Genetic analysis of housekeeping genes of members of the genus Acholeplasma: Phylogeny and complementary molecular markers to the 16S rRNA gene

Molecular Phylogenetics and Evolution 44 (2007) 699–710 www.elsevier.com/locate/ympev

Genetic analysis of housekeeping genes of members of the genus Acholeplasma: Phylogeny and complementary molecular markers to the 16S rRNA gene Dmitriy V. Volokhov a,*, Alexander A. Neverov a, Joseph George a, Hyesuk Kong a, Sue X. Liu a, Christine Anderson a, Maureen K. Davidson b, Vladimir Chizhikov a b

a Center for Biologics Evaluation and Research, Food and Drug Administration, 1401 Rockville Pike, HFM-470, Rockville, MD 20852, USA Department of Veterinary Pathobiology, Purdue University School of Veterinary Medicine, 725 Harrison Street, West Lafayette, IN 47907, USA

Received 1 September 2006; revised 29 November 2006; accepted 1 December 2006 Available online 19 December 2006

Abstract The partial nucleotide sequences of the rpoB and gyrB genes as well as the complete sequence of the 16S–23S rRNA intergenic transcribed spacer (ITS) were determined for all known Acholeplasma species. The same genes of Mesoplasma and Entomoplasma species were also sequenced and used to infer phylogenetic relationships among the species within the orders Entomoplasmatales and Acholeplasmatales. The comparison of the ITS, rpoB, and gyrB phylogenetic trees with the 16S rRNA phylogenetic tree revealed a similar branch topology suggesting that the ITS, rpoB, and gyrB could be useful complementary phylogenetic markers for investigation of evolutionary relationships among Acholeplasma species. Thus, the multilocus phylogenetic analysis of Acholeplasma multilocale sequence data (ATCC 49900 (T) = PN525 (NCTC 11723)) strongly indicated that this organism is most closely related to the genera Mesoplasma and Entomoplasma (family Entomoplasmataceae) and form the branch with Mesoplasma seiffertii, Mesoplasma syrphidae, and Mesoplasma photuris. The closest genetic relatedness of this species to the order Entomoplasmatales was additionally supported by the finding that A. multilocale uses UGA as the tryptophan codon in its gyrB and gyrA sequences. Use of the UGA codon for encoding tryptophan was previously reported as a unique genetic feature of Entomoplasmatales and Mycoplasmatales but not of Acholeplasmatales. These data, as well as previously published data on metabolic features of A. multilocale, leads to the proposal to reclassify A. multilocale as a member of the family Entomoplasmataceae.  2006 Elsevier Inc. All rights reserved. Keywords: Mollicutes; rpoB and gyrB genes; Mycoplasmas

1. Introduction The bacterial genus Acholeplasma of the order Acholeplasmatales, family Acholeplasmataceae, currently includes 15 species: A. axanthum, A. brassicae, A. cavigenitalium, A. equifetale, A. granularum, A. hippikon, A. laidlawii, A. modicum, A. morum, A. multilocale, A. oculi, A. palmae, A. parvum, A. pleciae, and A. vituli (Woese et al., 1980; Neimark and London, 1982; Rogers et al., 1985; Pollack et al., *

Corresponding author. Fax: +1 301 827 9531. E-mail address: [email protected] (D.V. Volokhov).

1055-7903/$ - see front matter  2006 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2006.12.001

1996a; Angulo et al., 2000; Knight, 2004) (http:// www.ncbi.nlm.nih.gov/Taxonomy/). Acholeplasma species are widely distributed in the nature and can be detected and isolated from different plant, avian, and mammalian sources (Tully, 1984; Razin et al., 1998; Ayling et al., 2004). The Acholeplasma members are chemoorganotrophs and depend on carbohydrates and amino acids but, in contrast to the species of the family Mycoplasmataceae and Spiroplasmataceae do not require sterol for growth. The range of the growth temperature varies from 25 to 37 C (Rogers et al., 1985; Razin et al., 1998). All Acholeplasma species except for A. multilocale reduce the redox indicator

700

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710

benzyl viologen (Pollack et al., 1996a). The genome sizes of Acholeplasma range from 1215 kb (A. brassicae) to 2095 kb (A. vituli) with the GC contents vary from 28.3% (A. oculi) to 38.3% (A. vituli) (Tully et al., 1994; Artiushin et al., 1995; Angulo et al., 2000). Acholeplasma taxonomy is currently based on phenotypic criteria, predominantly biochemical and serological features, as well as genetic methods that include DNA–DNA hybridization and analysis of the 16S rRNA gene sequence relationships (Stephens et al., 1983; Razin et al., 1998; Knight, 2004). The application of the serological methods alone for Acholeplasma species identification may be complicated due to the previously reported interspecies cross-reactivity of antibodies (Tully, 1984). The phenotypic, predominantly metabolic, inter and intragenus Acholeplasma differentiation is based on the use of the following biochemical features: non-requirement of sterol for growth, fermentation of mannose, esculin and arbutin hydrolysis, carotenoid pigment production, and medium acidification due to the catabolism of some sugars (Tully, 1984; Pollack et al., 1996b; Pollack et al., 1997). Overall, in comparison with the currently available DNA identification methods, the traditional serological and biochemical identification of Acholeplasma species is laborious, time-consuming and restricted to specialized laboratories. As a result, the development of novel and simplified approaches capable of precisely identifying a bacterial species is highly desirable. Thus, investigations of intra and interspecies divergences of multiple chromosomal loci of Mollicutes provide valuable information for comprehensive genetic characterization of these organisms, species definition, and taxa classification (Stackebrandt et al., 2002; Drancourt and Raoult, 2005; Maiden, 2006). The recognized divergence among the Mollicutes has substantially increased over the past decade through studies of the 16S rRNA gene sequences and the use of differences in this gene for taxonomic placement of Mollicutes isolates, particularly species which represent fastidious or uncultivated forms (Neimark et al., 2001; Messick et al., 2002; Neimark et al., 2002; Knight, 2004). It is noteworthy that a study of the 16S rRNA gene had a significant impact on the understanding of Mollicutes evolution, taxonomy, and ecological distribution as well (Woese et al., 1980; Razin et al., 1998; Messick et al., 2002; Gasparich et al., 2004). Recently, on the basis of the 16S rRNA phylogenetic analysis, Mesoplasma and Entomoplasma species were proposed to be combined into a single genus, presumably with the name of Entomoplasma (Johansson, 2000; Gasparich et al., 2004). For this study, we will refer to these species as the Mesoplasma/Entomoplasma phylogenetic group of organisms and will use the official binomial species names when referring to specific organisms. The 16S rRNA gene is a commonly accepted genetic marker for taxonomic identification of bacteria. However, in some cases the use of it as a marker might be complicated due to the presence of multiple ribosomal RNA (rrn) operon copies in a single bacterial genome (Acinas et al.,

2004) or the low interspecies polymorphism in some taxonomic groups (Boyer et al., 2001; Clarridge, 2004; Schloss and Handelsman, 2004), including Mollicutes (Gundersen et al., 1994; Pettersson et al., 2000; Kim et al., 2003; Chalker and Brownlie, 2004; Gasparich et al., 2004). Previously published data showed that Acholeplasma species have two rrn operons (Neimark, 1983; Amikam et al., 1984; Razin et al., 1984; Razin et al., 1998) that differ from each other in length and sequence of their 16S–23S rRNA intergenic transcribed spacer (ITS) regions (Nakagawa et al., 1992). Recently, the genetic relatedness between different bacterial taxons was successfully tested by multilocus sequence typing based on simultaneous analysis of several housekeeping genes (Holmes et al., 2004; Rubin et al., 2005). The potential candidates for such markers are the rpoB, gyrB, elongation factor Tu (EF-Tu), phosphoglycerate kinase (pgk), and heat shock protein (dnaK) genes, as well as the 16S–23S rRNA intergenic transcribed spacer region (Kamla et al., 1996; Johansson, 2000; Kim et al., 2003; Wolf et al., 2004; Drancourt and Raoult, 2005). The main goal of this study was to assess the advantage of using the ITS, rpoB, and gyrB genes for reconstructing the phylogeny of Acholeplasma species, as well as Mesoplasma and Entomoplasma species, which share some genetic features with members of the genus Acholeplasma. 2. Materials and methods 2.1. Mollicutes strains and culture The Acholeplasma strains (Table 1) were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and the Mollicutes Collection at Purdue University (Purdue University, West Lafayette, IN). The broth and agar for Mollicutes growth were as described in previous studies (Tully, 1984; Volokhov et al., 2006). 2.2. Genomic DNA isolation Genomic DNA was isolated either from Mollicutes culture or directly from a small part of lyophilized samples using the DNeasy Tissue Kit (Qiagen, Chatsworth, Calif.), according to the manufacturer’s protocol. DNA concentrations in solutions were calculated on the basis of their optical density at 260 nm. 2.3. PCR amplification of 16S–23S rRNA ITS region Broad-spectrum Mollicutes-specific primers for PCR amplification of 16S–23S rRNA ITS region were designed using sequences in the 16S and 23S rRNA genes conserved for most Firmicutes (Volokhov et al., 2006). Forward PCR primer 16S-F-MYC (GGTGAATACGTTCTCGGGTC TTGTACACAC) and reverse primer 23S-R1-MYC (TNCTTTTCACCTTTCCCTCACGGTAC) were used for amplification of the ITS from all the Mollicutes species used in the study (Table 1). The standard PCR mixture

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710 Table 1 Origin and description of laboratory and reference strains used in this study Genus

Species

Strain

Source

Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Acholeplasma Entomoplasma Entomoplasma Entomoplasma Entomoplasma Entomoplasma Entomoplasma Entomoplasma Entomoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma

axanthum axanthum axanthum axanthum axanthum axanthum brassicae brassicae cavigenitalium cavigenitalium cavigenitalium equifetale equifetale granularum granularum granularum granularum hippikon hippikon laidlawii laidlawii laidlawii laidlawii laidlawii laidlawii modicum modicum modicum modicum modicum morum morum morum morum morum multilocale multilocale oculi oculi oculi oculi oculi palmae palmae parvum parvum vituli vituli vituli pleciae ellychniae freundtii lucivorax lucivorax luminosum melaleucae melaleucae somnilux chauliocola chauliocola chauliocola coleopterae

626 25176 S410 S743 MSX Panangala 58 502 49388 GP9 GP3 49901 29724 C112 19168 BTS 39 HA-9 NI-14 C1 29725 14089 23206 543N C3FA OR KHS 2310S 27367 527 PG 49 27379 72-043 S2 SP7 33211 SP9 PN525 49900 19L 27350 TC 1002 3571 TC 3557 TC J233 33684 H23M 29892 92-19 FC-097 700667 PS-1 ELCN-1 BARC 318 PI-16 (Chastel) PIPN-2 PIMN-1 SO M1 PYAN-1 AnuA-1 CHPA-2 CnuA-1 BARC 779

Purdue ATCC Purdue Purdue Purdue Purdue Purdue ATCC Purdue Purdue ATCC ATCC Purdue ATCC Purdue Purdue Purdue Purdue ATCC ATCC ATCC Purdue Purdue Purdue Purdue Purdue ATCC Purdue Purdue ATCC Purdue Purdue Purdue ATCC Purdue Purdue ATCC Purdue ATCC Purdue Purdue Purdue Purdue ATCC Purdue ATCC Purdue Purdue ATCC Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue

701

Table 1 (continued) Genus

Species

Strain

Source

Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma Mesoplasma

coleopterae corruscae entomophilum entomophilum entomophilum florum florum florum grammopterae lactucae photuris photuris seiffertii syrphidae syrphidae tabanidae

BARC 785 ELcA-2 TAC W24 W36 L1 MQ3 W23 GRUA-1 831-C4 BARC 1976 PUPA-2 F7 HeuA-1 YJS BARC 857

Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue Purdue

(50 ll) contained 1.5 U of HotStar Taq DNA polymerase, 1· reaction buffer supplemented with 2.5 mM MgCl2 (Qiagen, Chatsworth, Calif.), 600 nM of each forward and reverse primer, 200 lM of each deoxynucleoside triphosphate (dATP, dGTP, dCTP, and dTTP), and 1–2 ll of DNA template (ca. 0.2 lg of genomic bacterial DNA). The PCR was performed using a GeneAmp PCR system 9600 thermocycler (PE Applied Biosystems, Foster City, Calif.) with the following cycle conditions; initial activation at 95 C for 15 min; 35 cycles of 94 C for 30 s, 60 C for 30 s, and 72 C extension for 2 min, and a final extension at 72 C for 5 min. The efficiency of PCR amplification was verified by electrophoresis on 1.5% agarose gel containing ethidium bromide, followed by UV visualization. 2.4. PCR amplification of rpoB and genes of two subunits (A and B) of DNA gyrase The universal PCR primers for amplification of rpoB and gyrB genes of Mollicutes were designed on the basis of conserved regions found within sequences of these genes available in GenBank. Forward PCR primers rpoB-FMYC (AGTTATCACAATTTATGGATCAAA), gyrB-FMYC (AAAACGWCCAGGKATGTATATTGG) and reverse primers rpoB-R-MYC (GCTCAHACTTCCAT TTCHCCAAA), gyrB-R-MYC (GGATCCATTGTTGT TTCTCATAATTG) efficiently amplified the rpoB and gyrB genes from all the Mollicutes species used in the study (Table 1). The gyrA gene of A. multilocale was amplified by using forward PCR primer gyrAF (CAAAGCTATCTTA GATATGAGATTACAAC) and reverse primer gyrAR (GGAAACTTAATTAAAACTAAAGCATCAGAC). The high-fidelity PCR (50 ll) with highly processive enzyme Pfx DNA Polymerase (AccuPrime Pfx DNA Polymerase, Invitrogen) was carried out as described above using the following cycling conditions; initial activation at 95 C for 6 min, 45 cycles of 95 C for 1 min, 50 C for 1 min, and 68 C extension for 2 min, and a final extension at 68 C for 5 min.

702

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710

2.5. Cloning of amplicons Prior to sequencing, the PCR amplicons of 16S–23S rRNA ITS region were purified through 1.5% agarose gel, extracted with QIAquick Gel Extraction kit (Qiagen), and cloned into plasmid vector pCR4-TOPO by using TOPO-TA Cloning kit (Invitrogen, Carlsbad, Calif.). Approximately 10–100 ng of target amplicon was used in each cloning procedure. Transformed TOP10 E. coli cells were grown overnight at 37 C using an agar plates containing ampicillin, IPTG (isopropyl-b-D-thiogalactopyranoside) and X-gal (5-bromo-4-chloro-3-indolyl-b-Dgalactopyranoside) (Fermentas, Hanover, MD). White colonies were selected for the following analysis. A QIAprep Spin MiniPrep kit (Qiagen) was employed for isolation of plasmid DNAs in accordance with the manufacturer’s protocol. Isolated plasmid DNA samples were used for DNA sequencing. 2.6. DNA sequencing Plasmid DNA and PCR amplicons sequencing was conducted by using the Applied Biosystem’s BigDye Terminator v3.1 Cycle Sequencing kit. The M13 forward and reverse primers were utilized for sequencing cloned PCR products, while amplicons were sequenced with the primers used for PCR amplification and additional primers for internal regions of the rpoB and gyrB genes. Reaction samples were then purified with Centrisep Spin Column (Princeton Separations, Adelphia, NJ) and dried under vacuum. Samples were sequenced using ABI Prism 3100 genetic analyzer system. The GenBank Accession Nos. of the deposited sequences are AY736032, AY738726– AY738728, AY744936, AY740425–AY740437, AY765210, AY786572, AY786573, AY973565, AY974059, AY974060, AY974067–AY974069, DQ004908–DQ004910, DQ004923, DQ094151–DQ094158, DQ179265–DQ179269, DQ400417– DQ400421, DQ400422–DQ400444, DQ223252–DQ223261, DQ219498, DQ386606, DQ386607, DQ272358, DQ217902–DQ217917. 2.7. Analysis of sequence data Nucleotide diversity (p, average pairwise nucleotide difference/site), number of mutations, number of synonymous mutations (ds), number of non-synonymous mutations (dn), and the dn/ds ratios (the number of non-synonymous substitutions/non-synonymous site (dn) to the number of synonymous substitutions/synonymous site (ds)) with a Jukes–Cantor correction of the Nei–Gojobori method (Kumar et al., 2001) were calculated using MEGA version 2.1. The selection pressure on a protein-encoding gene was measured by comparing the rates of non-synonymous (dn) (amino acid altering) and synonymous substitutions (ds) (silent, with no amino acid change) to obtain the dn/ds  An x  value of 1 indicates neutral evolution ratio (x). (relaxed selective constraint; non-synonymous changes

have no associated fitness advantage and are fixed at the  values of <1 indicate same rate as synonymous changes), x purifying selection (strong functional constraint; non-synonymous changes are deleterious for protein function and are fixed at a lower rate than synonymous changes), and  values of >1 indicate positive selection (adaptive evolux tion; non-synonymous changes are favored because they confer a fitness advantage and are fixed at a higher rate than synonymous changes) (Anisimova et al., 2001). The determined sequences of the rpoB and gyrB genes were compared to the GenBank nucleotide and protein databases using BLASTN and BLASTP algorithms (Wheeler et al., 2006). Nucleotide and deduced amino acid sequences for each gene were aligned with the publicly available ClustalX software http://www.molecularevolution.org/software/clustalx/. Nucleotide contents, codon usage, inter and intraspecies similarity score matrixes for each gene were generated using MEGA version 2.1 and BioEdit softwares, http://www.megasoftware.net, http:// www.mbio.ncsu.edu/BioEdit/bioedit.html. To compare the interspecies genetic diversity we used the Shannon– Wiener information index (Hx) (Rubin et al., 2005). The mean values for all sites in the same set of taxa were calculated for each dataset by using BioEdit software. Phylogenetic analysis was conducted using MEGA version 2.1. Genetic distances were calculated by the Kimura two-parameter and Tamura–Nei models. Phylogenetic trees were constructed and compared using neighbor-joining, maximum-parsimony, and minimum evolution algorithms (Kumar et al., 2001). The genes of other Mollicutes genera were used as outgroup species for phylogenetic comparisons, and bootstrap analyses were performed with 1000 replicates. 3. Results 3.1. Sequencing of the 16S–23S ITS, 16S rRNA, rpoB, and gyrB genes To assess the feasibility of different loci of the Acholeplasma genome for the establishment of phylogenetic relationship and taxonomic affiliation of new isolates, we selected four genomic regions; the 16S–23S ITS, 16S rRNA, rpoB, and gyrB genes. The potential suitability of these genes for the reconstruction of Mollicutes phylogeny has been previously demonstrated elsewhere (Kim et al., 2003; Gasparich et al., 2004). At the time this study was initiated, very limited numbers of the 16S–23S ITS, rpoB, and gyrB sequences of Acholeplasma and Mesoplasma/Entomoplasma species were available. The species of the genera Mesoplasma and Entomoplasma were included in this study due to the sharing of some genetic features with members of the genus Acholeplasma. Therefore, the first step of the study included the sequencing of the required target genes. The amplification of the ITS regions of all Acholeplasma and Mesoplasma/Entomoplasma species was conducted using the set of universal primers previously tested for

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710

703

Table 2 The 16S–23S ITS data for members of the genus Acholeplasma

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Species

Numbers of the ITS amplified

tRNA type

Anti_codon

GenBank reference Nos.

A. A. A. A. A. A. A. A. A. A. A. A. A. A.

2 2 2 2 2 2 2 2 2 2 2 2 2 2

Ile Ile Ile Ile, Ile, Ile, Ile, Ile, Ile, Ile, Ile, Ile Ile Ile

GAT GAT GAT GAT, GAT, GAT, GAT, GAT, GAT, GAT, GAT, GAT GAT GAT

AY738727; AY738728 AY740432; AY740433 AY974060; AY974059 AY740436; AY740437 AY973565; DQ400444 DQ400427; DQ400428 DQ400438; DQ400439 AY740425; AY740426 AY744936; AY765210 DQ004910; DQ004923 AY740428; AY740429 DQ840500; DQ840499 DQ400433; DQ400434 AY740430; AY740431

morum vituli brassicae laidlawii pleciae granularum oculi hippikon equifetale palmae parvum axanthum modicum cavigenitalium

PCR amplification of Mollicutes species (Volokhov et al., 2006). The analysis of PCR products of all known Acholeplasma species, except for A. multilocale, showed the presence of two amplicon bands of different molecular weights (data not shown). The appearance of a two-band amplicon pattern was previously shown to be due to the presence of two rrn operons in Acholeplasma genome (Neimark, 1983; Amikam et al., 1984; Razin et al., 1984; Razin et al., 1998). It was shown that the difference in the lengths of ITS alleles related to the insertion of one or two, depending on species, tRNA genes (tRNA-Ile or tRNA-Ala) into a single ITS allele (Table 2). Surprisingly, the presence of Acholeplasma-specific two-band pattern was not observed for only one species i.e., A. multilocale. Further sequence analysis of multiple plasmid clones of the amplified ITS region of A. multilocale revealed complete nucleotide homogeneity of the ITS amplicon. However, no evidence for the presence of any tRNA-related insertions within the region of A. multilocale was found. It clearly demonstrated that A. multilocale had some unique genetic characteristics distinguishing it from all other Acholeplasma species. No tRNA-related insertions were found in the ITS region of Mesoplasma/Entomoplasma species as well. The main characteristics of the 16S rRNA gene and the ITS regions of different Acholeplasma and Mesoplasma/ Entomoplasma species are summarized in Tables S1–S4. The comparison of these two taxonomic groups showed that Acholeplasma species possess shorter ITS region (without tRNA(s) insertion) of 161 ± 19.5 bp with average GC content of 43.6 ± 1.4%, while the Mesoplasma/Entomoplasma species were 230.8 ± 52.2 bp and 39.8 ± 1.0%, respectively. The ITS region of A. multilocale was found to be 257 bp long which falls in a range of the ITS region length of Mesoplasma/Entomoplasma not Acholeplasma species. The gyrB and rpoB genes of Acholeplasma and Mesoplasma/Entomoplasma species were amplified using universal primers (see Section 2) followed by the direct sequencing of amplicons. The gyrB- and rpoB-derived amplicons were 1700–2000 bp long, covering nearly 90% of the DNA gyrase b-subunit gene and more than 50% of the RNA polymerase b-subunit gene. The interspecies similarities

Ala Ala Ala Ala Ala Ala Ala Ala

TGC TGC TGC TGC TGC TGC TGC TGC

of the gyrB and rpoB sequences are presented in Tables S5 and S6. At the intraspecies level the nucleotide diversity of the rpoB and gyrB genes was found to be less than 2%, and most intraspecies substitutions in these housekeeping genes were synonymous (x < 1), i.e., did not result in amino acid changes. This is not surprising because the genes encode the proteins vital for cellular function. The results from the Shannon–Wiener analysis (Hx index of substitutions at each nucleotide position) of all four genetic loci are presented in Figs. 3 and 4. The data revealed that the 16S rRNA gene had multiple highly conserved sequence domains interspersed along the gene and separated by variable regions. In contrast, the solitaire ITS region was found to be highly variable with few conserved regions within the ITS. The gyrB and rpoB sequences were also found to be highly variable with a more or less even distribution of nucleotide substitutions along the genes. 3.2. Phylogenetic analysis of the 16S rRNA gene sequences The sequences of the 16S rRNA gene used in the study were obtained from GenBank database. The resulting dendrogram in Fig. 1a shows the phylogenetic relationship between Acholeplasma and Mesoplasma/Entomoplasma species obtained by using the minimum evolution algorithm. This 16S rRNA tree, as well as all subsequent trees constructed for other four genetic loci analyzed (Fig. 1), has two well-divided Acholeplasma and Mesoplasma/Entomoplasma phylogenetic clades. Recently, the study of G.E. Gasparich et al. (Gasparich et al., 2004) showed that Mesoplasma and Entomoplasma species belong to the Mycoides–Entomoplasmataceae polyphyletic clade, and based on phylogenetic and phenotypic grounds, it proposed to place all the Mesoplasma and Entomoplasma species into a single genus. The results of our phylogenetic study also support this point of view on the common origin of Mesoplasma and Entomoplasma species. The Acholeplasma phylogenetic clade could be additionally divided into four sub-clusters; (i) A. laidlawii, A. pleciae, A. granularum, A. hippikon, A. oculi, and A. equifetale, (ii) A. brassicae, A.

704

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710 A. laidlawii M23932

98

a

53

A. pleciae AY257485

A. laidlawii AY740436

100

b

A. laidlawii U14905

99

62

i

100

A. oculi U14906

72 100

66

A. parvum AY538170

99

A. vituli AY740432

iv

A. cavigenitalium DQ004908 A. axanthum DQ400426

52

100

A. morum AY738727

62

iii iv

Me. grammopterae AY174170

56 Me. florum AY974064

Me. florum AF300327

37

76

Me. tabanidae DQ439654

Me. chauliocola DQ439658

Me. grammopterae DQ439649 87

99 86 Me. entomophilum DQ004936

48

100 Me. seiffertii AY351331 62

Me. syrphidae AY231458 Me. photuris AY177627

75

94 99

61 99

E. ellychniae DQ439659

100

Me. seiffertii DQ004930

91 72 78

100

E. somnilux AY157871

96 Me. seiffertii DQ004930 77 81

98 95

96

A. multilocale AY738726

26 46

E. somnilux DQ439664

A. multilocale AY738726

Me. photuris DQ004902

E. luminosum DQ004927

E. freundtii DQ439663

E. somnilux DQ439664

78 34

E. freundtii DQ439663

Me. lactucae DQ439661 48

S. culicicola AY780799

M. hyopneumoniae Y00149

S. culicicola AY780799 M. hyopneumoniae AY737012

M. hyopneumoniae AY737012 0. 05

E. luminosum DQ004927 99 E. lucivorax DQ439665

Me. lactucae DQ439661

S. phoeniceum AY772395

Me. syrphidae DQ439662

49

E. lucivorax DQ439665

E. freundtii AF036954

S. culicicola AY189129

0. 05

Me. corruscae DQ439660 87 E. ellychniae DQ439659

Me. photuris DQ004902

E. luminosum AY155670

E. melaleucae DQ439655 Me. florum AY974064

Me. syrphidae DQ439662

A. multilocale AY538169

Me. lactucae AF303132 100

E. melaleucae DQ439655

100

98

E. lucivorax AF547212 78

92

Me. corruscae DQ439660

Me. ellychnium M24292

Me. entomophilum DQ004936 Me. coleopterae DQ004928

Me. tabanidae DQ439654 99

Me. corruscae AY168929

51

A. modicum DQ400436

Me. chauliocola DQ439658

Me. coleopterae DQ004928

Me. coleopterae DQ514606

74 E. melaleucae DQ514607

88

A. axanthum DQ400426

69

A. modicum DQ400436

99 A. modicum AY736032

Me. chauliocola AY166704

72

A. parvum AY740428 A. cavigenitalium DQ004908

99

100

A. palmae DQ004910

38 58

84 Me. grammopterae DQ439649

69 Me. tabanidae AY187288

100

A. modicum AY736032

54

Me. entomophilum AF305693

A. brassicae AY974060

66

A. parvum AY740428 100

A. hippikon AY740425 A. vituli AY740432

37

99

A. palmae DQ004910

75

72

iii

A. modicum M23933

100

ii

A. brassicae AY974060

A. cavigenitalium AY538164

51

A. equifetale AY765210 50

A. morum AY738727

100

ii

A. axanthum AF412968 100

A. oculi DQ400442

A. equifetale AY765210 100

A. morum AY538168

A. palmae L33734 100

A. pleciae AY973565

94

A. hippikon AY740425

A. brassicae AY538163

100

70 59 A. granularum DQ400431

A. oculi DQ400442 73

A. hippikon AY538167

A. vituli AF031479

i

A. granularum DQ400431

100

A. laidlawii AY740434 A. laidlawii AY740436

32

A. equifetale AY538165 94

46

65

A. pleciae AY973565

56

A. oculi U14904 100

c

A. laidlawii AY740434

100

A.granularum AY538166

91

0. 05

Fig. 1. Dendrograms showing phylogenetic relationships among members of the orders Acholeplasmatales and Entomoplasmatales based on nucleotide sequence data for the partial 16S rRNA gene (a), the entire 16S–3S ITS amplicon (b), and the 16S–23S ITS alone (c). The trees were constructed by the minimum evolution method in the MEGA 2.1 package. The bootstrap values presented at corresponding branches were evaluated from 1000 replications. GenBank accession numbers are indicated for each strain used in creating the dendrograms.

vituli, and A. morum, (iii) A. palmae and A. parvum, and (iv) A. modicum, A. cavigenitalium, and A. axanthum. The only exception from Acholeplasma species was A. multilocale, which was placed into the Mesoplasma/Entomoplasma phylogenetic clade instead Acholeplasma phylogenetic clade and formed a separate branch with Me. seiffertii, Me. syrphidae, and Me. photuris (bootstrap value of 88%) in the phylogenetic group including E. luminosum, E. lucivorax, E. somnilux, and E. freundtii (Fig. 1a). In addition, the comparison of the interspecies similarity data for different species showed that A. multilocale has higher overall homology to the Mesoplasma/Entomoplasma than to Acholeplasma species (Table 3). 3.3. Phylogenetic analysis of sequences of the 16S–23S rRNA intergenic transcribed spacer For reconstruction of Acholeplasma phylogeny we used two parts of rrn operon which included the sequence of the ITS alone (without flanking and tRNA sequences)

and the whole ITS amplicon that included partial flanking sequences of the16S and 23S rRNA genes (Fig. 1b, c, and Table S2). The dendrograms in Fig. 1b and c show the phylogeny of Acholeplasma obtained by the minimum evolution algorithm analysis of the whole amplified ITS region and the ITS alone. The comparison of the phylogenetic trees of the 16S rRNA and the whole ITS amplicon showed their similar topology. However, the Acholeplasma tree obtained using the whole ITS amplicon (Fig. 1c) contained only three sub-clusters with significant bootstrap values; (i) A. laidlawii, A. pleciae, A. granularum, A. oculi, A. equifetale, and A. hippikon; (ii) A. brassicae, A. morum, and A. vituli; (iii) A. palmae, A. parvum, A. axanthum, A. cavigenitalium, and A. modicum. Unlike the 16S rRNA tree, the second and fourth sub-clusters were not resolved on the whole ITS amplicon tree. The phylogenetic tree obtained for the ITS sequences alone had a topology very similar to the 16S rRNA gene tree however, the overall sub-clustering was not supported by statistically significant bootstrap values. Nevertheless, in both ITS trees A.

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710

705 100

a 97

100

b

A. laidlawii DQ223260

99

A. hippikon DQ444279

i

100 100

A. pleciae DQ217917

86

A. oculi DQ157643

100

A. laidlawii DQ217912

84

A. granularum DQ179269 38

A. oculi DQ400420

55 100

A. oculi DQ179266

A. palmae DQ223261 93

A. parvum DQ444278 100

55

A. cavigenitalium DQ223256 100

A. hippikon DQ485320 A. equifetale DQ217908

iii

85

A. parvum DQ094155

iv

100

A. vituli DQ272358

33 58 100

A. axanthum DQ217902

99

A. modicum DQ400418 100

Me. entomophilum DQ310552

Me. entomophilum DQ496242

100

Me. coleopterae DQ310550

Me. coleopterae DQ463748

85

Me. florum AE017263

Me. florum AE017263

99 100

Me. grammopterae DQ310549

Me. grammopterae DQ496245

76

Me. tabanidae DQ487765 100

E. melaleucae DQ310557 Me. chauliocola DQ310559

E. melaleucae DQ487764

92

Me. chauliocola DQ487766

Me. corruscae DQ310560 100 100 94

94

Me. corruscae AY351332

E. ellychniae DQ310561

100

56

Me. syrphidae DQ310563

100

Me. seiffertii DQ310562

100

63

99

Me. photuris DQ310564 E. lucivorax DQ487105

100

E. luminosum DQ496239 99 70 51

100

E. freundtii DQ487104

45 90

S. phoeniceum DQ307057

E. freundtii DQ512480

S. culicicola DQ485322 88

S. phoeniceum DQ514609

Me. hyopneumoniae AE017332 0. 05

E. somnilux AY196996

Me. lactucae DQ514613

S. culicicola DQ310569 78

Me. photuris DQ512479 E. lucivorax DQ512482 E. luminosum AY196995

66

E. somnilux DQ310565 Me. lactucae DQ460213

Me. syrphidae AY231457

A. multilocale DQ094158 100

23

97

E. ellychniae DQ512481

Me. seiffertii AY360319

A. multilocale DQ287928

100

iv

A. cavigenitalium DQ287931

Me. tabanidae DQ310556

100

A. brassicae DQ217906

ii

99 100

ii

A. vituli DQ094157 100

A. brassicae DQ223254 100

iii

A. morum DQ094153

98

60

A. morum DQ386606

100

A. palmae DQ169006

100

A. modicum DQ444280 73

A. oculi DQ400419

100

A. axanthum DQ219498 A. axanthum DQ112173

100

i

A. granularum DQ217909

A. equifetale DQ223258

100

A. laidlawii DQ217915

99

A. pleciae DQ234658

A. laidlawii DQ217913

Me. hyopneumoniae AE017332 0. 05

Fig. 2. Dendrograms showing phylogenetic relationships among members of the orders Acholeplasmatales and Entomoplasmatales based on nucleotide sequence data for the partial rpoB gene (a), the partial gyrB gene (b). The trees were constructed by the minimum evolution method in the MEGA 2.1 package. The bootstrap values presented at corresponding branches were evaluated from 1000 replications. GenBank accession numbers are indicated for each strain used in creating the dendrograms.

multilocale was placed into Mesoplasma/Entomoplasma phylogenetic clade in one group with Me. seiffertii, Me. syrphidae, and Me. photuris (Fig. 1b and c). 3.4. Phylogenetic analysis of the gyrB and rpoB genes The rpoB and gyrB phylogenetic trees constructed using the minimum evolution algorithm are shown in Fig. 2a and b. These trees also demonstrated the presence of well-separated Acholeplasma and Mesoplasma/Entomoplasma clades. Although there are some differences in branching order within these clades, the Acholeplasma clade was found to contain the same four well-supported sub-clusters previously observed in the 16S rRNA tree (Fig. 2a and b).

The study demonstrated that the gyrB and rpoB sequences of Acholeplasma, Mesoplasma, and Entomoplasma have lower interspecies similarity rates than those of the 16S rRNA gene (Tables S5 and S6). Based on these interspecies similarity rates, the gyrB and rpoB trees were found to have a better deep-branch resolution in comparison with the 16S rRNA or the ITS trees. Once again, the phylogenetic analysis of both gyrB and rpoB sequences unambiguously placed A. multilocale into the group formed by Me. photuris, Me. seiffertii, and Me. syrphidae of the Mesoplasma/ Entomoplasma phylogenetic clade. Overall, the gyrB and rpoB nucleotide sequences and deduced protein sequences showed a similar level of conservation between the genes and proteins. Due to this similar level of conservation,

706

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710

Entropy (Hx) Plot 16S rRNA gene

Entropy (Hx)

1

100

200

300

400

500

600 700 800 900 Alignment Position (residue number)

1,000

1,100

1,200

1,300

1,400

Entropy (Hx) Plot The 16S-23S ITS amplicon

Entropy (Hx)

1

50

100

150

200

250

300

350

400 450 500 550 600 650 Alignment Position (residue number)

700

750

800

850

900

950

1,000

Fig. 3. Results from the Shannon–Wiener (Hx) analysis of the 16S rRNA gene and the 16S–23S ITS amplicon sequences. The Hx index shows the sequence variation along the individual genes.

the genes and proteins phylogenetic trees have the same sub-clustering and branch topologies (data not shown). 3.5. A. multilocale codon usage Direct sequencing of the gyrA- and gyrB-derived amplicons of A. multilocale followed by the subsequent analysis of deduced amino acid sequences of the GyrA and GyrB proteins and comparison to analogous proteins of other Mollicutes showed that A. multilocale is capable of using the UGA triplet for encoding tryptophan amino acid. Generally, UGA is a bacterial stop-codon used for the termination of the polypeptide translation but, in contrast to the species of the order Acholeplasmatales, Entomoplasmatales species use the UGA triplet as the codon for tryptophan. The analysis of gyrA and gyrB genes of A. multilocale sequenced in this study revealed the presence of three UGA codons: one in the middle of the encoded GyrA protein and for the GyrB protein, one in the beginning and one in the middle of amino acid sequence. DNA gyrase is an essential bacterial enzyme that catalyzes the ATP-dependent negative super-coiling of double-stranded closed-circular DNA. Thus, it is unlikely that A. multilocale could

survive having knockout genes of the enzyme vital for DNA replication. It is noteworthy that in all three cases the occurrence of tryptophan in the position encoded by UGA was observed in homologous proteins of most Mollicutes species analyzed. Taking into account that the gyrA and gyrB genes were found in single copies in the A. multilocale genome, the occurrence of UGA usage for encoding the tryptophan in this species strongly supports the taxonomic relationship of A. multilocale to the Entomoplasmatales (Mesoplasma/Entomoplasma species). In addition to the findings above, interspecies nucleotide and protein sequence similarity values between Acholeplasma and Mesoplasma/Entomoplasma species examined taken together with phylogenetic data revealed that A. multilocale clearly belongs to the Mesoplasma/Entomoplasma phylogenetic clade. 4. Discussion The conventional bacteriological classification of Mollicutes species based on phenotypic features is difficult and can be error-prone. Remarkably, the number of biochemical reactions suitable for phenotypic characterization of

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710

707

Entropy (Hx) Plot rpoB

Entropy (Hx)

1

100

200

300

400

500

600

700 800 900 1,000 1,100 1,200 1,300 1,400 1,500 1,600 1,700 1,800 1,900 Alignment Position (residue number)

Entropy (Hx) Plot gyrB

Entropy (Hx)

1

100

200

300

400

500

600 700 800 900 1,000 Alignment Position (residue number)

1,100

1,200

1,300

1,400

1,500

1,600

Fig. 4. Results from the Shannon–Wiener (Hx) analysis of partial nucleotide sequences of the rpoB and gyrB genes. The Hx index shows the sequence variation along the individual genes.

Table 3 Interspecies similarity of multiple genetic loci among members of Acholeplasma and Mesoplasma/Entomoplasma genera Species

16S rRNA gene

ITS amplicon

ITS alone

rpoB gene

RpoB protein

gyrB gene

GyrB protein

Acholeplasma A. multilocale to Acholeplasma Mesoplasma/Entomoplasma A. multilocale to Mesoplasma/Entomoplasma Acholeplasma to Mesoplasma/Entomoplasma

80.6–98.5 74.8–80 88.8–100 89.6–97.5 72.1–81

66.4–99.7 50.1–52.9 65.9–99.8 69.1–89.9 44.6–55.8

31–99.4 17.3–22.8 31.7–99.5 39.2–77.7 11.8–25.1

67.4–99.3 61.1–63.2 74.1–98.5 76.7–86.4 59–63.9

68.2–99.6 55.9–61 77.3–99.8 82.5–93.1 54.8–61.5

63.6–98.8 56.2–61.1 67.8–99.1 71.6–81.9 53.5–62.5

64.6–98.6 49.2–55.1 69.3–99.6 73.3–88.3 48.9–55.1

Mollicutes is small, and therefore the current strategy of Mollicutes identification to the species level basically relies on their comparative metabolic or/and serological features (Pollack et al., 1996a; Pollack et al., 1996b; Pollack et al., 1997; Gasparich et al., 2004; Knight, 2004). The currently available identification scheme is labor-intensive, time-consuming, and requires a complete serum panel to all known Mollicutes species. Therefore, only Mollicutes-specialized or reference laboratories are capable of carrying out all essential procedures for species identification. While the sterol requirement and some serological tests that distinguish the Acholeplasma, Mesoplasma, and Entomoplasma from other Mollicutes species are effective classification

tools, performing these tests and accurately interpreting them are difficult and require considerable experience and skill. In addition, the presence of uncultivated Mollicutes species makes multilocus genetic analysis the only available option to identify and characterize these uncultivated or fastidious organisms taxonomically and phylogenetically (Neimark et al., 1998; Drancourt and Raoult, 2005; Neimark, 2005). The 16S rRNA has been used extensively as a phylogenetic marker in bacterial taxonomy for intergenic relationships due to its extremely slow rate of evolution. However, the lack of 16S rRNA sequence variability among some species makes it unsuitable for identification (Fox

708

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710

et al., 1992; Drancourt and Raoult, 2005). In contrary, the ITS has been selected as a region for interspecies comparison and accurate species identification of Mollicutes due to its highly polymorphic nature (Harasawa, 1999; Harasawa et al., 2000; Chalker and Brownlie, 2004; Volokhov et al., 2006). Protein-encoding genes such as gyrB and rpoB have been reported to evolve much faster than rrn operons, thus providing better discrimination among closely related species (Huang, 1996; Kasai et al., 1998; Watanabe et al., 2001; Kim et al., 2003; Walsh et al., 2004). At the same time, the amino acid sequences are more conserved and are generally more suitable for discrimination of species which are taxonomically and phylogenetically distant (Shearer and Johnson, 1993; Lio and Goldman, 1998; Palys et al., 2000). The main purpose of this study was to evaluate and comprehensively characterize the 16S–23S intergenic transcribed spacer and two other genes, gyrB and rpoB, of Acholeplasma and Mesoplasma/Entomoplasma species. The interspecies differences of the genes were used for multilocus phylogenetic analysis among members of the genus Acholeplasma. The analysis of multiple loci is a valuable genetic tool, and recently recommended as the most suitable approach for identifying strains/species of bacteria whose taxonomic relationship is solely based on nucleotide differences in a certain number of genes (Stackebrandt et al., 2002; Drancourt and Raoult, 2005). In contrast to the characteristics of conventional phenotypic methods, the multilocus sequence analysis data are definite, can be easily repeated by different labs, and do not require Mollicutes-specialized experience and skill. Furthermore, the multilocus sequence analysis data are generally available in a public database, i.e., GenBank or the PubMLST (publicly accessible Multilocus Sequence Typing database, http://pubmlst.org) (Kasai et al., 1998; Watanabe et al., 2001; Stackebrandt et al., 2002). The multilocus analysis of housekeeping genes of the Acholeplasma species showed that all 14 species A. axanthum, A. brassicae, A. cavigenitalium, A. equifetale, A. granularum, A. hippikon, A. laidlawii, A. modicum, A. morum, A. oculi, A. palmae, A. parvum, A. pleciae, and A. vituli, with exception of A. multilocale, were always positioned into discrete Acholeplasma phylogenetic clade. This clade was clearly separated from the Mesoplasma/Entomoplasma phylogenetic clade. The 16S rRNA, rpoB, and gyrB phylogenetic trees further showed that all Acholeplasma species can be divided into four sub-clusters with statistically significant bootstrap values regardless the phylogenetic algorithm used for the trees reconstruction. The sub-clusters were formed by; (i) A. laidlawii, A. pleciae, A. granularum, A. hippikon, A. oculi, and A. equifetale, (ii) A. brassicae, A. vituli, and A. morum (iii) A. palmae and A. parvum, (iv) A. modicum, A. cavigenitalium, and A. axanthum. At the same time, A. multilocale was always found to be outside the Acholeplasma phylogenetic clade. From multilocus analysis of housekeeping genes, this species clearly belongs to the Mesoplasma/

Entomoplasma phylogenetic clade with closest neighbors being Me. seiffertii, Me. syrphidae, and Me. photuris. A. multilocale was first described in 1992 by A.C. Hill, et. al. (Hill et al., 1992). The species was assigned to the genus Acholeplasma on the basis of two main parameters; lack of sterol requirement for growth and GC content of 31%. No significant antigenic cross reactions with any Acholeplasma species were detected. At the time of that publication, the sequence of the 16S rRNA gene of A. multilocale was not determined. This sequence became available only in 2004 (K.E. Johansson et al., unpublished data, GenBank Accession No. AY538169). Our study of the 16S–23S rRNA ITS of Acholeplasma species showed that in contrast to other members of this genus, A. multilocale did not carry any insertion of tRNA genes in this region. Partial sequencing of the essential housekeeping genes gyrB and gyrA showed that A. multilocale uses the UGA codon for encoding tryptophan. The UGA usage for encoding tryptophan was previously reported as a unique genetic feature of Entomoplasmatales and Mycoplasmatales but not of Acholeplasmatales. In addition, J.D. Pollack et al. (Pollack et al., 1996a; Pollack et al., 1996b) have previously reported that A. multilocale, unlike all other Acholeplasma species, lacks dUTPase, PPidependent phosphokinase, and uracil DNA glycosilase activities, as well as compatibility to benzyl viologen reduction that is associated with presence of membrane NADH oxidase activity. On the basis of this data, the authors made a conclusion that A. multilocale can belong to either a distinct unrecognized metabolic subgroup of the genus Acholeplasma or to different genus (Pollack et al., 1996a; Pollack et al., 1996b). Based on our multilocus genetic analysis of housekeeping genes and the previously published metabolic data for this species, we propose that A. multilocale should be reclassified as a member of the Mesoplasma/Entomoplasma polyphyletic taxon. Indeed, the clustering A. multilocale PN525 to members of the order Entomoplasmatales was observed in our study and strongly supports earlier metabolic studies of J.D. Pollack et al. (Pollack et al., 1996a; Pollack et al., 1996b). Thus, our study should improve the taxonomic and phylogenetic analyses of the genus Acholeplasma and also provides data on several more genes from the Acholeplasmatales and Entomoplasmatales. Acknowledgment We express our appreciation to Michael Klutch for his assistance in sequencing. References Acinas, S.G., Marcelino, L.A., Klepac-Ceraj, V., Polz, M.F., 2004. Divergence and redundancy of 16S rRNA sequences in genomes with multiple rrn operons. J. Bacteriol. 186, 2629–2635. Amikam, D., Glaser, G., Razin, S., 1984. Mycoplasmas (Mollicutes) have a low number of rRNA genes. J. Bacteriol. 158, 376–378.

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710 Angulo, A.F., Reijgers, R., Brugman, J., Kroesen, I., Hekkens, F.E., Carle, P., Bove, J.M., Tully, J.G., Hill, A.C., Schouls, L.M., Schot, C.S., Roholl, P.J., Polak-Vogelzang, A.A., 2000. Acholeplasma vituli sp. nov., from bovine serum and cell cultures. Int. J. Syst. Evol. Microbiol. 50 (Pt. 3), 1125–1131. Anisimova, M., Bielawski, J.P., Yang, Z., 2001. Accuracy and power of the likelihood ratio test in detecting adaptive molecular evolution. Mol. Biol. Evol. 18, 1585–1592. Artiushin, S., Duvall, M., Minion, F.C., 1995. Phylogenetic analysis of mycoplasma strain ISM1499 and its assignment to the Acholeplasma oculi strain cluster. Int. J. Syst. Bacteriol. 45, 104–109. Ayling, R.D., Bashiruddin, S.E., Nicholas, R.A., 2004. Mycoplasma species and related organisms isolated from ruminants in Britain between 1990 and 2000. Vet. Rec. 155, 413–416. Boyer, S.L., Flechtner, V.R., Johansen, J.R., 2001. Is the 16S–23S rRNA internal transcribed spacer region a good tool for use in molecular systematics and population genetics? A case study in cyanobacteria. Mol. Biol. Evol. 18, 1057–1069. Chalker, V.J., Brownlie, J., 2004. Taxonomy of the canine Mollicutes by 16S rRNA gene and 16S/23S rRNA intergenic spacer region sequence comparison. Int. J. Syst. Evol. Microbiol. 54, 537–542. Clarridge 3rd, J.E., 2004. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin. Microbiol. Rev. 17, 840–862. Drancourt, M., Raoult, D., 2005. Sequence-based identification of new bacteria: a proposition for creation of an orphan bacterium repository. J. Clin. Microbiol. 43, 4311–4315. Fox, G.E., Wisotzkey, J.D., Jurtshuk Jr., P., 1992. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity. Int. J. Syst. Bacteriol. 42, 166–170. Gasparich, G.E., Whitcomb, R.F., Dodge, D., French, F.E., Glass, J., Williamson, D.L., 2004. The genus Spiroplasma and its non-helical descendants: phylogenetic classification, correlation with phenotype and roots of the Mycoplasma mycoides clade. Int. J. Syst. Evol. Microbiol. 54, 893–918. Gundersen, D.E., Lee, I.M., Rehner, S.A., Davis, R.E., Kingsbury, D.T., 1994. Phylogeny of mycoplasmalike organisms (phytoplasmas): a basis for their classification. J. Bacteriol. 176, 5244–5254. Harasawa, R., 1999. Genetic relationships among mycoplasmas based on the 16S–23S rRNA spacer sequence. Microbiol. Immunol. 43, 127–132. Harasawa, R., Hotzel, H., Sachse, K., 2000. Comparison of the 16S–23S rRNA intergenic spacer regions among strains of the Mycoplasma mycoides cluster, and reassessment of the taxonomic position of Mycoplasma sp. bovine group 7. Int. J. Syst. Evol. Microbiol. 50 (Pt. 3), 1325–1329. Hill, A.C., Polak-Vogelzang, A.A., Angulo, A.F., 1992. Acholeplasma multilocale sp. nov., isolated from a horse and a rabbit. Int. J. Syst. Bacteriol. 42, 513–517. Holmes, D.E., Nevin, K.P., Lovley, D.R., 2004. Comparison of 16S rRNA, nifD, recA, gyrB, rpoB and fusA genes within the family Geobacteraceae fam. nov. Int. J. Syst. Evol. Microbiol. 54, 1591–1599. Huang, W.M., 1996. Bacterial diversity based on type II DNA topoisomerase genes. Annu. Rev. Genet. 30, 79–107. Johansson, K.E., 2000. International Committee on Systematic Bacteriology Subcommittee on the taxonomy of Mollicutes. Minutes of the meetings, 21 and 28 July 1998, Sydney, Australia. Int. J. Syst. Evol. Microbiol. 50 (Pt. 3), 1393–1397. Kamla, V., Henrich, B., Hadding, U., 1996. Phylogeny based on elongation factor Tu reflects the phenotypic features of mycoplasmas better than that based on 16S rRNA. Gene 171, 83–87. Kasai, H., Watanabe, K., Gasteiger, E., Bairoch, A., Isono, K., Yamamoto, S., Harayama, S., 1998. Construction of the gyrB database for the identification and classification of bacteria. Genome Inform. Ser. Workshop Genome. Inform. 9, 13–21. Kim, K.S., Ko, K.S., Chang, M.W., Hahn, T.W., Hong, S.K., Kook, Y.H., 2003. Use of rpoB sequences for phylogenetic study of Mycoplasma species. FEMS Microbiol. Lett. 226, 299–305.

709

Knight Jr., T.F., 2004. Reclassification of Mesoplasma pleciae as Acholeplasma pleciae comb. nov. on the basis of 16S rRNA and gyrB gene sequence data. Int. J. Syst. Evol. Microbiol. 54, 1951–1952. Kumar, S., Tamura, K., Jakobsen, I.B., Nei, M., 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17, 1244–1245. Lio, P., Goldman, N., 1998. Models of molecular evolution and phylogeny. Genome Res. 8, 1233–1244. Maiden, M.C., 2006. Multilocus sequence typing of bacteria. Annu. Rev. Microbiol. 60, 561–588. Messick, J.B., Walker, P.G., Raphael, W., Berent, L., Shi, X., 2002. ‘Candidatus mycoplasma haemodidelphidis’ sp. nov., ‘Candidatus mycoplasma haemolamae’ sp. nov. and Mycoplasma haemocanis comb. nov., haemotrophic parasites from a naturally infected opossum (Didelphis virginiana), alpaca (Lama pacos) and dog (Canis familiaris): phylogenetic and secondary structural relatedness of their 16S rRNA genes to other mycoplasmas. Int. J. Syst. Evol. Microbiol. 52, 693–698. Nakagawa, T., Uemori, T., Asada, K., Kato, I., Harasawa, R., 1992. Acholeplasma laidlawii has tRNA genes in the 16S–23S spacer of the rRNA operon. J. Bacteriol. 174, 8163–8165. Neimark, H., 1983. Evolution of mycoplasmas and genome losses. Yale J. Biol. Med. 56, 377–383. Neimark, H., 2005. Proposal for archival reference collections of chromosomal DNA from uncultivated bacterial species. Int. J. Syst. Evol. Microbiol. 55, 1407. Neimark, H., Johansson, K.E., Rikihisa, Y., Tully, J.G., 2002. Revision of haemotrophic Mycoplasma species names. Int. J. Syst. Evol. Microbiol. 52, 683. Neimark, H., Johansson, K.E., Rikihisa, Y., Tully, J.G., 2001. Proposal to transfer some members of the genera Haemobartonella and Eperythrozoon to the genus Mycoplasma with descriptions of ‘Candidatus Mycoplasma haemofelis’, ‘Candidatus Mycoplasma haemomuris’, ‘Candidatus Mycoplasma haemosuis’ and ‘Candidatus Mycoplasma wenyonii’. Int. J. Syst. Evol. Microbiol. 51, 891–899. Neimark, H., London, J., 1982. Origins of the mycoplasmas: sterolnonrequiring mycoplasmas evolved from streptococci. J. Bacteriol. 150, 1259–1265. Neimark, H., Mitchelmore, D., Leach, R.H., 1998. An approach to characterizing uncultivated prokaryotes: the Grey Lung agent and proposal of a Candidatus taxon for the organism, ‘Candidatus Mycoplasma ravipulmonis’. Int. J. Syst. Bacteriol. 48 (Pt. 2), 389–394. Palys, T., Berger, E., Mitrica, I., Nakamura, L.K., Cohan, F.M., 2000. Protein-coding genes as molecular markers for ecologically distinct populations: the case of two Bacillus species. Int. J. Syst. Evol. Microbiol. 50 (Pt. 3), 1021–1028. Pettersson, B., Tully, J.G., Bolske, G., Johansson, K.E., 2000. Updated phylogenetic description of the Mycoplasma hominis cluster (Weisburg et al. 1989) based on 16S rDNA sequences. Int. J. Syst. Evol. Microbiol. 50 (Pt. 1), 291–301. Pollack, J.D., Banzon, J., Donelson, K., Tully, J.G., Davis Jr., J.W., Hackett, K.J., Agbanyim, C., Miles, R.J., 1996a. Reduction of benzyl viologen distinguishes genera of the class Mollicutes. Int. J. Syst. Bacteriol. 46, 881–884. Pollack, J.D., Williams, M.V., Banzon, J., Jones, M.A., Harvey, L., Tully, J.G., 1996b. Comparative metabolism of Mesoplasma, Entomoplasma, Mycoplasma, and Acholeplasma. Int. J. Syst. Bacteriol. 46, 885–890. Pollack, J.D., Williams, M.V., McElhaney, R.N., 1997. The comparative metabolism of the mollicutes (Mycoplasmas): the utility for taxonomic classification and the relationship of putative gene annotation and phylogeny to enzymatic function in the smallest free-living cells. Crit. Rev. Microbiol. 23, 269–354. Razin, S., Glaser, G., Amikam, D., 1984. Molecular and biological features of mollicutes (mycoplasmas). Ann. Microbiol. (Paris) 135A, 9–15. Razin, S., Yogev, D., Naot, Y., 1998. Molecular biology and pathogenicity of mycoplasmas. Microbiol. Mol. Biol. Rev. 62, 1094–1156. Rogers, M.J., Simmons, J., Walker, R.T., Weisburg, W.G., Woese, C.R., Tanner, R.S., Robinson, I.M., Stahl, D.A., Olsen, G., Leach, R.H.,

710

D.V. Volokhov et al. / Molecular Phylogenetics and Evolution 44 (2007) 699–710

et al., 2004. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data. Proc. Natl. Acad. Sci. USA 82, 1160–1164. Rubin, C.J., Thollesson, M., Kirsebom, L.A., Herrmann, B., 2005. Phylogenetic relationships and species differentiation of 39 Legionella species by sequence determination of the RNase P RNA gene rnpB. Int. J. Syst. Evol. Microbiol. 55, 2039–2049. Schloss, P.D., Handelsman, J., 2004. Status of the microbial census. Microbiol. Mol. Biol. Rev. 68, 686–691. Shearer, A.C., Johnson, M.S., 1993. Confidence limits on the branching order of phylogenetic trees. Protein Sci. 2, 1686–1696. Stackebrandt, E., Frederiksen, W., Garrity, G.M., Grimont, P.A., Kampfer, P., Maiden, M.C., Nesme, X., Rossello-Mora, R., Swings, J., Truper, H.G., Vauterin, L., Ward, A.C., Whitman, W.B., 2002. Report of the ad hoc committee for the re-evaluation of the species definition in bacteriology. Int. J. Syst. Evol. Microbiol. 52, 1043– 1047. Stephens, E.B., Aulakh, G.S., Rose, D.L., Tully, J.G., Barile, M.F., 1983. Interspecies and intraspecies DNA homology among established species of Acholeplasma: a review. Yale J. Biol. Med. 56, 729–735. Tully, J.G., 1984. Acholeplasmataceae. In: Krieg, N.R., Holt, J.G. (Eds.), Bergey’s Manual of Systematic Bacteriology. Williams & Wilkins, Baltimore, pp. 775–781. Tully, J.G., Whitcomb, R.F., Rose, D.L., Bove, J.M., Carle, P., Somerson, N.L., Williamson, D.L., Eden-Green, S., 1994. Acholeplasma brassicae sp. nov. and Acholeplasma palmae sp. nov., two nonsterol-requiring mollicutes from plant surfaces. Int. J. Syst. Bacteriol. 44, 680–684.

Volokhov, D.V., George, J., Liu, S.X., Ikonomi, P., Anderson, C., Chizhikov, V., 2006. Sequencing of the intergenic 16S–23S rRNA spacer (ITS) region of Mollicutes species and their identification using microarray-based assay and DNA sequencing. Appl. Microbiol. Biotechnol. 71, 680–698. Walsh, D.A., Bapteste, E., Kamekura, M., Doolittle, W.F., 2004. Evolution of the RNA polymerase B’ subunit gene (rpoB’) in Halobacteriales: a complementary molecular marker to the SSU rRNA gene. Mol. Biol. Evol. 21, 2340–2351. Watanabe, K., Nelson, J., Harayama, S., Kasai, H., 2001. ICB database: the gyrB database for identification and classification of bacteria. Nucleic Acids Res. 29, 344–345. Wheeler, D.L., Barrett, T., Benson, D.A., Bryant, S.H., Canese, K., Chetvernin, V., Church, D.M., DiCuccio, M., Edgar, R., Federhen, S., Geer, L.Y., Helmberg, W., Kapustin, Y., Kenton, D.L., Khovayko, O., Lipman, D.J., Madden, T.L., Maglott, D.R., Ostell, J., Pruitt, K.D., Schuler, G.D., Schriml, L.M., Sequeira, E., Sherry, S.T., Sirotkin, K., Souvorov, A., Starchenko, G., Suzek, T.O., Tatusov, R., Tatusova, T.A., Wagner, L., Yaschenko, E., 2006. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 34, D173–D180. Woese, C.R., Maniloff, J., Zablen, L.B., 1980. Phylogenetic analysis of the mycoplasmas. Proc. Natl. Acad. Sci. USA 77, 494–498. Wolf, M., Muller, T., Dandekar, T., Pollack, J.D., 2004. Phylogeny of Firmicutes with special reference to Mycoplasma (Mollicutes) as inferred from phosphoglycerate kinase amino acid sequence data. Int. J. Syst. Evol. Microbiol. 54, 871–875.