exp Parasitol 1993;77:162–9. [22] Sambrook J, Russell WD. Molecular cloning—a laboratory manual. 3rd ed. New York: Cold Spring Harbor Laboratory Press. [23] Sengupta K, Das P, Johnson TM, Chaudhuri PP, Das D, Nair GB. Production and characterization of monoclonal antibodies against a highly immunogenic fraction of Entamoeba histolytica (NIH:200) and their application in the detection of current amoebic infection. J Eukaryot Microbiol 1993;40:722–6. [24] Sengupta K, Hernandez-Ramirez VI, Rios A, Mondragon R, TalamasRohana P. Entamoeba histolytica: monoclonal antibody against the beta1 integrin-like molecule (140 kDa) inhibits cell adhesion to extracellular matrix components. Exp Parasitol 2001;98:83–9. [25] Karlin S, Brocchieri L. Heat shock protein 70 family: multiple sequence comparisons, function, and evolution. J Mol Evol 1998;47:565–77.

[26] Ortner S, Plaimauer B, Binder M, Wiedermann G, Scheiner O, Duchene M. Humoral immune response against a 70-kilodalton heat shock protein of Entamoeba histolytica in a group of patients with invasive amoebiasis. Mol Biochem Parasitol 1992;54:175–83. [27] Liang P, Pardee AB. Differential display. A general protocol. Mol Biotechnol 1998;10:261–7. [28] Andreeva L, Heads R, Green CJ. Cyclophilins and their possible role in the stress response. Int J Exp Pathol 1999;80:305–15. [29] Santos AN, Korber S, Kullertz G, Fischer G, Fischer B. Oxygen stress increases prolyl cis/trans isomerase activity and expression of cyclophilin 18 in rabbit blastocysts. Biol Reprod 2000;62:1–7. [30] Que X, Kim SH, Sajid M, Eckmann L, Dinarello CA, McKerrow JH, et al. A surface amebic cysteine proteinase inactivates interleukin-18. Infect Immun 2003;71:1274–80. [31] Nickel R, Ott C, Dandekar T, Leippe M. Pore-forming peptides of Entamoeba dispar. Similarity and divergence to amoebapores in structure, expression and activity. Eur J Biochem 1999;265:1002–7. [32] Keene WE, Pettit GM, Allen S, McKerrow JH. The major neutral proteinases of Entamoeba histolytica. J Exp Med 1986;163:536–49. [33] Reed SL, Bouvier J, Pollack S, Engel JC, Brown M, Hirata K, et al. Cloning of a virulence factor of Entamoeba histolytica: pathogenic strains possess a unique cysteine proteinase gene. J Clin Invest 1993;91:1532–40. [34] Fridovich I. Superoxide radical and superoxide dismutases. Annu Rev Biochem 1995;64:97–112. [35] Lee J, Dawes IW, Roe JH. Adaptive response of Schizosaccharomyces pombe to hydrogen peroxide and menadione. Microbiology 1995;141:3127–32. [36] Das P, Sengupta K, Pal S, Das D, Pal SC. Biochemical and immunological studies on soluble antigens of Entamoeba histolytica. Parasitol Res 1993;79:365–71. [37] Lee J, Park SJ, Yong TS. Serodiagnosis of amoebiasis using a recombinant protein fragment of the 29-kDa surface antigen of Entamoeba histolytica. Int J Parasitol 2000;30:1487–91.