Genetic and functional analyses of the gene encoding synaptophysin in schizophrenia

Schizophrenia Research 137 (2012) 14–19

Contents lists available at SciVerse ScienceDirect

Schizophrenia Research journal homepage: www.elsevier.com/locate/schres

Genetic and functional analyses of the gene encoding synaptophysin in schizophrenia Yu-Chih Shen a, b, Ho-Min Tsai c, Jhen-Wei Ruan d, Yi-Chu Liao d, Shih-Fen Chen e, Chia-Hsiang Chen c, f,⁎ a

Department of Psychiatry, Tzu Chi General Hospital, Hualien, Taiwan School of Medicine and Department of Human Development, Tzu Chi University, Hualien, Taiwan c Division of Mental Health and Addiction Medicine, Institute of Population Health Sciences, National Health Research Institutes, Zhunan, Taiwan d Institute of Medical Sciences, Tzu Chi University, Hualien, Taiwan e Department of Life Science and Graduate Institute of Biotechnology, Dong-Hwa University, Hualien, Taiwan f Department of Psychiatry, Chang Gung Memorial Hospital at Linkou and Chang Gung University School of Medicine, Taoyuan, Taiwan b

a r t i c l e

i n f o

Article history: Received 14 November 2011 Received in revised form 6 January 2012 Accepted 22 January 2012 Available online 19 February 2012 Keywords: Synaptophysin SYP Schizophrenia Rare variants Association and functional study

a b s t r a c t Objectives: Synaptophysin (SYP) has been shown to be critical for regulating neurotransmitter release and synaptic plasticity, a process thought to be disrupted in schizophrenia. In addition, abnormal SYP expression in different brain regions has been linked to this disorder in postmortem brain studies. We investigated the involvement of the SYP gene in the susceptibility to schizophrenia. Methods: We searched for genetic variants in the promoter region, all exons, and both UTR ends of the SYP gene using direct sequencing in a sample of patients with schizophrenia (n = 586) and non-psychotic controls (n= 576), both being Han Chinese from Taiwan, and conducted an association and functional study. Results: We identified 2 common SNPs (c.*4+271A>G and c.*4+565T>C) in the SYP gene. SNP and haplotypebased analyses displayed no associations with schizophrenia. In addition, we identified 6 rare variants in 7 out of 586 patients, including 1 variant (g.-511T>C) located at the promoter region, 1 synonymous (A104A) and 2 missense variants (G293A and A324T) located at the exonic regions, and 2 variants (c.*31G>A and c.*1001G>T) located at the 3′UTR. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated the influence of g.-511T>C and c.*1001G>T on the regulatory function of the SYP gene, while that the influence of c.*31G>A may be tolerated. In silico analysis demonstrated the functional relevance of other rare variants. Conclusion: Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and provides genetic clues that indicate the involvement of SYP in this disorder. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Over the past 2 decades, structural anomalies have been identified in the brains of patients with schizophrenia (Harrison, 1999). This can be seen in in vivo neuroimaging studies that have demonstrated a significant ventricular enlargement and a decrease in cortical mass (Lawrie and Abukmeil, 1998). Postmortem brain studies have shown a reduction in total brain volume, particularly in the cerebral cortex (Pakkenberg, 1992), and functional brain imaging studies have indicated impaired connectivity between the frontal lobe and other brain regions (Friston and Frith, 1995; McGuire and Frith, 1996). At the cellular and molecular level, microscopic histopathologic studies have demonstrated a reduced neuronal size and decreased density of dendritic spines (Selemon and Goldman-Rakic, 1999). Taken together, the changes in synaptic components may reflect a decrease in cortical volume, and it is believed that such changes may underlie the aberrant ⁎ Corresponding author at: Division of Mental Health and Addiction Medicine, Institute of Population Health Sciences, National Health Research Institutes, Zhunan 350, Taiwan. Tel.: +886 37 246166x36713; fax: +886 37 586453. E-mail address: [email protected] (C.-H. Chen). 0920-9964/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.schres.2012.01.028

functional connectivity in schizophrenia (Frankle et al., 2003; Eastwood, 2004). For these reasons, some synaptic proteins have been utilized as proxy markers of synapses to determine whether synaptic alterations are a feature of schizophrenia (Frankle et al., 2003; Eastwood, 2004). One such synaptic protein repeatedly reported in schizophrenia is synaptophysin (SYP) (Eastwood, 2004). SYP is an abundant integral membrane protein of synaptic vesicles expressed in 95% of cortical synaptic terminals (Sudhof et al., 1987; Fykse et al., 1993). Its expression occurs early in neurogenesis and is greatly up-regulated during synaptogenesis (Marazzi and Buckley, 1993). This protein is known to regulate neurotransmitter release and synaptic plasticity (Alder et al., 1992, 1995). In addition, it participates in the biogenesis and recycling of synaptic vesicles (Daly et al., 2000; Thiele et al., 2000). Several studies have examined SYP expression in the postmortem brains of patients with schizophrenia. Using in situ hybridization, histochemistry, immune-autoradiography, and Western blotting analysis, decreased SYP expression has been demonstrated in the prefrontal cortex, medial temporal cortex, visual association cortex, hippocampus, and thalamus (Eastwood and Harrison, 1995; Eastwood et al., 1995; Perrone-Bizzozero et al., 1996; Glantz and Lewis, 1997; Davidsson

Y.-C. Shen et al. / Schizophrenia Research 137 (2012) 14–19

et al., 1999; Eastwood and Harrison, 1999; Karson et al., 1999; Landen et al., 1999; Vawter et al., 1999; Eastwood and Harrison, 2001; Eastwood et al., 2001; Webster et al., 2001; Hemby et al., 2002; Mukaetova-Ladinska et al., 2002; Halim et al., 2003; Chambers et al., 2005). Conversely, elevated SYP protein levels have been found in the anterior cingulate cortex (Gabriel et al., 1997; Honer et al., 1999). Microarray studies also have highlighted the lower levels of SYP in the postmortem brains of patients with schizophrenia, along with other presynaptic markers (Mirnics et al., 2006). These findings lend support to the notion that SYP disturbance in specific brain regions might be part of the pathogenesis of schizophrenia (Eastwood, 2004). The SYP gene (Gene ID: 6855) is mapped to chromosome Xp11.23-11.22. This region has been reported to be linked to schizophrenia (Dann et al., 1997; Wei and Hemmings, 2000). The function of SYP, to a large extent, is supposed to be affected by its genetic variations (Wei and Hemmings, 2006). Although a case–control study has reported no association between the polymorphism rs3817678 at the SYP locus and schizophrenia (Wei and Hemmings, 2006), we are still interested in understanding whether the SYP gene plays a role in conferring genetic liability to schizophrenia. To test this possibility, we searched for genetic variants in the SYP gene using direct sequencing in a sample of patients with schizophrenia (n= 586) and non-psychotic controls (n= 576), both being Han Chinese from Taiwan, and conducted an association and functional study.

2. Methods 2.1. Subjects All of the subjects recruited into this study were Han Chinese from Taiwan. Patients meeting the diagnostic criteria of schizophrenia, based on the structured clinical interview for the DSM-IV-TR (American Psychiatric Association, 2000), were recruited into this study. Exclusion criteria included psychosis due to general medical conditions, substance-related psychosis, and mood disorder with psychotic features. Non-psychotic controls were recruited from the Department of Family Medicine of a medical center located in Taiwan. The screening of these patients and controls was based on a clinical interview and review of previous medical records by senior psychiatrists with consensus. The study was approved by the Institutional Review Board of Tzu-Chi Hospital. After a complete description of the study to the participants, written informed consent was obtained in line with the Institution's Review Board guidelines. The patient group was composed of 586 patients with schizophrenia (302 males, 284 females; mean age

15

45.8± 12.5 years); while the control group was composed of 576 subjects (293 males, 283 females; mean age 43.2 ± 11.1 years). 2.2. Genetic analysis The human SYP gene spans approximately 12.4 kb at chromosome Xp11.23-11.22 and contains 6 exons. The encoded protein has 313 amino acids with a predicted molecular weight of 38 kDa (Ozcelik et al., 1990). The putative core promoter region, shown in Fig. 1, was predicted at 350–650 bp upstream from the transcription start site by FirstEF in the UCSC genome browser (http://genom.ucsc.edu/cgi-bin/hgGateway) (size: 570 bp; position: chrX: 49056697–49057266; probability: 1). In addition, an overlapping exon, which was an exon overlap in an intron in another transcript, was predicted in intron 6 by Alt Events in the UCSC genome browser (size: 891 bp; position: chrX: 49046999–49047889). When genetic variations in the promoter region were identified, TESS (http://www.cbil.upenn.edu/cgi-bin/tess/tess) was used to predict their influence on transcription factor binding sites (TFBSs). When genetic variations in the exonic region or UTR were identified, RegRNA (http://regrna.mbc.nctu.edu.tw/index.php) was used to predict their influence on different regulatory RNA elements, such as motifs in UTR ends, motifs involved in transcriptional regulation, the splicing donor/acceptor sites, and the miRNA target sites. The rudimentary functional influence of the missense variations in the exonic regions was analyzed using PolyPhen-2 (http://genetics.bwh.harvard. edu/pph2/) and SIFT (http://sift.jcvi.org/). In order to sequence the SYP gene in our sample, blood samples were collected from each subject. Then, genomic DNA was extracted from whole blood using the Puregene DNA purification system (Gentra Systems Inc. Minneapolis, MI). Optimal polymerase chain reaction (PCR) primer sequences were generated by Primer3 (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). We designed 11 amplicons to cover the putative core promoter region, all of the exonic regions, and both UTR ends. Their flanking intronic sequences ranged from 50 to 249 nucleotides. PCR cycling conditions consisted of an initial denaturation at 95 °C for 5 min, followed by 30 cycles of 95 °C for 50 s, the optimal annealing temperature of each primer pair for 50 s, and 72 °C for 50 s, with a final elongation step at 72 °C for 10 min. The primer sequences and PCR conditions used for amplification are listed in Table 1. After PCR amplification, aliquots of PCR products were processed using a PCR Pre-Sequencing Kit (USB Corp. Cleveland, OH) to remove residual primers and dNTPs, following the manufacturer's protocol. The purified PCR products were subjected to direct sequencing using an ABI PRISM® BigDye® Terminator Cycle Sequencing Ready Reaction

Fig. 1. Schematic genomic structure of the SYP gene and the locations of all the genetic variants identified in this study. The left gray box indicates the putative core promoter region, while the right gray box indicates the overlapping exon in intron 6. The black box indicates the protein-coding region, while the white box indicates the untranslated region. Common SNPs are listed above the schematic genomic structure, while rare variants are listed below the schematic genomic structure. PCPR: putative core promoter region; E: exon; OE: the overlapping exon in intron 6; #: patient-specific rare variants.

16

Y.-C. Shen et al. / Schizophrenia Research 137 (2012) 14–19

Table 1 Primer sequences, optimal annealing temperature (Ta), and size of PCR products for PCR amplification of the putative core promoter region and all the exons (including both UTR ends) of the SYP gene. Amplicon

Forward (5′–3′)

Reverse (3′–5′)

Ta (°C)

Size (bp)

PCPR1 PCPR2/5′UTR/Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6/ 3′UTR1/OE1 OE2 3′UTR2 3′UTR3 3′UTR4

TGACCTTGATGGGCCTAGTT TGGGGAATTATTTTCCTCGTC AGACCTTCCCACCAGTCCTT AGAGAAGAGGGAGGTCAGCA AGTGCTTGGGTTGGAGTGAG TCACACTCCCACATCCTCTG TTCTGCACATCGACGTTCTC GAGCCAATCAAGAGGCAGAA GGGGGCAAGGTCAGGTAT CTCCACTCCTCCCAACTCTG AGGAGCTTCCAGATGGGTTT

TGCCAGGCTCTTTTCTGAGT AAAGAGCGCACTCCTTTTCTC CGTCACAGTCTCCCACTTCA CAGAGCAGTGCCAGGTACAA GGCTGTTATGGTGGCTGTTT CTTTGGGGACAGTCTGTGGT CTGTCCATCTTGAAGCACCA ACAAGGTCTCGCTCTGTTGC CTCCACACCTCCTCTCCAAG GCCTCACCCTACAAGCCATA CACCTCTCCCTCCTTTCTCC

55 55 60 62 60 60 60 65 67 60 60

400 625 481 531 534 593 713 761 711 699 582

PCPR: putative core promoter region; OE: the overlapping exon in intron 6.

Kit Version 3.1 and an ABI autosequencer 3730 (Perkin Elmer Applied Biosystem, Foster City, CA), according to the manufacturer's protocol. An experienced researcher conducted the genotyping and read out the data, and the genetic variants were verified by repeated PCR and sequencing in both directions. 2.3. Statistical analysis The SHEsis program was used to compare allele, genotype, and haplotype frequencies between the patient and control groups (Shi and He, 2005). In addition, Haploview version 4.2 was used for pair-wise linkage disequilibrium (LD) measurement, for assessing block structure, and for comparing the haplotype block frequencies (Barrett et al., 2005). P-values less than 0.05 were considered significant. Any significant P-value was corrected for multiple testing using the rough false discovery rate (Storey, 2002). Post-hoc power analysis was performed using the Genetic Power Calculator (http://pngu.mgh. harvard.edu/~purcell/gpc/) under the assumption of the following parameters: multiplicative inheritance mode, genotype relative risk = 1.2, prevalence of disease = 0.01, alpha level = 0.05, and risk allele frequency of each SNP (Purcell et al., 2003). Since the SYP gene is located at chromosome X, the results of the above comparisons were further analyzed by gender. 3. Results 3.1. SNP identification and association study with schizophrenia After sequencing all of the amplicons of the 586 patients and 576 control subjects, we detected 2 common SNPs (c.*4+271A>G (rs2293945) and c.*4+565T>C (rs3817678)) in this sample, located at the overlapping exon in intron 6. The locations of these 2 SNPs are illustrated in Fig. 1, and the nomenclature follows the guidelines of the “Human Genome Variation Society” (den Dunnen and Antonarakis, 2001). For the 2 SNPs, no significant deviations from the expected values in the Hardy–Weinberg equilibrium were found for either the patient or the control group when they were sub-grouped by gender (data

not shown). In single SNP analysis, there were no significant differences in allele or genotype frequencies detected between the patients and control subjects when they were sub-grouped by gender. The detailed genotype and allele frequencies are listed in Tables 2 and 3. In addition, the power to detect the fixed genotype relative risk of each SNP is presented in Tables 2 and 3. These 2 SNPs were found to be in complete LD both in the patient group and in the control group (D′ = 1, r 2 = 1). Haplotype analysis showed no differences between the patient and control subjects when they were sub-grouped by gender (data not shown). 3.2. Detection of rare variants associated with schizophrenia After sequencing all of the amplicons of the 586 patients and 576 control subjects, we identified 6 rare variants in 7 out of 586 patients, including 1 variant (g.-511T>C) located at the promoter region, 1 synonymous (A104A) and 2 missense variants (G293A and A324T) located at the exonic regions, and 2 variants (c.*31G>A and c.*1001G>T) located at the 3′UTR. These rare variants were not identified in any of the control subjects. The nomenclature of these newly identified rare variants followed the guidelines of the “Human Genome Variation Society” (den Dunnen and Antonarakis, 2001). The locations of these rare variants are illustrated in Fig. 1 and summarized in Table 4. Since the subjects were recruited for a population-based case–control association study, their family members were not available for further family study. In detail, at the promoter region, a T-to-C substitution (g.-511T>C) that may affect the function of the upstream open reading frame (uORF) was identified in 1 male patient. At exon 4, a C-to-T (c.312C>T) nucleotide substitution that does not change the amino acid sequence of alanine at codon 104 (A104A) was observed in 2 female patients. This rare variant is unlikely to activate the splicing donor/acceptor sites. Nevertheless, it may influence the binding of an exonic splicing enhancer, Splicing Factor 2/ Alternative Splicing Factor (SF2/ASF). At exon 6, a G-to-C nucleotide substitution (c.878 G>C) that changes the amino acid glycine to alanine at codon 293 (G293A) was identified in 1 male patient. At the overlapping exon in intron 6, a C-to-T nucleotide substitution (c.*4+24G>A) that changes alanine at codon 324 to threonine (A324T) was identified in 1 female patient. In

Table 2 Genotype and allele frequencies of the identified common SNPs and the results of comparisons between the male patient (n = 302) and control (n = 293) groups. Location

SNP ID

Allele counts (frequency)

P (allele)a

Power (%)

G/– 202 (0.669) 190 (0.648)

0.60

A 100 (0.331) 103 (0.352)

G 202 (0.669) 190 (0.648)

0.60

30.7

C/– 202 (0.669) 190 (0.648)

0.60

T 100 (0.331) 103 (0.352)

C 202 (0.669) 190 (0.648)

0.60

30.7

Genotype counts (frequency)

OE

c.*4+271A>G (rs2293945)

Schizophrenia Control

A/– 100 (0.331) 103 (0.352)

OE

c.*4+565T>C (rs3817678)

Schizophrenia Control

T/– 100 (0.331) 103 (0.352)

a

P (genotype)a

Group

Fisher's P value; OE: the overlapping exon in intron 6.

Y.-C. Shen et al. / Schizophrenia Research 137 (2012) 14–19

17

Table 3 Genotype and allele frequencies of the identified common SNPs and the results of comparisons between the female patient (n = 284) and control (n = 283) groups. Location

OE

SNP ID

c.*4+271A>G (rs2293945) c.*4+565T>C (rs3817678)

Group

Schizophrenia Control Schizophrenia Control

Allele (1/2)a

A/G T/C

P (genotype)b

Genotype counts (frequency) 1/1

1/2

50 40 50 40

122 120 122 120

(0.176) (0.141) (0.176) (0.141)

2/2 (0.430) (0.424) (0.430) (0.424)

112 123 112 123

Allele counts (frequency) 1

(0.394) (0.435) (0.394) (0.435)

0.44 0.44

222 200 222 200

P (allele)b

Power (%)

0.19

55.3

0.19

55.3

2 (0.391) (0.353) (0.391) (0.353)

346 366 346 366

(0.609) (0.647) (0.609) (0.647)

OE: the overlapping exon in intron 6. a 1/2: allele 1/ allele 2. b Fisher's P value.

silico analysis using PolyPhen-2 predicted the 2 missense variants were “benign”, while SIFT predicted they “affect protein function”. At 3′UTR, a G-to-A nucleotide substitution (c.*31G>A) was identified in 1 male patient, and may influence the binding of a human miRNA (hsa-miR-324-3p) to the 3′UTR of the SYP. In addition, a G-toT nucleotide substitution (c.*1001G>T) was identified in 1 male patient. This substitution may influence the binding of a human miRNA (hsamiR-629) to the 3′UTR of the SYP, and is predicted to influence the function of the gamma interferon inhibitor of translation (GAIT element). 3.3. Functional characterization of g.-511T>C, c.*31G>A and c.*1001G>T using the reporter gene activity assay Genomic DNA from each patient with g.-511T>C, c.*31G>A and c.*1001G>T was used to construct the inserts for the reporter gene assay. A 724 bp fragment covering the entire core promoter region was amplified using PCR with the sense primer (5′-TGACCTTGATGGGCC TAGTT-3′) and antisense primer (5′-TACCTGATTCACCACGTCCA-3′) for further functional assay of g.-511T>C. Amplicons 3′UTR2 and 3′UTR3 (see Table 1) covering partial 3′UTR were also amplified using PCR for functional assay of c.*31G>A and c.*1001G>T, respectively. These PCR fragments were first cloned into the pCR-Blunt II-TOPO vector (Invitrogen, CA, USA), then subcloned into the pGL3-basic reporter vector (Promega, Madison, WI, USA) for g.-511T and g.-511C, and subcloned into the pMIR-REPORT™ miRNA expression reporter vector (Ambion, Austin, TX, USA) for c.*31G, c.*31A, c.*1001G and c.*1001T. Both of the vectors carried the gene for firefly luciferase (Fluc). The authenticity of each construct was verified by direct sequencing. Since the PCR fragments used in the reporter assay may cover some SNP sites, the allele was kept constant at these loci. Transfection of the plasmids containing each construct was performed in a SKNSH neuroblastoma cell line cultured in Minimum Essential Medium (MEM) containing 5% fetal bovine serum in 24-well plates using LipofetamineTM2000 (Invitrogen, California, USA), according to the manufacturer's protocol. Each well contained 105 cells, 800 ng of reporter plasmid, 160 ng of pRL-TK carrying the gene for renilla luciferase (Rluc) (Promega, Madison, WI, USA) as an internal control, and 2 ml of LipofetamineTM2000. Transfection was repeated 6 times for each reporter plasmid. At 30 h after transfection, cells were lysed and the luciferase activities were measured using the Dual-Luciferase Reporter Assay System, according to the manufacturer's

instructions (Promega, Madison, WI, USA). The Fluc activity was normalized against the Rluc activity in each transfection. As shown in Table 5, the regulatory activity of the construct containing g.-511C was significantly lower than that of the wild type construct (g.-511T) (two-tailed t-test, p b 0.001). In addition, the regulatory activity of the construct containing c.*31A was similar to that of the wild type construct (c.*31G) (p= 0.21). Furthermore, the regulatory activity of the construct containing c.*1001T was significantly higher than that of the wild type construct (c.*1001G) (pb 0.001). In the presence of 20 pmol hsa-miR-324-3p and using β-gal to carry the gene for β-galactosidase (Ambion, Austin, TX, USA) as an internal control, the regulatory activities of the construct containing c.*31A and c.*31G were also similar (p= 0.48) (See Table 6). 4. Discussion In this study, we used a re-sequencing strategy to search for genetic variants in the SYP gene in a sample of schizophrenic and control subjects, and assessed their associations with schizophrenia. In spite of the evidence for SYP being a plausible candidate gene for schizophrenia (Frankle et al., 2003; Eastwood, 2004), no significant difference was observed between the patients and controls in allelic frequencies and genotypic distributions of the studied common polymorphisms. Thus, the present study indicates that the common polymorphisms in the promoter region and exons (including UTR ends) of the SYP gene appear not to play a major role in conferring susceptibility to schizophrenia in the studied population. Nevertheless, the conclusion is limited by the small sample size, and there is not enough power to detect the small effect size. Although the genetic bases of schizophrenia have been attributed to the joint effects of multiple common polymorphisms with a small-tomodest effect on the risk (Craddock et al., 2007), there is an increasing appreciation that at least some patients with schizophrenia are associated with monogenic rare variants that have a relatively higher clinical penetrance (McClellan et al., 2007; Williams et al., 2009). The observation that SYP could regulate neurotransmitter releasing and synaptic plasticity suggested that any variant of this gene is likely to interfere with these important functions (Alder et al., 1992, 1995). In this study, we identified 6 rare variants in 7 out of 586 patients, but no rare variants were found in the 576 control subjects, suggesting that the rare variants may contribute to the pathogenesis of schizophrenia.

Table 4 Rare variants in SYP gene of our patient cohort. Location

Nucleotide change

Change of motifs, AA, ESEs or miRNA binding

Number of patients (genotype)

PCPR Exon 4 Exon 6 OE 3′UTR

g.-511T>C c.312C>T (A104A) c.878G>C (G293A) c.*4+24G>A (A324T) c.*31G>A c.*1001G>T

uORF (motif in promoter region) SF2/ASF (ESE) AA (benign, affect protein function) AA (benign, affect protein function) hsa-miR-324-3p GAIT element (motif in 3′UTR) hsa-miR-629

1 (C/–) 2 (CT) 1 (C/–) 1 (AA) 1 (A/–) 1 (T/–)

AA: amino acid; ESE: exonic splicing enhancer; PCPR: putative core promoter region; uORF: upstream open reading frame; OE: the overlapping exon in intron 6; GAIT element: gamma interferon inhibitor of translation.

18

Y.-C. Shen et al. / Schizophrenia Research 137 (2012) 14–19

Table 5 Reporter gene activity assay of g.-511T>C, c.*31G>A and c.*1001G>T in the SYP gene. Location

Group

Fluc/Rluc (n = 6)

P value

PCPR

Wild type construct (g.-511T) Mutant construct (g.-511C) Wild type construct (c.*31G) Mutant construct (c.*31A) Wild type construct (c.*1001G) Mutant construct (c.*1001T)

4.08 ± 0.18 3.48 ± 0.14 2.16 ± 0.13 2.00 ± 0.26 2.96 ± 0.29 4.36 ± 0.21

b0.001

3′UTR

0.21 b0.001

Fluc/Rluc indicates the luciferase activity normalized by renilla activity. P value indicates the significance of the difference between the wild type and the mutant (two-tailed t-test).

The 2 patient-specific missense rare variants identified in exon 6 (G293A and A324T) were predicted as “benign” and “affect protein function” using different software. Their encoded amino acids are conserved in rhesus monkey, dog, and mouse. SYP has a unique C-terminal cytoplasmic tail that contains 9 copies of an imperfect pentapeptide repeat, YGP(Q)QG (Ozcelik et al., 1990). The last 3 repeats (residue 278–307) are responsible for binding Siah-1A (Wheeler et al., 2002). The Siah-1A, a putative E3 ubiquitin-protein ligase, has been demonstrated to regulate the ubiquitination and degradation of SYP by the proteasome pathway (Wheeler et al., 2002). The 2 missense rare variants are located near or at this region, which may affect interactions with Siah-1A, and have subsequent deleterious effects on neurotransmitter release and synaptic plasticity. Further assays are needed to address their functional significance. In addition, we also identified a patient-specific synonymous rare variant in exon 4 (A104A). Its encoded amino acid is conserved in rhesus monkey, dog, and mouse. A growing amount of evidence suggests that synonymous variants may not always be silent; they may affect the abundance and function of protein through activation of cryptic splicing sites, influencing the stability of mRNA or altering the protein-folding pathway (Duan et al., 2003; Parmley and Hurst, 2007; Sauna et al., 2007; Tsai et al., 2008). The identified synonymous rare variant was predicted to influence the binding of a serine/ arginine-rich (SR) protein, SF2/ASF. The SR proteins are involved in regulating and selecting splice sites during alternative splicing (Graveley, 2000). We speculate that this variant might influence the binding of SF2/ASF and further affect the splicing of the SYP. Further functional analyses are needed to verify this speculation. Furthermore, we found a patient-specific rare variant located at the putative core promoter region (g.-511T>C). The T nucleotide of this variant is conserved in rhesus monkey, dog, and mouse. The result of the reporter gene assay supports its influence on the regulatory function of the SYP gene. This rare variant was predicted to influence the function of uORF. Expression of the uORF typically interferes with the expression of a downstream primary ORF and regulates the gene expression (Vilela and McCarthy, 2003). We speculate that this variant may affect the amount of SYP in the brain and, consequently, affect synaptic plasticity. Further functional assays are warranted to address these issues. Finally, 2 rare variants (c.*31G>A and c.*1001G>T) located at 3′UTR were identified. The G nucleotides of the c.*31G>A and c.*1001G>T are not conserved in rhesus monkey, dog, and mouse. The 2 rare variants

Table 6 Reporter gene activity assay of c.*31G>A in the present of hsa-miR-324-3p. Group

Fluc/β-gal (n = 6)

P value

c.*31G + miR-324-3p c.*31A + miR-324-3p

977.75 ± 59.99 1126.61 ± 269.35

0.48

Fluc/β-gal indicates the luciferase activity normalized by β-galactosidase activity; P value indicates the significance of the difference between the wild type and the mutant (two-tailed t-test).

may influence the binding of different kinds of miRNAs. In addition, the c.*1001G>T was predicted to influence the function of the GAIT element. The result of the reporter gene assay supports the influence of c.*1001G>T on the regulatory function of the SYP gene, while the influence of c.*31G>A may be tolerated. Recently, with the identification of regulatory miRNAs as important factors in brain development and function (Smirnova et al., 2005), a growing body of evidence suggests that alterations in the interactions between miRNAs and their targets may contribute to phenotypic variations of schizophrenia (Perkins et al., 2005; Hansen et al., 2007; Coyle, 2009). In addition, the GAIT element, which was a cis-acting RNA element in the 3′UTR, was involved in selective translational silencing of gene transcripts (Sampath et al., 2003). Taken together, we speculate that c.*1001G>T may affect the amount or the distribution of SYP in the brain, and consequently affect neurotransmitter release and synaptic plasticity. Further functional analyses are needed to verify this speculation. Recently, de novo DNA copy number variations (CNVs) have been found to be associated with schizophrenia in some sporadic cases (Delisi, 2009), which is in line with the rare variant hypothesis of schizophrenia. In the UCSC genome variation database, there are several CNVs reported at chromosome Xp11.2. Nevertheless, their relationship with schizophrenia is unclear. In future studies, it would be of interest to investigate whether there are copy number changes in the SYP gene in patients with schizophrenia. Although we found no association between the studied SYP common polymorphisms and schizophrenia in the present study, this result does not rule out the possible association of the SYP gene with schizophrenia in other ethnic groups or some subtypes of schizophrenia. Also, we could not completely rule out the fact that altered SYP expression in different brain regions plays a role in schizophrenia. Instead of the possibility that functional rare variants influence SYP expression in schizophrenia, it could be that these findings are secondary to the aberrant activity of some genes that modulate the expression of SYP in the brain. Thus, further studies are warranted to elucidate the complex mechanisms involved in the regulation of SYP expression to confirm its role in schizophrenia. This study has several limitations. First, several potentially important regions were not sequenced, including conserved intronic regions that may contain regulatory elements, new exons, and new promoter regions derived from the alternative splicing of this gene. Second, the sample size of this study was relatively small. Hence, the existence of these rare variants should be assessed in a larger control Han Chinese population to clarify whether they are benign or potentially pathogenic. In conclusion, this study suggests that the common polymorphisms of the SYP gene appear not to play a major role in conferring susceptibility to schizophrenia in our studied population. Nevertheless, some rare variants in the SYP gene with possibly damaging effects in our patients may be of importance. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and may provide genetic clues to indicate the involvement of SYP in this disorder.

Role of funding source The funding source has no further role in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication.

Contributors Author Chia-Hsiang Chen designs the study and writes the protocol. Author Yu-Chih Shen, and Shih-Fen Chen manage the literature searches and perform the genetic analyses. Authors Ho-Min Tsai, Jhen-Wei Ruan, and Yi-Chu Liao undertake the functional analysis of identified rare variants. Author Yu-Chih Shen writes the first draft of the manuscript. All authors have approved the final manuscript.

Conflict of interest The authors declare no conflict of interest.

Y.-C. Shen et al. / Schizophrenia Research 137 (2012) 14–19 Acknowledgment Funding for this study is provided by the National Science Council of Taiwan (NSC 99-2314-B-303-010-MY3).

References Alder, J., Lu, B., Valtorta, F., Greengard, P., Poo, M.M., 1992. Calcium-dependent transmitter secretion reconstituted in Xenopus oocytes: requirement for synaptophysin. Science 257, 657–661. Alder, J., Kanki, H., Valtorta, F., Greengard, P., Poo, M.M., 1995. Overexpression of synaptophysin enhances neurotransmitter secretion at Xenopus neuromuscular synapses. J. Neurosci. 15, 511–519. American Psychiatric Association, 2000. Diagnostic and Statistical Manual of Mental Disorders, 4th ed., text rev. Author, Washington, DC. Barrett, J.C., Fry, B., Maller, J., Daly, M.J., 2005. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21, 263–265. Chambers, J.S., Thomas, D., Saland, L., Neve, R.L., Perrone-Bizzozero, N.I., 2005. Growthassociated protein 43 (GAP-43) and synaptophysin alterations in the dentate gyrus of patients with schizophrenia. Prog. Neuropsychopharmacol. Biol. Psychiatry 29, 283–290. Coyle, J.T., 2009. MicroRNAs suggest a new mechanism for altered brain gene expression in schizophrenia. Proc. Natl. Acad. Sci. U. S. A. 106, 2975–2976. Craddock, N., O'Donovan, M.C., Owen, M.J., 2007. Phenotypic and genetic complexity of psychosis. Invited commentary on … Schizophrenia: a common disease caused by multiple rare alleles. Br. J. Psychiatry 190, 200–203. Daly, C., Sugimori, M., Moreira, J.E., Ziff, E.B., Llinas, R., 2000. Synaptophysin regulates clathrin-independent endocytosis of synaptic vesicles. Proc. Natl. Acad. Sci. U. S. A. 97, 6120–6125. Dann, J., DeLisi, L.E., Devoto, M., Laval, S., Nancarrow, D.J., Shields, G., Smith, A., Loftus, J., Peterson, P., Vita, A., Comazzi, M., Invernizzi, G., Levinson, D.F., Wildenauer, D., Mowry, B.J., Collier, D., Powell, J., Crowe, R.R., Andreasen, N.C., Silverman, J.M., Mohs, R.C., Murray, R.M., Walters, M.K., Lennon, D.P., Crow, T.J., et al., 1997. A linkage study of schizophrenia to markers within Xp11 near the MAOB gene. Psychiatry Res. 70, 131–143. Davidsson, P., Gottfries, J., Bogdanovic, N., Ekman, R., Karlsson, I., Gottfries, C.G., Blennow, K., 1999. The synaptic-vesicle-specific proteins rab3a and synaptophysin are reduced in thalamus and related cortical brain regions in schizophrenic brains. Schizophr. Res. 40, 23–29. Delisi, L.E., 2009. Searching for the true genetic vulnerability for schizophrenia. Genome Med. 1, 14. den Dunnen, J.T., Antonarakis, S.E., 2001. Nomenclature for the description of human sequence variations. Hum. Genet. 109, 121–124. Duan, J., Wainwright, M.S., Comeron, J.M., Saitou, N., Sanders, A.R., Gelernter, J., Gejman, P.V., 2003. Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum. Mol. Genet. 12, 205–216. Eastwood, S.L., 2004. The synaptic pathology of schizophrenia: is aberrant neurodevelopment and plasticity to blame? Int. Rev. Neurobiol. 59, 47–72. Eastwood, S.L., Harrison, P.J., 1995. Decreased synaptophysin in the medial temporal lobe in schizophrenia demonstrated using immunoautoradiography. Neuroscience 69, 339–343. Eastwood, S.L., Harrison, P.J., 1999. Detection and quantification of hippocampal synaptophysin messenger RNA in schizophrenia using autoclaved, formalin-fixed, paraffin wax-embedded sections. Neuroscience 93, 99–106. Eastwood, S.L., Harrison, P.J., 2001. Synaptic pathology in the anterior cingulate cortex in schizophrenia and mood disorders. A review and a Western blot study of synaptophysin, GAP-43 and the complexins. Brain Res. Bull. 55, 569–578. Eastwood, S.L., Burnet, P.W., Harrison, P.J., 1995. Altered synaptophysin expression as a marker of synaptic pathology in schizophrenia. Neuroscience 66, 309–319. Eastwood, S.L., Cotter, D., Harrison, P.J., 2001. Cerebellar synaptic protein expression in schizophrenia. Neuroscience 105, 219–229. Frankle, W.G., Lerma, J., Laruelle, M., 2003. The synaptic hypothesis of schizophrenia. Neuron 39, 205–216. Friston, K.J., Frith, C.D., 1995. Schizophrenia: a disconnection syndrome? Clin. Neurosci. 3, 89–97. Fykse, E.M., Takei, K., Walch-Solimena, C., Geppert, M., Jahn, R., De Camilli, P., Sudhof, T.C., 1993. Relative properties and localizations of synaptic vesicle protein isoforms: the case of the synaptophysins. J. Neurosci. 13, 4997–5007. Gabriel, S.M., Haroutunian, V., Powchik, P., Honer, W.G., Davidson, M., Davies, P., Davis, K.L., 1997. Increased concentrations of presynaptic proteins in the cingulate cortex of subjects with schizophrenia. Arch. Gen. Psychiatry 54, 559–566. Glantz, L.A., Lewis, D.A., 1997. Reduction of synaptophysin immunoreactivity in the prefrontal cortex of subjects with schizophrenia. Regional and diagnostic specificity. Arch. Gen. Psychiatry 54, 943–952. Graveley, B.R., 2000. Sorting out the complexity of SR protein functions. RNA 6, 1197–1211. Halim, N.D., Weickert, C.S., McClintock, B.W., Hyde, T.M., Weinberger, D.R., Kleinman, J.E., Lipska, B.K., 2003. Presynaptic proteins in the prefrontal cortex of patients with schizophrenia and rats with abnormal prefrontal development. Mol. Psychiatry 8, 797–810. Hansen, T., Olsen, L., Lindow, M., Jakobsen, K.D., Ullum, H., Jonsson, E., Andreassen, O.A., Djurovic, S., Melle, I., Agartz, I., Hall, H., Timm, S., Wang, A.G., Werge, T., 2007. Brain expressed microRNAs implicated in schizophrenia etiology. PLoS One 2, e873. Harrison, P.J., 1999. The neuropathology of schizophrenia. A critical review of the data and their interpretation. Brain 122 (Pt 4), 593–624.

19

Hemby, S.E., Ginsberg, S.D., Brunk, B., Arnold, S.E., Trojanowski, J.Q., Eberwine, J.H., 2002. Gene expression profile for schizophrenia: discrete neuron transcription patterns in the entorhinal cortex. Arch. Gen. Psychiatry 59, 631–640. Honer, W.G., Falkai, P., Chen, C., Arango, V., Mann, J.J., Dwork, A.J., 1999. Synaptic and plasticity-associated proteins in anterior frontal cortex in severe mental illness. Neuroscience 91, 1247–1255. Karson, C.N., Mrak, R.E., Schluterman, K.O., Sturner, W.Q., Sheng, J.G., Griffin, W.S., 1999. Alterations in synaptic proteins and their encoding mRNAs in prefrontal cortex in schizophrenia: a possible neurochemical basis for ‘hypofrontality’. Mol. Psychiatry 4, 39–45. Landen, M., Davidsson, P., Gottfries, C.G., Grenfeldt, B., Stridsberg, M., Blennow, K., 1999. Reduction of the small synaptic vesicle protein synaptophysin but not the large dense core chromogranins in the left thalamus of subjects with schizophrenia. Biol. Psychiatry 46, 1698–1702. Lawrie, S.M., Abukmeil, S.S., 1998. Brain abnormality in schizophrenia. A systematic and quantitative review of volumetric magnetic resonance imaging studies. Br. J. Psychiatry 172, 110–120. Marazzi, G., Buckley, K.M., 1993. Accumulation of mRNAs encoding synaptic vesiclespecific proteins precedes neurite extension during early neuronal development. Dev. Dyn. 197, 115–124. McClellan, J.M., Susser, E., King, M.C., 2007. Schizophrenia: a common disease caused by multiple rare alleles. Br. J. Psychiatry 190, 194–199. McGuire, P.K., Frith, C.D., 1996. Disordered functional connectivity in schizophrenia. Psychol. Med. 26, 663–667. Mirnics, K., Levitt, P., Lewis, D.A., 2006. Critical appraisal of DNA microarrays in psychiatric genomics. Biol. Psychiatry 60, 163–176. Mukaetova-Ladinska, E.B., Hurt, J., Honer, W.G., Harrington, C.R., Wischik, C.M., 2002. Loss of synaptic but not cytoskeletal proteins in the cerebellum of chronic schizophrenics. Neurosci. Lett. 317, 161–165. Ozcelik, T., Lafreniere, R.G., Archer III, B.T., Johnston, P.A., Willard, H.F., Francke, U., Sudhof, T.C., 1990. Synaptophysin: structure of the human gene and assignment to the X chromosome in man and mouse. Am. J. Hum. Genet. 47, 551–561. Pakkenberg, B., 1992. Stereological quantitation of human brains from normal and schizophrenic individuals. Acta Neurol. Scand. Suppl. 137, 20–33. Parmley, J.L., Hurst, L.D., 2007. How do synonymous mutations affect fitness? Bioessays 29, 515–519. Perkins, D.O., Jeffries, C., Sullivan, P., 2005. Expanding the ‘central dogma’: the regulatory role of nonprotein coding genes and implications for the genetic liability to schizophrenia. Mol. Psychiatry 10, 69–78. Perrone-Bizzozero, N.I., Sower, A.C., Bird, E.D., Benowitz, L.I., Ivins, K.J., Neve, R.L., 1996. Levels of the growth-associated protein GAP-43 are selectively increased in association cortices in schizophrenia. Proc. Natl. Acad. Sci. U. S. A. 93, 14182–14187. Purcell, S., Cherny, S.S., Sham, P.C., 2003. Genetic Power Calculator: design of linkage and association genetic mapping studies of complex traits. Bioinformatics 19, 149–150. Sampath, P., Mazumder, B., Seshadri, V., Fox, P.L., 2003. Transcript-selective translational silencing by gamma interferon is directed by a novel structural element in the ceruloplasmin mRNA 3′ untranslated region. Mol. Cell. Biol. 23, 1509–1519. Sauna, Z.E., Kimchi-Sarfaty, C., Ambudkar, S.V., Gottesman, M.M., 2007. The sounds of silence: synonymous mutations affect function. Pharmacogenomics 8, 527–532. Selemon, L.D., Goldman-Rakic, P.S., 1999. The reduced neuropil hypothesis: a circuit based model of schizophrenia. Biol. Psychiatry 45, 17–25. Shi, Y.Y., He, L., 2005. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res. 15, 97–98. Smirnova, L., Grafe, A., Seiler, A., Schumacher, S., Nitsch, R., Wulczyn, F.G., 2005. Regulation of miRNA expression during neural cell specification. Eur. J. Neurosci. 21, 1469–1477. Storey, J.D., 2002. A direct approach to false discovery rates. J. R. Stat. Soc. Ser. B 64, 479–498. Sudhof, T.C., Lottspeich, F., Greengard, P., Mehl, E., Jahn, R., 1987. A synaptic vesicle protein with a novel cytoplasmic domain and four transmembrane regions. Science 238, 1142–1144. Thiele, C., Hannah, M.J., Fahrenholz, F., Huttner, W.B., 2000. Cholesterol binds to synaptophysin and is required for biogenesis of synaptic vesicles. Nat. Cell Biol. 2, 42–49. Tsai, C.J., Sauna, Z.E., Kimchi-Sarfaty, C., Ambudkar, S.V., Gottesman, M.M., Nussinov, R., 2008. Synonymous mutations and ribosome stalling can lead to altered folding pathways and distinct minima. J. Mol. Biol. 383, 281–291. Vawter, M.P., Howard, A.L., Hyde, T.M., Kleinman, J.E., Freed, W.J., 1999. Alterations of hippocampal secreted N-CAM in bipolar disorder and synaptophysin in schizophrenia. Mol. Psychiatry 4, 467–475. Vilela, C., McCarthy, J.E., 2003. Regulation of fungal gene expression via short open reading frames in the mRNA 5′untranslated region. Mol. Microbiol. 49, 859–867. Webster, M.J., Shannon Weickert, C., Herman, M.M., Hyde, T.M., Kleinman, J.E., 2001. Synaptophysin and GAP-43 mRNA levels in the hippocampus of subjects with schizophrenia. Schizophr. Res. 49, 89–98. Wei, J., Hemmings, G.P., 2000. Searching for a locus for schizophrenia within chromosome Xp11. Am. J. Med. Genet. 96, 4–7. Wei, J., Hemmings, G.P., 2006. A further study of a possible locus for schizophrenia on the X chromosome. Biochem. Biophys. Res. Commun. 344, 1241–1245. Wheeler, T.C., Chin, L.S., Li, Y., Roudabush, F.L., Li, L., 2002. Regulation of synaptophysin degradation by mammalian homologues of seven in absentia. J. Biol. Chem. 277, 10273–10282. Williams, H.J., Owen, M.J., O'Donovan, M.C., 2009. Schizophrenia genetics: new insights from new approaches. Br. Med. Bull. 91, 61–74.