Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum

G Model

ARTICLE IN PRESS

BIOTEC-6571; No. of Pages 11

Journal of Biotechnology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum Tang Li a,1 , Xi Chen a,1 , Muhammad Tausif Chaudhry a , Bo Zhang a , Cheng-Ying Jiang a,b , Shuang-Jiang Liu a,b,∗ a b

State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, PR China Environmental Microbiology and Biotechnology Research Center, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, PR China

a r t i c l e

i n f o

Article history: Received 24 October 2013 Received in revised form 6 January 2014 Accepted 13 January 2014 Available online xxx Keywords: Corynebacterium glutamicum 4-Cresol Aromatic compound degradation P450 cre genes

a b s t r a c t Corynebacterium glutamicum uses 4-cresol as sole carbon source for growth. Protocatechuate 3,4dioxygenase activity had been detected when C. glutamicum was grown with 4-cresol. In this work, we found that 4-cresol was catabolized via 4-hydroxybenzoate and protocatechuate as intermediate metabolites, and a genetic cluster called cre (designated for 4-cresol, creABCDEFGHIR, tagged as ncgl0521–ncgl0531 in NCBI) was identified. The cre gene cluster comprises of 11 genes, and six of them were experimentally confirmed to be involving in 4-cresol catabolism. The genes creD, creE, and creJ were involved in oxidation of 4-cresol into 4-hydroxybenzyl alcohol. The creD encoded a protein showing Mg2+ -dependent phosphohydrolase activity. The genes creE, creF, creJ encoded a putative P450 system. The creG encoded a NAD+ -dependent dehydrogenase and catalyzed 4-hydroxybenzyl alcohol to 4-hydroxybenzaldehyde. Two other genes creH and creI were involved in conversion of 4-hydroxybenzyl alcohol to 4-hydroxybenzoate, but their catalytic function is still unknown. Similar genetic clusters with high DNA sequence identity were identified in Arthrobacter and additional Corynebacterium species, suggesting that this genetic organization for 4-cresol catabolism might be more widely distributed in Gram-positive bacteria. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Corynebacterium glutamicum is a high-GC Gram-positive soil bacterium and is of industrial importance. It is well known for its robust ability to grow on a variety of carbohydrates as carbon sources. During the last years, C. glutamicum has been extensively characterized for its catabolism of various aromatic compounds (Huang et al., 2006; Qi et al., 2007; Shen and Liu, 2005; Shen et al., 2005a, 2005b, 2012). 4-Cresol is an aromatic compound that C. glutamicum assimilates for growth (Qi et al., 2007), but neither the metabolic pathway nor the genetics of 4-cresol degradation by C. glutamicum was reported. 4-Cresol is used as disinfectants, preservatives and for the manufacture of synthetic resins, and is highly toxic to higher organisms. It is a priority environmental pollutant, for example, in

∗ Corresponding author at: Institute of Microbiology, Chinese Academy of Sciences, Beichen West Road No. 1, Chaoyang District, Beijing 100101, PR China. Tel.: +86 10 64807423. E-mail address: [email protected] (S.-J. Liu). 1 These two authors contribute to this work equally.

groundwater (Tallur et al., 2006). Microbial degradation is the major route to remove 4-cresol from polluted environments, and many microbes such as Pseudomonas, Aspergillus, and Bacillus species (Dagley and Patel, 1957; Hopper, 1976; Jones et al., 1993; Keat and Hopper, 1978; Tallur et al., 2006) are able to degrade 4-cresol under either aerobic or anaerobic conditions. Under aerobic condition, 4-cresol is metabolized by a series of methyl group oxidations to 4-hydroxybenzoate, with 4-hydroxybenzyl alcohol and 4-hydroxybenzaldehyde as intermediate metabolites (Hopper, 1976; Keat and Hopper, 1978). 4-Hydroxybenzoate is further hydroxylated to protocatechuate (3,4-dihydroxybenzoate) (Hopper and Taylor, 1975), which is finally degraded via beta-ketoadipate pathway (Harwood and Parales, 1996) (Fig. 1). Under anaerobic condition, 4-cresol is metabolized via three different pathways: With obligately anaerobic bacterium Desulfobacterium cetonicum, 4-cresol metabolism is initiated by oxidation of its methyl group, and is further converted to 4-hydroxybenzylsuccinate with the consumption of fumarate (Muller et al., 2001). Some other sulfate-reducing bacteria metabolize 4-cresol by initial oxidation of its methyl group and subsequently dehydroxylation, thus converts 4-cresol into benzoate (Londry et al., 1999; Smolenski and Suflita, 1987) (Fig. 1). In

http://dx.doi.org/10.1016/j.jbiotec.2014.01.017 0168-1656/© 2014 Elsevier B.V. All rights reserved.

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017

G Model BIOTEC-6571; No. of Pages 11

ARTICLE IN PRESS T. Li et al. / Journal of Biotechnology xxx (2014) xxx–xxx

2

Fig. 1. Initial reactions of 4-cresol metabolism in bacteria. (A) 4-Cresol; (B) 4-hydroxybenzyl alcohol; (C) 4-hydroxybenzaldehyde; (D) 4-hydroxybenzoate; (E) protocatechuate; (F) 4-hydroxybenzoyl-CoA; (G) benzoate; (H) benzoyl-CoA. (I) In aerobic bacteria, 4-hydroxybenzoate is hydroxylated to protocatechuate. (II) In denitrifying bacteria, 4-hydroxybenzoate is metabolized to 4-hydroxybenzoyl-CoA and then to benzoyl-CoA. (III) In obligately anaerobic bacteria, 4-hydroxybenzoate is metabolized to benzoate and then to benzoyl-CoA. (a) 4-Cresol methylhydroxylase (PCMH); (b) 4-hydroxybenzaldehyde dehydrogenase; (c) 4-hydroxybenzoate hydroxylase.

denitrifying bacteria, 4-cresol is firstly oxidized into 4hydroxybenzoate, and 4-hydroxybenzoate is activated by thioesterification and forming 4-hydroxybenzoyl-coenzyme A (4HB-CoA). 4HB-CoA is further dehydroxylated to benzoyl-CoA, a central intermediate of anaerobic aromatic metabolism (Bossert and Young, 1986; Gibson et al., 1994; Rudolphi et al., 1991) (Fig. 1). Although progress has been made in understanding the biochemistry as well as genetics involving the initial reaction of 4-cresol metabolism, knowledge is limited to a few examples of bacteria, such as the well known aerobic Gram-negative Pseudomonas species (Cho et al., 2011; Hopper, 1976; Hopper and Taylor, 1975; Peters et al., 2007; Wright and Olsen, 1994). Here, we report the identification of metabolic intermediates and genetic cluster involving in 4-cresol catabolism in C. glutamicum. Results showed that C. glutamicum adopted a metabolic pathway started by oxidation of 4-cresol into 4-hydroxybenzoate that is similar to the previously reported pathway for Pseudomonas and Geobacter species (Cho et al., 2011; Peters et al., 2007), but the genetic organization and gene identities are unique in C. glutamicum. 2. Materials and methods

2.2. Analysis of sequence data The genomic sequence and protein sequences of C. glutamicum ATCC 13032 (accession no. NC 003450 and NC 006958) were retrieved from the GenBank database (http://www.ncbi.nlm. nih.gov/). Sequence comparisons and database searches were performed using BLAST programs at the NCBI website. For conserved domain analysis, the Conserved Domain Database (CDD) at the NCBI website and the Pfam database (Finn et al., 2010) were used. 2.3. DNA extraction and manipulation The genomic DNA of C. glutamicum was extracted by using of the method of Tauch et al. (1995). Plasmid isolation, DNA manipulation and DNA electrophoresis were performed according to the methods described by Sambrook et al. (1989). For genetic transformation of E. coli and C. glutamicum cells, electroporation was used as described by Tauch et al. (2002). 2.4. Amplification of DNA fragments with PCR and construction of plasmids

2.1. Bacterial strains, plasmids, and culture conditions The bacterial strains and plasmids used in this work are listed in Table 1. Escherichia coli was grown aerobically in Luria-Bertani (LB) broth with a rotary shaker (150 rpm) at 37 ◦ C. C. glutamicum was grown aerobically in LB broth, or in mineral salts medium (pH 8.4) (Konopka, 1993) supplemented with 0.03 g/l yeast extract to meet the requirement of vitamins, with a rotary shaker (150 rpm) at 30 ◦ C. Glucose (10 mM) or aromatic compounds (2 mM) were added into the mineral salts medium for carbon sources. Cell growth was measured by determining turbidity at 600 nm (OD600 ) using a spectrophotometer. For generation of mutants and maintenance of C. glutamicum, brain heart (BH) broth with 0.5 M sorbitol medium was used. When needed, antibiotics were used at the following concentrations: kanamycin, 50 mg/l for E. coli and 25 mg/l for C. glutamicum; ampicillin, 100 mg/l for E. coli; chloramphenicol, 20 mg/l for E. coli and 10 mg/l for C. glutamicum; and nalidixic acid, 50 mg/l for C. glutamicum.

All the PCRs were carried out using Pfu DNA polymerase or Taq DNA polymerase (Transgene, China). Primers used to amplify the entire or partial fragments of target genes are listed in Table 1. Deletion of target genes was constructed either by removing middle part through restriction enzyme digestion on creD or by overlap extension (SOEing) (Horton et al., 1989) on creH, creI and creJ. The fragments with partial deletions were ligated into plasmid pK18mobsacB (Schäfer et al., 1994) to generate recombinant vector pK18mobsacBcreD, pK18mobsacBcreH, pK18mobsacBcreI, and pK18mobsacBcreJ. For construction of genetically complementary vectors, the entire sequences of individual genes were amplified from genomic DNA of C. glutamicum and ligated into plasmid pXMJ19 (Jakoby et al., 1999) to generate recombination vectors pXMJ19-creD, pXMJ19-creH, pXMJ19-creI, and pXMJ19-creJ. Ribosome biding site (Amador et al., 1999) was added into all complementary sequences during PCR amplifications. For construction of protein expression vectors,

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017

G Model BIOTEC-6571; No. of Pages 11

ARTICLE IN PRESS T. Li et al. / Journal of Biotechnology xxx (2014) xxx–xxx

3

Table 1 Bacterial strains, plasmids and primers used in this study. Restriction endonucleotidase digestion sites are underlined. Ribosome binding sites are given in boldface. Strain, plasmid, or primer Strains E. coli DH5␣ BL21(DE3) C. glutamicum RES167 RES167pcaHG RES167creAB RES167creD RES167creE RES167creG RES167creH RES167creI RES167creJ Plasmids pK18mobsacB pK18mobsacB-creD pK18mobsacB-creE pK18mobsacB-creG pK18mobsacB-creH pK18mobsacB-creI pK18mobsacB-creJ pXMJ19 pXMJ19-creD pXMJ19-creE pXMJ19-creG pXMJ19-creH pXMJ19-creI pXMJ19-creJ pET28a pET28a-creD pET28a-creE pET28a-creF pET28a-creG pET28a-creJ Primers 05210522-F 05210522-R 524F 524R 524Fce 524Rce 525Fce 525Rce E26F E26R 527Fce 527Rce E30F E30R D0528A D0528B D0528C D0528D C0528F C0528R D0529A D0529B D0529C D0529D C0529F C0529R DL0530A DL0530B DL0530C DL0530D C0530F C0530R

Relevant characteristics

Source, reference, or note

F- 80lacZM15 (lacZYA-argF)U169 recA1 endA1 hsdR17(rk-, mk-) phoA supE44 thi-1 gyrA96 relA1 ␭− hdsS gal (␭cIts857 ind-l Sam7 nin-5 lacUV5-T7 gene 1)

Invitrogen

Restriction-deficient mutant of ATCC13032; (cglIM-cglIR-cglIIR) RES167 with disrupted pcaHG RES167 with disrupted creAB RES167 with disrupted creD RES167 with disrupted creE RES167 with disrupted creG RES167 with disrupted creH RES167 with disrupted creI RES167 with disrupted creJ

Gift from University of Bielefeld Shen and Liu (2005) This study This study Qi et al. (2007) Qi et al. (2007) This study This study This study

Mobilizable vector; allows for selection of double-crossover in C. glutamicum Carrying creD deletion (refer to RES167creD) Carrying creE deletion (refer to RES167creE) Carrying creG deletion (refer to RES167creG) Carrying creH deletion (refer to RES167creH) Carrying creI deletion (refer to RES167creI) Carrying creJ deletion (refer to RES167creJ) Shuttle vector (Camr , Ptac, lacq , pBL1 oriVC.glu , pK18 oriVE. col. ) Carrying creD (for complementation of creD) Carrying creE (for complementation of creE) Carrying creG (for complementation of creG) Carrying creH (for complementation of creH) Carrying creI (for complementation of creI) Carrying creJ (for complementation of creJ) Expression vector with N-terminal hexahistidine affinity tag pET28a derivative for expression of creD pET28a derivative for expression of creE pET28a derivative for expression of creF pET28a derivative for expression of creG pET28a derivative for expression of creJ

Schäfer et al. (1994) This study Qi et al. (2007) Qi et al. (2007) This study This study This study Jakoby et al. (1999) This study Qi et al. (2007) Qi et al. (2007) This study This study This study Novagen This study This study This study This study This study

CGCGCGGATCCACAAAGCGCG ACAAGAACTA CTGCGTAAAA AGC (BamHI) CGCGCGGATCCCTCTTCCAAATGAATCACAGATTGAGCTTG (BamHI) GATCTAGATCCCCTGGTTCTGGTC (XbaI) CGGAATTCGGTAGCCTGTTCGTTCC (EcoRI) GCTCTAGAAAAGGAGGACACATATGACTCGCAGTAATTTACCCGC (XbaI, NdeI) CGGAATTCGAGAAGCACGCCTGGTTG (EcoRI) GCTCTAGAAAAGGAGGACACATATGAATACTTCAGCTGAAACTGGA (XbaI, NdeI) GGAGCTCTCCCAAGCGGGTAAAT (SacI) GCCGAGCTCATGTCTACTATTCATTTCAT (SacI) ACTCTCGAGTCACACTTGCGTTTCTGGCG (XhoI) GCTCTAGAAAAGGAGGACACATATGCCTAGTCCACGCACTGTTC (XbaI, NdeI) CGGAATTCAGTAGACATGATCTTCTCCTTAG (EcoRI) ACTGGATCCATGACAATGACTTCCCAGAC (BamHI) GTCAAGCTTTTAAGCGTTCCAAGTCACGG (HindIII) CCCAAGCTTTCTGTACCCGTACTACCTCG (HindIII) TACTTCGGTGCCGTCTTTG CAAAGACGGCACCGAAGTACCAGCTCTTAACACTCCTCC AAAACTGCAGATGACAACCTTGCCCTTG (PstI) CCCAAGCTTAAAGGAGGACAACCTTGACCATGGCTAATAAATC (HindIII) ACAGAGCTCCTAGGCATGTGTATCCACCC (SacI) CCCAAGCTT ACATCCCGTTTGTCCAGC (HindIII) ACGTCGCCACCGCATCGTTC GAACGATGCGGTGGCGACGTATGCCACCAGTGGAAGCC CTAGCTAGCCATTGCGACGGTGATTGAG (NheI) CCCAAGCTTAAAGGAGGACAACCATGACCAACAGTTTGAACATC (HindIII) ACAGAGCTCTTACTTCGTGCCGGTCATTG (SacI) CCCAAGCTTTTCCCAACAATCCACCTC (HindIII) TCTGGTTCGAGTGCTTTATAG CTATAAAGCACTCGAACCAGAGGCAGTGGATGAGGTCTTG AACTGCAGGGAACCCGATAGCTTTGTC (PstI) CCCAAGCTTAAAGGAGGACAACCATGACAATGACTTCCCAGAC (HindIII) ACAGAGCTCTTAAGCGTTCCAAGTCACG (SacI)

To generate pK18mobsacB-creAB

Novagen (catalogue no. 69387-3)

To generate pK18mobsacB-creD To generate pXMJ19-creD and pET28a-creD To generate pET28a-creE To generate pET28a-creF To generate pET28a-creG To generate pET28a-creJ To generate pK18mobsacB-creH

To generate pXMJ19-creH To generate pK18mobsacB-creI

To generate pXMJ19-creI To generate pK18mobsacB-creJ

To generate pXMJ19-creJ

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017

G Model BIOTEC-6571; No. of Pages 11 4

ARTICLE IN PRESS T. Li et al. / Journal of Biotechnology xxx (2014) xxx–xxx

PCR-amplified genes were individually inserted into pET28a to generate pET28a-creD, pET28a-creE, pET28a-creF, pET28a-creG, and pET28a-creJ. 2.5. Genetic disruption and complementation of C. glutamicum The pK18mobsacB derivatives were transformed into C. glutamicum RES167 by use of electroporation. Screening for the first and second recombination events, as well as confirmation of the chromosomal deletion, was performed as described previously (Schäfer et al., 1994). The resulting clones/strains were designated as C. glutamicum RES167creD, RES167creH, RES167creI, and RES167creJ (Table 1). The deletions of the target genes in pK18mobsacB derivatives and in C. glutamicum mutants were verified by PCR amplification and DNA sequencing. Complementary plasmids pXMJ19-creD, pXMJ19-creH, pXMJ19-creI and pXMJ19-creJ were introduced into the respective mutants by electroporation. The gene expression in C. glutamicum was induced by addition of 0.1 mM isopropyl-␤-d-thiogalactopyranoside (IPTG) to culture broth. 2.6. Conversion of aromatic compounds with C. glutamicum cells and determination of products by high-performance liquid chromatography (HPLC) and mass spectroscopy (MS) For conversion assay of aromatic compounds, C. glutamicum strains were grown in mineral salts medium with 10 mM glucose until the OD600 reached 1.4–1.6. Cells were harvested by centrifugation at 3,500 rpm for 20 min, resuspended in same volume of mineral salts medium but with 2 mM aromatic compounds, and then incubated in a rotary shaker (150 rpm) at 30 ◦ C. Cultures were harvested at 2-h interval and centrifuged at 13,000 rpm for 10 min. The supernatant was used for product determination by HPLC as previously described (Peters et al., 2007). Briefly, 20 ␮l supernatant was loaded to a HPLC 1200 system equipped with a photodiode array detector and a ZORBAX SB-C18 column (Agilent, USA) and eluted using a solvent phase with a linear gradient from 10% methanol in 40 mM methanoic acid to 60% methanol in 40 mM methanoic acid within 20 min at a flow rate of 1 ml/min. Detection wavelength was set at 275 nm. The retention time of standard sample of 4-cresol, 4-hydroxybenzyl alcohol, 4-hydroxybenzaldehyde, 4-hydroxybenzoate and protocatechuate was 16.1 min, 5.9 min, 10.6 min, 8.9 min, and 6.2 min, respectively, under the above specified conditions. All cell conversion assays were performed in 2 or 3 parallel tests. The identities of metabolic intermediates were determined by MS determination. Elutions at 6.2 and 8.9 min were collected, lyophilized, and subjected to MS examination. Spectra of electrospray ionization MS (ESI-MS) were recorded in the negative ionization mode on a LCQ Deca XPplus ion-trap mass spectrometer (Thermo-Finnigan, San Jose, CA, USA). Samples in 50% methanol were infused directly into the source at 5 ␮l/min using a syringe pump. The transfer capillary temperature and spray voltage were set at 275 ◦ C and 5.5 kV, respectively. The sheath gas flow rate was set to 12 arbitrary units and the tube lens offset was set to 25 V. For MS/MS analysis, selected precursor ions were isolated with a width of 3 m/z and the collision energy was optimized to obtain stable and entire product ion spectra. 2.7. Heterologous expression in E. coli cells and protein purification For heterologous expression in E. coli cells, creD, creE, creF, creG, and creJ were amplified by PCR and were inserted into vector pET28a with hexahistidine cascade at N-terminal. The resulting plasmids pET28a-creD, pET28a-creE, pET28a-creF, pET28a-creG,

and pET28a-creJ were transformed into E. coli BL21(DE3) by electroporation. Synthesis of recombinant protein in E. coli BL21(DE3) cells was initiated by addition of 0.2 mM IPTG when the culture reached OD600 of 0.4–0.6 and continued cultivation for additional 3 h at 30 ◦ C for CreD and CreG, and 12 h at 16 ◦ C for CreE, CreF, and CreJ, respectively. Cells were harvested by centrifugation at 4 ◦ C, sonicated, and then centrifuged to remove cell debris. The supernatant was used for recombinant protein purification with the His-Bind protein purification kit (Novagen, Madison, WI) according to the manufacturer’s instructions. 2.8. SDS-PAGE SDS-PAGE was run with 5% stacking gel and 12% separating gel using a Mini-PROTEIN II Electrophoresis Cell (Bio-Rad) according to the manufacturer’s instructions. After electrophoresis, the protein bands were visualized by Coomassie brilliant blue staining. Molecular weight of proteins was estimated according to the relative mobility of protein markers with molecular masses ranging from 14 to 94 kDa. 2.9. Phosphohydrolase activity assay toward 4-nitrophenyl phosphate (4-NPP) Purified CreD was assayed for phosphatase activity using general phosphatase substrate 4-NPP as previously described (Proudfoot et al., 2004). In brief, the assay system (0.2 ml) contained 5 mM MgCl2 , 0.5 mM MnCl2 , 0.5 mM NiCl2 , 40 mM 4-NPP, and 0.1–1.0 mg of purified CreD in 50 mM HEPES-K buffer, pH 7.5 and was incubated for 1–3 h at 37 ◦ C. The max at 410 nm was read for 4-nitrophenol product. Positive control with 1 mg of calf intestinal phosphatase (CIP) and negative control without enzyme were run in parallel. 2.10. Assay of dehydrogenase activity of CreG by HPLC The assay was performed according to a modified method described by Peters et al. (2007). In brief, the assay system comprising of 4-hydroxybenzyl alcohol, purified CreG, and NAD+ /NADP+ /PMS as electron acceptor in 50 mM Tris–HCl buffer (pH 7.8) was incubated at 30 ◦ C. Aliquots of 100 ␮l were taken at 1, 30, and 60 min. 20 ␮l of 20% formic acid was added to stop reaction. Proteins were pelleted by centrifugation at 13,000 rpm for 10 min at 4 ◦ C. After filtration with 0.2-␮m filter, 20 ␮l supernatant was loaded to HPLC 1200 system (Agilent, USA) for product analysis as described above. 3. Results 3.1. 4-Hydroxybenzoate and protocatechuate are intermediate metabolites of 4-cresol catabolism in C. glutamicum In our previous studies, protocatechuate 3,4-dioxygenase (encoded by pcaHG) activity was induced in C. glutamiucm when 4-cresol was used as sole carbon source for growth (Shen et al., 2005a). The mutant, C. glutamicum RES167pcaHG, lost the ability to grow on 4-cresol (Shen and Liu, 2005). Those results suggested that 4-cresol catabolism relied on the protocatechuate pathway in C. glutamicum. The protocatechuate pathway had been characterized in our previous work (Shen et al., 2005a), however, that how 4-cresol was converted into protocatechuate had not been known. To investigate the 4-cresol catabolism in C. glutamicum, intermediate metabolites from 4-cresol catabolism were identified with RES167 and mutant RES167pcaHG. In RES167, accumulation of metabolites was not observed and 4-cresol was consumed after 8 h incubation (Fig. 2B). In contrast, two metabolites were accumulated with mutant RES167pcaHG (Fig. 2D). The

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017

G Model BIOTEC-6571; No. of Pages 11

ARTICLE IN PRESS T. Li et al. / Journal of Biotechnology xxx (2014) xxx–xxx

5

Fig. 2. Identification of intermediate metabolites of 4-cresol catabolism in C. glutaimicum by HPLC (A–D) and MS (E–H). Metabolism of 4-cresol (compound 1) to protocatechuate (2) and 4-hydroxybenzoate (3) in pcaHG double mutant. Samples were taken at 0 h (A and C) and 8 h (B and D) in RES167 (A and B) and pcaHG double mutant (C and D) culture, respectively. MS and MS/MS spectrum of HPLC elution 2 (E and F) and elution 3 (G and H) were shown, respectively.

two metabolites showed retention times of 6.2 and 8.9 min in HPLC, which matched that of protocatechuate and 4-hydroxybenzoate, respectively (Fig. 2D). These metabolites were further subjected to MS identification. The MS spectrum of the metabolite at 6.2 min showed two peaks of m/z 153.2 and m/z 188.9 (Fig. 2E). The precursor peak (m/z 188.9) was subjected to further MS/MS analysis and a unique fragment (m/z 153.0) was produced (Fig. 2F), representing the deprotonated protocatechuate molecule. The MS spectrum of the metabolite at 8.9 min showed two obvious peaks of m/z 137.1 and m/z 173.0 (Fig. 2G) and the MS/MS analysis demonstrated that the precursor peak (m/z 173.0) produced the fragment of m/z

137.0 (Fig. 2H), representing the deprotonated 4-hydroxybenzoate molecule. These results clearly demonstrated that 4-cresol was metabolized via the metabolic intermediates of 4-hydroxybenzoate and protocatechuate in C. glutamicum. 3.2. Genome data-mining of C. glutamicum for 4-cresol catabolism Previous proteomic research revealed that four proteins, namely NCgl0524, NCgl0525, NCgl0527, and NCgl0530 were specifically synthesized when C. glutamicum grew on 4-cresol (Qi et al.,

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017

Gene product annotation

Sequence identity (%)

Homologous proteins (organism; accession no.)

creA

ncgl0521

558196–558519/107/11.8

NAD-dependent aldehyde dehydrogenase

59/79 (74%)

59/90 (65%) 54/84 (64%) 24/69 (34%)

Methylmalonate-semialdehyde dehydrogenase [acylating] (Micrococcus luteus NCTC 2665; YP 002956257) Malonate-semialdehyde dehydrogenase [acetylating] (Renibacterium salmoninarum ATCC 33209; YP 001624950) Methylmalonate-semialdehyde dehydrogenase [acylating] (Arthrobacter sp. FB24; YP 830817) Methylmalonate-semialdehyde dehydrogenase (Streptomyces sp. AA4; ZP 05481759) Hypothetical protein Aave 2764 (Acidovorax avenae subsp. citrulli AAC00-1; YP 971106)

24/73 (32%) 23/71 (32%) 22/76 (28%) 407/495 (82%)

Acriflavin resistance protein (Xylella fastidiosa M23; YP 001830174) Putative membrane protein (Clostridium perfringens E str. JGS1987; ZP 02633549) Hypothetical protein NECHADRAFT 87866 (Nectria haematococca mpVI 77-13-4; EEU41794) Putative aldehyde dehydrogenase (Corynebacterium efficiens YS-314; NP 737165)

354/498 (71%) 221/486 (45%) 216/477 (45%) 178/227 (78%) 155/230 (67%) 80/187 (42%) 83/212 (39%) 342/422 (81%) 287/420 (68%) 183/405 (45%) 173/391 (44%) 93/106 (87%) 74/106 (69%) 60/106 (56%) 55/106 (51%) 208/246 (84%)

Aldehyde dehydrogenase (Arthrobacter sp. FB24; YP 831482) Aldehyde dehydrogenase (Rhodococcus jostii RHA1; YP 702610) Aldehyde dehydrogenase (Rhodococcus opacus B4; YP 002781758) HD superfamily hydrolase (Corynebacterium efficiens YS-314; ZP 05749658) Metal dependent phosphohydrolase (Arthrobacter sp. FB24; YP 831481) Hypothetical protein MED193 12343 (Roseobacter sp. MED193; ZP 01058386) Hypothetical protein BBta 1603 (Bradyrhizobium sp. BTAi1; YP 001237723) Putative rubredoxin reductase (Corynebacterium efficiens YS-314; NP 737167) FAD-dependent pyridine nucleotide-disulphide oxidoreductase (Arthrobacter sp. FB24; YP 831480) Putative ferredoxin reductase (Nocardia farcinica IFM 10152; YP 119597) Putative ferredoxin reductase (Mycobacterium chubuense; ACZ56358) Ferredoxin, 2Fe–2S (Corynebacterium efficiens YS-314; ZP 05749656) Ferredoxin (Arthrobacter sp. FB24; YP 831479) Ferredoxin (Methylobacterium populi BJ001; YP 001927611) Putative ferredoxin (Nocardia farcinica IFM 10152; YP 119598) 3-Oxoacyl-[acyl-carrier-protein] reductase (Corynebacterium efficiens YS-314; ZP 05749655)

183/244 (75%) 150/245 (61%) 146/251 (58%) 557/627 (88%)

Short-chain dehydrogenase/reductase SDR (Arthrobacter sp. FB24; YP 831478) Probable short-chain dehydrogenase, secreted (Loktanella vestfoldensis SKA53; ZP 01004492) Putative 3-oxoacyl-[acyl-carrier protein] reductase (Bradyrhizobium sp. BTAi1; YP 001237720) Phenylphosphate synthase alpha subunit (Corynebacterium efficiens YS-314; ZP 05749654)

482/623 (77%) 375/604 (62%) 371/600 (61%) 307/365 (84%)

PEP-utilizing enzyme, mobile region (Arthrobacter sp. FB24; ABK03377) Phosphoenolpyruvate synthase (Bradyrhizobium sp. BTAi1; ABQ33818) Hypothetical protein SKA53 03729 (Loktanella vestfoldensis SKA53; ZP 01004488) Phenylphosphate synthase beta subunit (Corynebacterium efficiens YS-314; ZP 05749653)

255/351 (72%) 174/326 (53%) 160/310 (51%) 355/434 (81%) 325/424 (76%) 206/396 (52%) 203/393 (51%) 200/265 (75%)

Pyruvate, water dikinase (Arthrobacter sp. FB24; YP 831476) Hypothetical protein MED193 12333 (Roseobacter sp. MED193; ZP 01058384) Hypothetical protein SKA53 03724 (Loktanella vestfoldensis SKA53; ZP 01004487) Unspecific monooxygenase (Corynebacterium efficiens YS-314; ZP 05749652) Cytochrome P450 (Arthrobacter sp. FB24; YP 831475) Cytochrome P450 (Loktanella vestfoldensis SKA53; ZP 01004486) Putative cytochrome P450 (Roseobacter sp. MED193; ZP 01058383) Regulatory protein (Corynebacterium efficiens YS-314; ZP 05749651)

189/254 (74%) 156/259 (60%) 110/246 (44%)

Putative transcription regulator (Corynebacterium efficiens YS-314; NP 737173) IclR family transcriptional regulator (Arthrobacter sp. FB24; YP 831474) Transcriptional regulator, IclR family (Streptosporangium roseum DSM 43021; YP 003339224)

58/79 (73%)

creB

creC

ncgl0522

ncgl0523

558606–558971/121/12.9

559143–560636/497/52.3

Hypothetical membrane protein

Putative betaine aldehyde dehydrogenase/NADdependent aldehyde dehydrogenases

creD

ncgl0524

560633–561370/245/27.4

HD superfamily hydrolase

creE

ncgl0525

561367–562635/422/45.4

Ferredoxin reductase

creF

ncgl0526

562645–562965/106/11.4

Ferredoxin

creG

ncgl0527

562992–563738/248/25.7

Probable short-chain dehydrogenase, secreted

creH

creI

ncgl0528

ncgl0529

563731–565638/635/71.7

565679–566773/364/36.9

Putative PEP-utilizing enzyme

Pyruvate phosphate dikinase, PEP/pyruvate binding

creJ

ncgl0530

566798–568090/430/48.3

Cytochrome P450

creR

ncgl0531

568271–569077/268/29.0

Bacterial regulatory proteins, IclR family

ARTICLE IN PRESS

Position/product length/MW (kDa)

G Model

Gene ID

T. Li et al. / Journal of Biotechnology xxx (2014) xxx–xxx

Gene

BIOTEC-6571; No. of Pages 11

6

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017

Table 2 Gene annotation and BLAST searching results.

G Model BIOTEC-6571; No. of Pages 11

ARTICLE IN PRESS T. Li et al. / Journal of Biotechnology xxx (2014) xxx–xxx

7

Fig. 3. Physical map of the cre gene cluster in C. glutamicum (A) and their homologues in different bacteria (B). In panel B, two vertical lines indicate that the genes are not adjacent in the genome. Numbers underneath the arrows indicate the percentages of amino acid sequence identity of the encoding product with their equivalent product in C. glutamicum. The accession numbers of the sequences in NCBI database are as follows: Corynebacterium efficiens YS-314 (NC 004369); Arthrobacter sp. FB24 (NC 008541); Pseudomonas putida F1 (NC 009512); Pseudomonas putida GB-1 (NC 010322); Pseudomonas putida KT2440 (NC 002947); Geobacter metallireducens GS-15 (NC 007517).

2007). The genes encoding NCgl0524, NCgl0525, NCgl0527 and NCgl0530 were located at a genetic cluster consisting of 11 genes (ncgl0521–ncgl0531, position at 558196–569077 bp, named creABCDEFGHIR). The gene annotations, encoding products, and their homologs are listed in Table 2. Based on the previous proteomic data and the results from genome data mining, we deduced that genetic cluster creABCDEFGHIR was possibly involving in 4-cresol catabolism by C. glutamicum (Fig. 3A). 3.3. Characterization of individual cre genes involving in the conversion of 4-cresol into 4-hydroxybenzoate C. glutamicum RES167 grows on 4-cresol, 4-hydroxybenzyl alcohol, 4-hydroxybenzaldehyde, 4-hydroxybenzoate or protocatechuate as sole carbon source. Six of the 11 cre genes (creD, creE, creG, creH, creI, and creJ) were successfully knocked out from RES167, and were genetically complemented in the resulting mutants. Their phenotypes of growth on different substrates are listed in Table 3. Results clearly demonstrated that these cre genes were essential to 4-cresol assimilation in C. glutamicum. The

creA and creB were also knocked out, and obtained mutant grew on 4-cresol as RES167 did. Thus, the creAB was not involved in 4-cresol degradation. The creD was involved in conversion of 4-cresol into 4hydroxybenzyl alcohol, and showed Mg2+ -dependent phosphohydrolase activity. Disruption of creD resulted in mutant RES167creD. This mutant lost the ability to grow on 4-cresol or 4-hydroxybenzyl alcohol, but the ability to grow on 4-hydroxybenzaldehyde, 4hydroxybenzoate or protocatechuate was not disturbed (Table 3). Complementation with pXMJ19-creD totally restored the phenotype of growth on 4-cresol or 4-hydroxybenzyl alcohol. These results indicated its involvement in conversion of 4-cresol into 4-hydroxybenzyl alcohol. Bioinformatics analysis showed creD encoded a putative hydrolase with Mg2+ -binding site (putatively Asp104 ) and HD motif (residues 72–185). This putative hydrolase had 78% and 67% amino acid identity with the HD superfamily hydrolases of Corynebacterium efficiens and the metal-dependent phosphohydrolase of Arthrobacter sp. FB24, respectively (Table 2). The creD was cloned and expressed in E. coli. Results showed that CreD had highest phosphohydrolase activity against 4-nitrophenyl

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017

G Model

ARTICLE IN PRESS

BIOTEC-6571; No. of Pages 11

T. Li et al. / Journal of Biotechnology xxx (2014) xxx–xxx

8

Table 3 Growth of C. glutamicum RES167 and mutants on various aromatic compounds as sole carbon source (each at 2 mM as final concentrations). Strain

4-Cresol

4-Hydroxybenzyl alcohol

4-Hydroxybenzaldehyde

4-Hydroxybenzoate

Protocatechuate

3-Hydroxybenzoate

Benzoate

RES167 RES167creAB RES167creD RES167creE RES167creG RES167creH RES167creI RES167creJ RES167creD/pXMJ19-creD RES167creE/pXMJ19-creE RES167creG/pXMJ19-creG RES167creH/pXMJ19-creH RES167creI/pXMJ19-creI RES167creJ/pXMJ19-creJ

+ + − − − − − − + + + + + +

+ + − − − − − − + + + + + +

+ + + + − − − + + + + + + +

+ + + + + + + + + + + + + +

+ + + + + + + + + + + + + +

+ + + + + + + + + + + + + +

+ + + + + + + + + + + + + +

“+” indicates that the strain/mutant can utilize the aromatic compound as sole carbon source to grow; “−” indicates that the strain/mutant cannot utilize the aromatic compound as sole carbon source to grow.

phosphate at pH 8.5 and in the presence of Mg2+ . Interestingly, no catalytic activity (dehydrogenase, hydroxylase, and phosphohydrolase) was observed when 4-cresol, 4-hydroxybenzyl alcohol or 4-hydroxybenzaldehyde was used as substrate. The creE was also involved in conversion of 4-cresol into 4hydroxybenzyl alcohol. Similar to the phenotype of mutant RES167creD, mutant RES167creE lost the ability to grow on 4-cresol or 4-hydroxybenzyl alcohol but not on 4hydroxybenzaldehyde, 4-hydroxybenzoate or protocatechuate. The complementation of RES167creE by pXMJ19-creE completely restored the phenotype to grow on 4-cresol and 4-hydroxybenzyl alcohol (Table 3). The gene creE was annotated as a ferredoxin reductase, which showed 81%, 68% and 45% amino acid sequence identities to the putative rubredoxin reductase from C. efficiens, the FAD-dependent pyridine nucleotide-disulfied oxidoreductase of Arthrobacter sp. FB24, and the putative ferredoxin reductase of Nocardia farcinica, respectively (Table 2). Conserved motif(s) searches indicated that two pyridine nucleotide-disulphide oxidoreductase domains (residues 9–141 and 153–233) exist in CreE. The plasmid pET28a-creE was transformed into E. coli and the recombinant E. coli strain expressed a 49-kDa protein (Fig. 4). This protein was purified and was proved to be the translational product of creE. Unfortunately, we were not able to detect any catalytic activity of CreE with 4-cresol as substrate. The creF encoded a [2Fe–2S] type ferredoxin. The gene creF was annotated as a ferredoxin, with 87%, 69% and 56% amino acid sequence identities to the ferredoxins from C. efficiens, Arthrobacter

sp. FB24, and Methylobacterium populi, respectively (Table 2). Conserved domain search indicated that a 2Fe–2S iron–sulfur cluster binding domain (residues 9–92) exists in CreF. Although knockout vector pK18mobsacB-creF was constructed correctly, attempt to obtain a creF mutant failed. Expression vector pET28a-creF was constructed and transformed into E. coli. The His6 -CreF protein was expressed in the recombinant E. coli strain with a molecular mass of about 15 kDa (Fig. 4). The purified His6 -CreF protein was deep yellow. The creG encoded an NAD+ -dependent dehydrogenase and catalyzed 4-hydroxybenzyl alcohol to 4-hydroxybenzaldehyde. The mutant RES167creG lost the ability to grow on 4-cresol, 4hydroxybenzyl alcohol or 4-hydroxybenzaldehyde, while the ability to grow on 4-hydroxybenzoate or protocatechuate was not disrupted. Complementation with pXMJ19-creG completely restored the ability of the mutant RES167creG to grow on 4-cresol, 4-hydroxybenzyl alcohol or 4-hydroxybenzaldehyde (Table 3). The creG was annotated as a probable short-chain dehydrogenase with a conserved short-chain dehydrogenase domain (residues 6–173). The creG was heterologously expressed in E. coli and was purified (Fig. 4). This purified CreG catalyzed the oxidation of 4-hydroxybenzyl alcohol into 4-hydroxybenzaldehyde in the presence of NAD+ as electron acceptor (Fig. 5), which was supportive to observed phenotype of mutant RES167creG. In addition, it was found that recombinant E. coli pET28a-creG cells converted 4-hydroxybenzyl alcohol to 4-hydroxybenzaldehyde. Taken together, it was concluded that creG encoded an

Fig. 4. Gene expression and protein purification of cre genes in recombinant E. coli strains. In each panel, the lanes from left to right represent cell lysate without IPTG induction, cell lysate with IPTG induction, and purified protein, respectively. The theoretical MWs of purified proteins are as following: 31 kDa (CreD), 49 kDa (CreE), 15 kDa (CreF), 29 kDa (CreG), and 52 kDa (CreJ).

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017

G Model BIOTEC-6571; No. of Pages 11

ARTICLE IN PRESS T. Li et al. / Journal of Biotechnology xxx (2014) xxx–xxx

9

Fig. 5. 4-Hydroxybenzyl alcohol dehydrogenase activity of CreG assayed by HPLC. Time-dependent oxidation of 4-hydroxybenzyl alcohol (compound 1) to 4hydroxybenzaldehyde (compound 2) by purified CreG in presence of NAD+ as an electron acceptor. Samples were taken without purified CreG (A), and at 1 min (B), 30 min (C), and 60 min (D) after addition of purified CreG, respectively.

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017

G Model BIOTEC-6571; No. of Pages 11 10

ARTICLE IN PRESS T. Li et al. / Journal of Biotechnology xxx (2014) xxx–xxx

Fig. 6. Proposed initial reactions of 4-cresol catabolism in C. glutamicum. The putative steps and enzymes without experimental confirmation are shown in gray whereas the steps and enzymes confirmed by enzyme activity are shown in black. “?” represents unknown intermediate metabolite(s) from 4-hydroxybenzyle alcohol to 4hydroxybenzaldehyde.

NAD+ -dependent 4-hydroxybenzyl alcohol dehydrogenase that catalyzed 4-hydroxybenzyl alcohol to 4-hydroxybenzaldehyde in C. glutamicum. The creH and the creI were involved in conversion of 4hydroxybenzyl alcohol to 4-hydroxybenzoate. Besides the genes discussed above, creH and creI were also identified to be involved in the metabolism of 4-cresol. The creH encodes a putative PEPutilizing enzyme with 77% and 62% amino acid identity to the PEP-utilizing enzyme of Arthrobacter sp. FB24 and the phosphoenolpyruvate synthase of Bradyrhizobium sp. BTAi1, respectively. The creI encodes a pyruvate phosphate dikinase with 72% amino acid identity with the pyruvate water dikinase of Arthrobacter sp. FB24 (Table 2). Conserved domain search revealed that a PEPutilising enzyme mobile domain (residues 527–602) existed in CreH while a PEP/pyruvate binding domain (residues 22–341) existed in CreI. Both mutants RES167creH and RES167creI were not able to grow on 4-cresol, 4-hydroxybenzyl alcohol or 4-hydroxybenzaldehyde, whereas their ability to grow on 4hydroxybenzoate or protocatechuate was not disturbed (Table 3). Genetic complementation with pXMJ19-creH or pXMJ19-creI completely restored their growth phenotypes. These results indicate that both creH and creI were involved in conversion of 4hydroxybenzyl alcohol to 4-hydroxybenzoate in C. glutamicum. The creJ encoded a cytochrome P450 and was involved in the initial oxidation of 4-cresol. Deletion of creJ interrupted the ability to grow on 4-cresol or 4-hydroxybenzyl alcohol in C. glutamicum, whereas the ability to grow on 4-hydroxybenzaldehyde, 4-hydroxybenzoate or protocatechuate was not disturbed. Complementation of pXMJ19-creJ completely restored the phenotype to grow on 4-cresol or 4-hydroxybenzyl alcohol (Table 3), indicating its involvement in conversion of 4-cresol into 4-hydroxybenzyl alcohol. The creJ was annotated as a cytochrome P450, which shows highest amino acid identity (81%) to a monooxygenase in C. efficiens. CreJ showed also identities of 76%, 52% and 51% to the cytochrome P450s of Arthrobacter sp. FB24, Loktanella vestfoldensis and Roseobacter sp. MED193, respectively (Table 2). Conserved domain search indicated that a cytochrome P450 domain (residues 218–394) existed in CreJ. The creJ was cloned and expressed in E. coli (Fig. 4). The purified His6 -CreJ protein showed a color of light yellow. Unfortunately, we were not able to detect any catalytic activity of CreJ with 4-cresol as substrate.

4. Discussion C. glutamicum grows on a range of aromatic compounds such as phenylacetate, benzoate, phenol, vanillin, resorcinol, 3hydroxybenzoate, protocatechuate, and gentisate (Shen et al., 2005a; Chen et al., 2012). Our previous studies had revealed the biochemistry and genetics of their metabolic pathway as well as how these pathways are regulated (Chen et al., 2012; Huang et al., 2006; Li et al., 2012; Shen and Liu, 2005; Shen et al., 2005a, 2005b, 2012; Zhao et al., 2010). In this study, we continued to explore the ability and the mechanism of aromatic degradation by C. glutamicum. Based on the results from this study, a tentative pathway of initial reactions of 4-cresol catabolism was proposed, and genes involving in 4-cresol catabolism were identified (Fig. 6). Cytochrome P450s (P450s) usually act as monooxygenases to transfer molecular oxygen to C H bonds of a substrate with the concomitant reduction of the other oxygen atom to water (Hannemann et al., 2007). In the cre cluster, creJ, creE and creF encode a cytochrome P450, a ferredoxin reductase, and a [2Fe–2S] type ferredoxin, respectively, which complete a class I P450 system (Hannemann et al., 2007). It was deduced that this class I P450 system catalyzed the first step of 4-cresol catabolism, i.e. 4-cresol to 4-hydroxybenzyl alcohol. This deduction is consistent with the phenotypes that creE and creJ mutants lost the ability of utilization of 4-cresol and 4-hydroxybenzyl alcohol. A CreD was also involved in conversion of 4-cresol to 4-hydroxybenzyl alcohol, since the disruption of creD disturbed the utilization of 4-cresol. It was mysterious that how the phosphohydrolase activity of CreD be linked to 4-cresol degradation. 4-Hydroxybenzyl alcohol is subsequently oxidized to 4-hydroxybenzaldehyde by CreG, an NAD+ dependent dehydrogenase. An unknown pathway converting 4-hydroxybenzyl alcohol to 4-hydroxybenzoate might exist in C. glutamicum, as we demonstrated that creH and creI were involved in conversion of 4-hydroxybenzyl alcohol to 4-hydroxybenzaldehyde. The creH encodes a putative PEP-utilizing enzyme while the creI encodes a putative pyruvate phosphate dikinase with a PEP/pyruvate binding domain, suggesting that 4-hydroxybenzyl alcohol may be converted to 4-hydroxybenzoate via additional intermediate metabolite(s) with addition of PEP, possibly similar to the degradation of 4-cresol in D. cetonicum by use of fumarate (Muller et al., 2001). 4-Hydroxybenzoate is further hydroxylated to

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017

G Model BIOTEC-6571; No. of Pages 11

ARTICLE IN PRESS T. Li et al. / Journal of Biotechnology xxx (2014) xxx–xxx

protocatechuate by PobA, a 4-hydroxybenzoate hydroxylase that had been identified in our previous study (Huang et al., 2008). In Pseudomonas species and G. metallireducens GS-15, cre genes are scattered and their translational products have low sequence similarities to that of C. glutamicum (from 24% to 45%). The cre cluster of C. glutamicum comprises of 11 continuous genes, including 10 structural genes and one regulatory gene. Genome data-mining revealed similar genetic clusters in Gram-positive bacteria but not in any Gram-negative bacteria (Fig. 3B). C. efficiens YS-314 and Arthrobacter sp. FB24 possess identical cre genetic organizations to that of C. glutamicum (except for the absence of homologs to creA and creB in strains YS-314 and FB24), and their gene products showed high sequence identities (from 60% to 88%). This result suggests a wider distribution of the newly defined cre genetic cluster in Gram-positive bacteria. Besides the conclusions from this study, more questions are still remained to be solved, examples are that the biochemistry of the class I P450 system encoded by creJ, creE and creF are still not clear and whether or not that creA and creB are related to 4-cresol catabolism in C. glutamicum. Acknowledgement This work was supported by grant (31200088) from the National Natural Science Foundation of China. References Amador, E., Castro, J.M., Correia, A., Martin, J.F., 1999. Structure and organization of the rrnD operon of ‘Brevibacterium lactofermentum’: analysis of the 16S rRNA gene. Microbiology 145, 915–924. Bossert, I.D., Young, L.Y., 1986. Anaerobic oxidation of p-cresol by a denitrifying bacterium. Appl. Environ. Microbiol. 52, 1117–1122. Chen, X., Kohl, T.A., Rückert, C., Rodionov, D.A., Li, L.-H., Ding, J.-Y., Kalinowski, J., Liu, S.-J., 2012. Phenylacetic acid catabolism and its transcriptional regulation in Corynebacterium glutamicum. Appl. Environ. Microbiol. 78, 5796–5804. Cho, A.R., Lim, E., Veeranagouda, Y., Lee, K., 2011. Identification of a p-cresol degradation pathway by a GFP-based transposon in Pseudomonas and its dominant expression in colonies. J. Microbiol. Biotechnol. 21, 1179. Dagley, S., Patel, M., 1957. Oxidation of p-cresol and related compounds by a Pseudomonas. Biochem. J. 66, 227. Finn, R.D., Mistry, J., Tate, J., Coggill, P., Heger, A., Pollington, J.E., Gavin, O.L., Gunasekaran, P., Ceric, G., Forslund, K., Holm, L., Sonnhammer, E.L.L., Eddy, S.R., Bateman, A., 2010. The Pfam protein families database. Nucleic Acids Res. 38, D211–D222. Gibson, J., Dispensa, M., Fogg, G.C., Evans, D.T., Harwood, C.S., 1994. 4Hydroxybenzoate-coenzyme A ligase from Rhodopseudomonas palustris: purification, gene sequence, and role in anaerobic degradation. J. Bacteriol. 176, 634–641. Hannemann, F., Bichet, A., Ewen, K.M., Bernhardt, R., 2007. Cytochrome P450 systems—biological variations of electron transport chains. Biochim. Biophys. Acta (BBA) – General Subjects 1770, 330–344. Harwood, C.S., Parales, R.E., 1996. The ␤-ketoadipate pathway and the biology of self-identity. Annu. Rev. Microbiol. 50, 553–590. Hopper, D.J., Taylor, D.G., 1975. Pathways for the degradation of m-cresol and pcresol by Pseudomonas putida. J. Bacteriol. 122, 1–6. Hopper, D.J., 1976. The hydroxylation of p-cresol and its conversion to phydroxybenzaldehyde in Pseudomonas putida. Biochem. Biophys. Res. Commun. 69, 462–468. Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.K., Pease, L.R., 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61–68. Huang, Y., Zhao, K.-X., Shen, X.-H., Chaudhry, M.T., Jiang, C.-Y., Liu, S.-J., 2006. Genetic characterization of the resorcinol catabolic pathway in Corynebacterium glutamicum. Appl. Environ. Microbiol. 72, 7238–7245.

11

Huang, Y., Zhao, K.-X., Shen, X.-H., Jiang, C.-Y., Liu, S.-J., 2008. Genetic and biochemical characterization of a 4-hydroxybenzoate hydroxylase from Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 78, 75–83. Jakoby, M., Ngouoto-Nkili, C.-E., Burkovski, A., 1999. Construction and application of new Corynebacterium glutamicum vectors. Biotechnol. Tech. 13, 437–441. Jones, K.H., Trudgill, P.W., Hopper, D.J., 1993. Metabolism of p-cresol by the fungus Aspergillus fumigatus. Appl. Environ. Microbiol. 59, 1125–1130. Keat, M.J., Hopper, D.J., 1978. p-Cresol and 3,5-xylenol methylhydroxylase in Pseudomonas putida N. C. I. B. 9896. Biochem. J. 175, 649–658. Konopka, A., 1993. Isolation and characterization of a subsurface bacterium that degrades aniline and methylanilines. FEMS Microbiol. Lett. 111, 93–99. Li, T., Zhao, K., Huang, Y., Li, D., Jiang, C.-Y., Zhou, N., Fan, Z., Liu, S.-J., 2012. The TetR-type transcriptional repressor RolR from Corynebacterium glutamicum regulates resorcinol catabolism by binding to a unique operator, rolO. Appl. Environ. Microbiol. 78, 6009–6016. Londry, K.L., Suflita, J.M., Tanner, R.S., 1999. Cresol metabolism by the sulfatereducing bacterium Desulfotomaculum sp. strain Groll. Can. J. Microbiol. 45, 458–463. Muller, J.A., Galushko, A.S., Kappler, A., Schink, B., 2001. Initiation of anaerobic degradation of p-cresol by formation of 4-hydroxybenzylsuccinate in Desulfobacterium cetonicum. J. Bacteriol. 183, 752–757. Peters, F., Heintz, D., Johannes, J., van Dorsselaer, A., Boll, M., 2007. Genes, enzymes, and regulation of para-cresol metabolism in Geobacter metallireducens. J. Bacteriol. 189, 4729–4738. Proudfoot, M., Kuznetsova, E., Brown, G., Rao, N.N., Kitagawa, M., Mori, H., Savchenko, A., Yakunin, A.F., 2004. General enzymatic screens identify three new nucleotidases in Escherichia coli: biochemical characterization of SurE, YfbR, AND YjjG. J. Biol. Chem. 279, 54687–54694. Qi, S.-W., Chaudhry, M.T., Zhang, Y., Meng, B., Huang, Y., Zhao, K.X., Poetsch, A., Jiang, C.-Y., Liu, S., Liu, S.-J., 2007. Comparative proteomes of Corynebacterium glutamicum grown on aromatic compounds revealed novel proteins involved in aromatic degradation and a clear link between aromatic catabolism and gluconeogenesis via fructose-1,6-bisphosphatase. Proteomics 7, 3775–3787. Rudolphi, A., Tschech, A., Fuchs, G., 1991. Anaerobic degradation of cresols by denitrifying bacteria. Arch. Microbiol. 155, 238–248. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G., Pühler, A., 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 69–73. Shen, X.-H., Liu, S.-J., 2005. Key enzymes of the protocatechuate branch of the ␤ketoadipate pathway for aromatic degradation in Corynebacterium glutamicum. Sci. China, Ser. C-Life Sci. 48, 241–249. Shen, X.-H., Huang, Y., Liu, S.-J., 2005a. Genomic analysis and identification of catabolic pathways for aromatic compounds in Corynebacterium glutamicum. Microbes Environ. 20, 160–167. Shen, X.-H., Jiang, C.-Y., Huang, Y., Liu, Z.-P., Liu, S.-J., 2005b. Functional identification of novel genes involved in the glutathione-independent gentisate pathway in Corynebacterium glutamicum. Appl. Environ. Microbiol. 71, 3442–3452. Shen, X.-H., Zhou, N.-Y., Liu, S.-J., 2012. Degradation and assimilation of aromatic compounds by Corynebacterium glutamicum: another potential for applications for this bacterium? Appl. Microbiol. Biotechnol. 95, 77–89. Smolenski, W.J., Suflita, J.M., 1987. Biodegradation of cresol isomers in anoxic aquifers. Appl. Environ. Microbiol. 53, 710–716. Tallur, P.N., Megadi, V.B., Kamanavalli, C., Ninnekar, H., 2006. Biodegradation of pcresol by Bacillus sp. Strain PHN 1. Curr. Microbiol. 53, 529–533. Tauch, A., Kassing, F., Kalinowski, J., Puhler, A., 1995. The Corynebacterium xerosis composite transposon Tn5432 consists of two identical insertion sequences, designated IS1249, flanking the erythromycin resistance gene ermCX. Plasmid 34, 119–131. Tauch, A., Kirchner, O., Löffler, B., Götker, S., Pühler, A., Kalinowski, J., 2002. Efficient electrotransformation of Corynebacterium diphtheriae with a mini-replicon derived from the Corynebacterium glutamicum plasmid pGA1. Curr. Microbiol. 45, 362–367. Wright, A., Olsen, R.H., 1994. Self-mobilization and organization of the genes encoding the toluene metabolic pathway of Pseudomonas mendocina KR1. Appl. Environ. Microbiol. 60, 235–242. Zhao, K.-X., Huang, Y., Chen, X., Wang, N.-X., Liu, S.-J., 2010. PcaO positively regulates pcaHG of the ␤-ketoadipate pathway in Corynebacterium glutamicum. J. Bacteriol. 192, 1565–1572.

Please cite this article in press as: Li, T., et al., Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum. J. Biotechnol. (2014), http://dx.doi.org/10.1016/j.jbiotec.2014.01.017