Genetic characterization of the dibenzofuran-degrading Actinobacteria carrying the dbfA1A2 gene homologues isolated from activated sludge

FEMS Microbiology Letters 239 (2004) 147–155 www.fems-microbiology.org

Genetic characterization of the dibenzofuran-degrading Actinobacteria carrying the dbfA1A2 gene homologues isolated from activated sludge Takashi Noumura a, Hiroshi Habe a,*, Jaka Widada a,b, Jin-Sung Chung a, Takako Yoshida a, Hideaki Nojiri a, Toshio Omori a,1 b

a Biotechnology Research Center, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan Laboratory of Soil and Environmental Microbiology, Department of Soil Science, Faculty of Agriculture, Gadjah Mada University, Bulaksumur, Yogyakarta 55281, Indonesia

Received 8 June 2004; received in revised form 15 August 2004; accepted 24 August 2004 First published online 11 September 2004 Edited by E. Baggs

Abstract Thirteen dibenzofuran (DF)-utilizing bacteria carrying the DF terminal dioxygenase genes homologous to those of Terrabacter sp. strain DBF63 (dbfA1A2) were newly isolated from activated sludge samples. The amplified ribosomal DNA restriction analysis and the hybridization analyses showed that these strains were grouped into five genetically different types of bacteria. The sequence analyses of the 16S rRNA genes and the dbfA1A2 homologues from these five selected isolates revealed that the isolates belonged to the genus Rhodococcus, Terrabacter or Janibacter and that they shared 99–100% conserved dbfA1A2 homologues. We investigated the genetic organizations flanking the dbfA1A2 homologues and showed that the minimal conserved DNA region present in all five selected isolates consisted of an
9.0-kb region and that their outer regions became abruptly non-homologous. Among them, Rhodococcus sp. strain DFA3 possessed not only the 9.0-kb region but also the 6.2-kb region containing dbfA1A2 homologues. Sequencing of their border regions suggested that some genetic rearrangement might have occurred with insertion sequence-like elements. Also, within their conserved regions, some insertions or deletions were observed.
2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords: Dibenzofuran degradation; Dibenzofuran 4,4a-dioxygenase; Terrabacter sp.; Rhodococcus sp.; Actinobacteria

1. Introduction Halogenated aromatic compounds, such as polychlorinated dibenzo-p-dioxin, dibenzofurans and biphenyls, and related compounds represent a diverse group of per* Corresponding author. Tel.: +81 3 5841 3085; fax: +81 3 5841 8030. E-mail address: [email protected] (H. Habe). 1 Present address: Department of Industrial Chemistry, Faculty of Engineering, Shibaura Institute of Technology, 3-9-14 Shibaura, Minato-ku, Tokyo 108-8548, Japan.

sistent and widespread environmental contaminants. For example, 2,3,7,8-tetrachlorodibenzo-p-dioxin, the biologically most active and toxic member of this class of compounds has a wide variety of species- and tissue-specific effect, such as tumor promotion, immuno-, hepato and dermal toxicity, lethality, birth defects, endocrine disruption and induction of numerous enzymes [1,2]. Dibenzo-p-dioxin (DD) and dibenzofuran (DF) are used as model compounds of dioxins for microbial degradation, and several bacteria capable of assimilating DD and DF have been described [3–10].

0378-1097/$22.00
2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.femsle.2004.08.032

148

T. Noumura et al. / FEMS Microbiology Letters 239 (2004) 147–155

Some of these bacteria have also been reported able to degrade chlorinated DDs and DFs [7,10–14]. Terrabacter sp. strain DBF63 is also able to utilize DF or fluorene (FN) as a sole source of carbon [6], and has a wide capacity to co-metabolize a broad range of chlorinated DDs and DFs [13,14]. Detailed genetic analysis of DF degradation in strain DBF63 has been made, and genes that encode the oxygenase components of angular dioxygenase for DF (dbfA1 and dbfA2), the extradiol dioxygenase for 2,2 0 ,3-trihydroxybiphenyl (THB) (dbfB) and the subsequent hydrolase for the meta-cleavage product of THB (dbfC), were cloned and sequenced [15,16]. All of them were expressed in DF-grown DBF63 cells [17]. Among the degradative enzymes for DF, the initial angular dioxygenase plays a very important role, because it facilitates both activation of the aromatic ring and fission of the ether linkage. DbfA represents the first described sequence of angular dioxygenases from Gram-positive bacteria [16]. The deduced amino acid sequences of the terminal oxygenase component of DF dioxygenase, DbfA1, from strain DBF63 showed <40% identity with other known large subunits of terminal oxygenases components of DF dioxygenase system, such as DF/dioxin dioxygenase, DxnA1, of Sphingomonas wittichii strain RW1 [18] and DF dioxygenase, DfdA1, of Terrabacter sp. strain YK3 [8]. In this study, to elucidate the presence and distribution of the dbfA1A2 genes within other DF-degrading bacteria and to gain insight into the structure of DF catabolic gene clusters, we newly isolated DF-utilizing strains and analyzed the genetic organization of the region flanking the dbfA1A2 genes.

2. Materials and methods 2.1. Bacterial strains, plasmids, media, and culture condition Bacterial strains and plasmids used in this study are listed in Tables 1 and 2. The 13 DF-utilizing strains used in this study were isolated from activated sludge samples taken from Tokyo, Japan, and its environs. The DF degradation ability of isolates was examined in liquid medium as described before [15]. For construction of the genomic library of strain DFA3, cosmid vector SuperCos1 (Stratagene, La Jolla, CA) was used. Escherichia coli strains JM109 and DH5a (Toyobo Co. Ltd., Tokyo, Japan) were used as host strains of plasmids pUC119, pBluescript II SK(), cosmid vector SuperCosI and their derivatives. All E. coli strains were grown on 2 · YT medium at 37 C. Ampicillin (Ap) and kanamycin at final concentrations of 50 or 100 lg ml1, respectively, were added when necessary. 2.2. Isolation of DF-utilizing bacteria DF-utilizing bacteria were isolated from activated sludge samples by the enrichment culture method [19]. Enrichment cultures were set up with 100 ml of carbonfree mineral medium (CFMM) as described previously [15] in 500-ml Erlenmeyer flasks aseptically supplemented with 0.1% (w/v) of DF as a sole source of carbon. When the growth of bacteria was observed, a subculture was performed with similarly prepared fresh medium. After three subcultures, the appropriate dilution of the resultant culture was spread onto solid CFMM plates,

Table 1 Bacterial strains and plasmids Bacterial strain and plasmid Bacterial strains E. coli JM109 E. coli DH5a E. coli HB101 Terrabacter sp. strain DBF63 Plasmids pBluescript II SKpUC119 SuperCos1 pCC12 pA3S pA3L pA3S15 pA3S4 pA3L101 pA3S501 PA3S502

Relevant characteristic

Source or reference

recA1, D(lac-proAB), endA1, gyrA96, thi-1, hsdR17, relA1, supE44, [F 0 , traD36, proAB, lacIqZDM15] þ F-, hsdR17ðr K ; mK Þ, recA1, endA1, deoR, thi-1, supE44, gyrA96, relA1 þ F-, hsdR17ðr ; m K K Þ, recA1, endA1, deoR, thi-1, supE44, gyrA96, relA1 Dibenzofuran- and fluorene-utilizing bacterium

Toyobo

Apr, Apr, Apr, Apr, Apr, Apr, Apr, Apr, Apr, Apr, Apr,

Stratagene [30] Stratagene [16] This study This study This study This study This study This study This study

lacZ, pMB9 replicon lacZ, pMB9 replicon Neor, cos SuperCos1 with BamHI insert of DBF63 DNA SuperCos1 with Sau3AI insert of DFA3 DNA SuperCos1 with Sau3AI insert of DFA3 DNA pUC119 with 2.9-kb SphI insert of pA3S pUC119 with 4.5-kb PstI insert of pA3S pBluescript SK- with 3.8-kb ClaI–PstI insert of pA3L pUC119 with 0.9-kb PCR fragment carrying flnD1DFA3 gene pUC119 with 1.0-kb PCR fragment carrying flnD1D2DFA3 gene

Toyobo Toyobo [6]

T. Noumura et al. / FEMS Microbiology Letters 239 (2004) 147–155

149

Table 2 Grouping of newly isolated dibenzofuran-degraders Straina

ARDRAb

Southern hybridizationc

HhaI

dbfA1A2 (kb)

dbfBC (kb)

DFA1 DFA2 DFA3 DFA4 DFA5 DFA6 DFA7 DFA8 DFA9 DFA10 DFA11 DFA12 DFA13

A A C C C C B C C A C C A

8.2 8.2 10.0 10.0 10.0 10.0 10.0 10.0 10.0 8.2 10.0 10.0 8.2

4.3 4.3 4.0 4.0 4.0 4.0 4.0 4.0 4.0 3.2 4.0 4.0 4.3

and and and and

4.3 4.3 4.3 4.3

and 4.3 and 4.3

Group

Most similar 16S rDNA sequenced

I I II II II II III IV IV V II II I

Terrabacter sp. YK21 (AB070468)e – Rhodococcus sp. BDC14 (AY249053)e – – – R. fascians (Y11196)e – R. erythropolis NV1 (AY147846)e Janibacter limosus SAFR-043 (AY167846)e – – –

a

All strains were isolated as DF-utilizing bacteria. The amplified ribosomal DNA restriction analysis (ARDRA) of the above listed DF-degraders was performed using restriction enzymes HhaI, HaeIII or AluI, and all results revealed the three different phylotypes of bacteria (data not shown). A, B and C represent the three different fragmentation patterns with HhaI (see Fig. 1). c The sizes of BamHI fragments (kb) hybridized with dbfA1A2 or dbfBC probes (Table 3) are shown. d Most similar 16S rDNA sequences are shown only in the representatives of each group, i.e., strains DFA1 (group I), DFA3 (II), DFA7 (III), DFA9 (IV), DFA10 (V). e Accession Numbers in the DDBJ/EMBL/GenBank databases are shown in parentheses. b

and then supplied vapored DF. The yellow colonies growing on CFMM plates, were purified using a nutrient broth agar plate (Eiken Chemical Co. Ltd., Tokyo, Japan), and were checked again for their ability to utilize DF as a sole source of carbon on liquid CFMM.

out at 68 C. After hybridization, the membranes were washed once with 2 · SSC-0.1% SDS (5 min, at room temperature) and three times with 0.1 · SSC-0.1% SDS (20 min, 68 C). The detection was carried out using an imaging plate and FLA-3000G image analyzer (Fuji Photo Film Co Ltd., Tokyo, Japan).

2.3. DNA manipulations 2.4. 16S rRNA gene analyses DNA manipulation was performed as described by Sambrook et al. [20]. Plasmid DNA was isolated from E. coli host cells with a Quantum Prep Plasmid Miniprep Kit (Bio-Rad Laboratories, Richmond, CA). Cosmid DNA was prepared from the E. coli host strain by the alkaline SDS lysis method [20]. After the electrophoresis, DNA was extracted from agarose gels using a ConcertTM Rapid Gel Extraction System (Gibco BRL Life Technologies, Madison, WI) according to the manufacturerÕs instructions. Restriction enzymes and the DNA ligation kit were purchased from Takara Shuzo Co. Ltd. (Kyoto, Japan). Southern and colony blotting were performed by using a Biodyne B nylon membrane (Pall BioSupport Co., East Hills, NY) according to the recommendations of the manufacturer. The DNA probes were generated by PCR with total DNA from strain DBF63 as a template and using the primer set listed in Table 3. A non-radioactive digoxigenin DNA labeling and detection kit (Roche Diagnostics GmbH) or Megaprime DNA labeling system (Amersham Pharmacia Biotech UK Ltd., Little Chalfont, Buckinghamshire, UK) and 32P-dCTP (110 TBq/mmol; Amersham Pharmacia Biotech UK Ltd.) were used according to the manufacturerÕs instructions. Pre-hybridization and hybridization were carried

The 16S rRNA genes of isolated strains were amplified using the forward primer 27f (5 0 -AGATable 3 Primers sequences for generate probes used in this study Probe

Name of primer

Sequence (5 0 –3 0 )

DbfA1A2

PmDBFA1A2F PmDBFA1A2R PmDBFBCF PmDBFBCR PmFLNEF PmFLNER PmFLNBF PmFLNBR PmPHTCF PmPHTCR PmPHTBF PmPHTBR PmPHTA1F PmPHTA1R PmORF14F PmORF14R PmFLND1F PmFLND1R PmFLNCF PmFLNCR

ACCCGATCATGACCAGCATT AAGAAGATGGAGA-TGGCACG CTGGAAGATCCACTACAACG GTGATCAGGTGCGAGATCCG AACTCGTTCTGGGTGGACCT GTGACCGAACGCAGGAAAC TCGAGTCATCGTTGTCACCG ACTGAGCGCTGTCATTGCTG CTCGTCGCGGATGCATGT CCCATCCTGGCGACTTCAT TGCGGTTGTGGACGTCTTC GGAACGTTTTCTGGGGGAAG CAACAGAGGGACAGGAAACG CTGTGCATCGAGCATCCAC AAGCCTATGGCGGTCCTTG TGTCGAAGACGTAGGAACGG ATGCGTCGGAATCGGAGA TCTTCATGGCGAGGATCG ACGCCGCTCCCTAAGAGAAA TCTAAATCGCGAGGTACCC

DbfBC FlnE FlnB PhtC PhtB PhtA1 ORF14 FlnD1 FlnC

150

T. Noumura et al. / FEMS Microbiology Letters 239 (2004) 147–155

GTTTGATCMTGGCTCAG-3 0 ) and the reverse primer 1492r (5 0 -TACGGHTACCTTGTTACGACTT-3 0 ) corresponding to the positions 8–27 and 1492–1513 of the E. coli 16S rDNA sequence, respectively. PCR reactions were performed using EX or LA Taq DNA polymerase (Takara Shuzo Co. Ltd., Kyoto, Japan) as recommended by the manufacturer, in a GeneAmp PCR System 9600 thermal cycler (PE Biosystems, Chiba, Japan). The PCR program used was as follows: 1 min at 95 C; the 35 cycles of 1 min at 95 C, 1 min at 55 C, and 1.5 min at 72 C; and at 72 C for 10 min for final extension of the products. The resultant PCR products were then digested with restriction endonucleases HaeIII, HhaI, or AluI, and resultant restriction fragments were analyzed by electrophoresis on 2% agarose gel. On the other hand, the PCR products were electrophoresis and the appropriate band was extracted from gel. The purified fragments DNA were directly used as a template for sequence analysis as described below. 2.5. PCR amplification and sequencing of the dbfA1A2 gene homologues Total genomic DNA of DF-utilizing bacteria isolated from nutrient broth-grown cells was directly used as the template for PCR amplification. dbfA1A2 homologues from these strains were amplified with the same primers as used to amplify the dbfA1A2 genes from Terrabacter strain DBF63 (Table 3). The amplification reaction mixture and program were performed as described above. The PCR products were then analyzed by electrophoresis on 2% agarose gels and extracted from the gel. The purified fragments DNA were directly used as a template for sequence analysis. 2.6. Cloning of the flanking regions of two dbfA1A2 homologues in strain DFA3 To obtain DNA region flanking the dbfA1A2 genes in strain DFA3, we constructed the genomic libraries of total DNA prepared from strain DFA3 by using the cosmid vector SuperCos1 as described previously [16]. Total DNA was partially digested with Sau 3A, and fragments of 15–25-kb in size were isolated and ligated into the BamHI site of SuperCos1. The ligation mixtures were packaged in vitro by using the Gigapack III Gold Packaging Extracts XL (Strategene) to infect the E. coli DH5a host strain. The clones carrying the desired DNA fragments were screened colony hybridization as described previously [16]. The 1.8-kb PCR fragment of dbfA1A2 was used as a probe. Pre-hybridization was performed at 65 C for at least 3 h in Rapid Hybridization Buffer (Amersham Pharmacia Biotech UK Ltd.). Hybridization was performed at the same temperature for at least 16 h in the same buffer supplemented with the 32P-labeled probe. The blots were washed once with

1 · SSC (1 · SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% sodium dodecyl sulfate (SDS) (30 min, 65 C) and twice with 0.1 · SSC-0.1% SDS (30 min, 65 C). The blots were visualized as described above. Subclones including flanking regions of dbfA1A2 homologue were constructed from the cosmid clones using several restriction enzymes (Table 1). To generate a population of DNA sequencing templates with randomly interspersed primer-binding sites, we used the GPS-1 GenomePriming System (New England Biolabs, Inc., Beverly, MA). 2.7. Nucleotide sequence determination, homology search, and alignment The purified plasmids containing the appropriate insert of DNAs or PCR products were sequenced by the chain termination method using a LI-COR Model 4200L-2 auto-DNA sequencer (LI-COR Inc., Lincoln, NE) according to the manufacturerÕs instruction, or by a ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Japan) according to the manufacturerÕs instructions. The obtained nucleotide sequences were analyzed with DNASIS-Mac software (version 3.7; Hitachi Software Engineering Co. Ltd., Yokohama, Japan). The BLASTN or BLASTX [21] was used for homology searching. Multiple alignment was performed by CLUSTAL W package version 1.6 [22]. 2.8. Identification of two-subunit extradiol dioxygenase in strain DFA3 Plasmids for expressing the extradiol dioxygenase from strain DFA3 were constructed as follows. The 906- and 1175-bp DNA fragments containing only flnD1DFA3 and flnD1DFA3-ORF16a, respectively (Table 1), were prepared by PCR using pA3S15 as templates. In PCR amplification, the forward primer having the nucleotide sequences, 5 0 -TTAAGCTTTAAGGAGGGCTGCATATGGGCAGGCTGGTAGGTGCGTAC3 0 [the underlined and the double-underlined sequences are the HindIII site and an efficient Shine-Dalgarno (SD) sequence [23], respectively] and the reverse primers having the nucleotide sequences, 5 0 -AAGAATTCCTCGAGTCACGGTTCCTCCTCGGGGGCCAACCG-3 0 (the underlined sequence is the EcoRI site) for flnD1 DFA3, and 5 0 -AAGAATTCCTCGAGTCATCGTCCC TCCGTGGTTAAGTC-3 0 (the underlined sequence is the EcoRI site) for flnD1DFA3-ORF16a were used. The PCR products were cloned using the pT7Blue (R) vector (Novagene) and the nucleotide sequence of PCR products were confirmed by sequencing. The clones were cut at both HindIII and EcoRI sites (derived from the primer), and then the fragment was cloned between HindIII and EcoRI sites of pUC119 to give pA3S501 (carrying flnD1DFA3) and pA3S502 (carrying flnD1 DFA3-

T. Noumura et al. / FEMS Microbiology Letters 239 (2004) 147–155

151

ORF16a). E. coli HB101 harboring pA3S501 or pA3S502, which direct respective genes to be expressed under the control of the 0.1 mM IPTG-inducible lac promoter, were used to confirm the expression of the extradiol dioxygenase activity. E. coli cells were cultured in 5 ml of 2 · YT medium supplemented with Ap at a final concentration of 50 lg/ml at 37 C with reciprocal shaking (300 strokes/min) for 18 h. The extradiol dioxygenase activity was confirmed by the addition of 0.1% (w/v) 2,3dihydroxybiphenyl (DHB) to the culture broth. 2.9. Nucleotide sequence accession numbers The 16S rRNA gene sequences of strains DFA1, DFA10, DFA3, DFA7 and DFA9, have been submitted to the DDBJ/EMBL/GenBank databases under Accession Nos. AB180233–AB180237, respectively. The nucleotide sequence data of the flanking regions of the dbfA1A2 genes in strains DFA3 have been submitted under Accession Nos. AB181125 for pA3S15, AB181126 for pA3SL101, and AB181127 for pA3S4.

3. Results and discussion 3.1. Grouping of DF-degrading isolates by amplified ribosomal DNA restriction analysis and southern hybridization with dbfA1A2 or dbfBC probes The 13 DF-utilizing bacterial strains, designated DFA1–DFA13, were isolated from activated sludge samples obtained in Tokyo, Japan. The amplified ribosomal DNA restriction analysis (ARDRA) of these DF-degraders using restriction enzymes HhaI, HaeIII and AluI revealed three different phylotypes of bacteria (Fig. 1). Three different patterns of hybridized signals were observed by hybridization analysis of their BamHI-digested total DNA with the dbfA1A2 probe (Table 2). Four strains (DFA1, DFA2, DFA10, and DFA13) exhibited a hybridized signal of the 8.2-kb BamHI fragment, that was the same size as that exhibited in strain DBF63, three strains (DFA7, DFA8, and DFA9) exhibited a signal of the 10.0-kb, and the other six strains (DFA3, DFA4, DFA5, DFA6, DFA11, and DFA12) exhibited two hybridized signals of the 10.0- and 4.3kb fragments (Table 2). All DF-degraders possessed the highly conserved initial dioxygenase genes, dbfA1A2, but the gene organization of the flanking regions in several strains seemed to be different from that in strain DBF63. By contrast, hybridization analysis with the dbfBC probe showed that all 13 strains also possessed the dbfBC homologues (Table 2). However, the signal intensities were weaker than that in strain DBF63 (data not shown), and there were three types of hybridized signals that were different from that in strain DBF63 (Table 2). Different from initial dioxygenase gene, the

Fig. 1. The amplified ribosomal DNA restriction analysis (ARDRA) of Terrabacter sp. strain DBF63 and newly isolated 13 DF-degraders with restriction enzyme HhaI. Lanes 1, strain DFA1; 2, strain DFA2; 3, strain DFA10; 4, strain DFA13 (this phylotype is designated group A). Lane 5, Terrabacter sp. strain DBF63 (group A). Lane 6, strain DFA7 (this phylotype is designated group B). Lanes 7, 12, and 17, Marker 6. Lanes 8, strain DFA3; 9, strain DFA4; 10, strain DFA5; 11, strain DFA6; 13, strain DFA8; 14, strain DFA9; 15, strain DFA11; 16, strain DFA12 (this phylotype is designated group C).

meta-cleavage pathway genes involved in DF degradation seemed to be different from those from strain DBF63. From the results described above, we classified the 13 DF-utilizing bacterial strains into five groups as shown in Table 2. Then, we performed detailed genetic analysis using strains DFA1 (group I), DFA3 (II), DFA7 (III), DFA9 (IV) and DFA10 (V) as representatives of each group. 3.2. Sequences of 16S rRNA genes and dbfA1A2 genes In order to establish precisely the phylogenetic affiliation of the DF-utilizing bacteria, we determined the 16S rRNA gene sequences of the five selected isolates. Phylogenetic analysis revealed that the DF degraders are belonging to members of the genus Rhodococcus, Terrabacter or Janibacter (Table 2). The genus Rhodococcus is the most closely related to Rhodoccocus sp. BDC14 (AY249053) (strain DFA3, 100%), R. fascians (Y11196) (strain DFA7, 99.86%) and R. erythropolis NV1 (AY147846) (strain DFA9, 100%). The genus Terrabacter is the most closely related to Terrabacter sp. strain YK21 (AB070468) (strain DFA1, 99.86%). The genus Janibacter is the most closely related to J. limosus SAFR-0 (AY167846) (strain DFA10, 99.70%). Since all DF degraders isolated from activated sludge samples in this study were classified as Actinobacteria (high G + C content group of Gram-positive bacteria), it seems that there may be a reservoir for DF catabolic genes in members of Actinobacteria. Iida et al. [8,9] also isolated 16 Actinobacteria that utilized DF as a sole carbon and energy source from soil samples. However, it should be noted that these DF-degrading strains were isolated from (undiluted) environmental samples enriched with

152

T. Noumura et al. / FEMS Microbiology Letters 239 (2004) 147–155

(pYK3) has also been found in Terrabacter sp. strain YK3 [8]. These findings suggest that there is the possibility that plasmids pDBF1, pDBF2 and pYK3 are selftransmissible, and may be involved in the distribution of the DF catabolic gene among Actinobacteria in nature.

0.1% DF. If Rhodococcus strains are preferentially isolated under these conditions because of their rapid growth (doubling times of R. opacus strain SAO101 and S. wittichii strain RW1 with DF were 6 h [12] and 7 h [7], respectively), this can explain why most DF-degrading bacteria isolated from natural soil or activated sludge samples exhibit a surprising uniformity in their phenotypes and cell structures [24]. When the same samples as those used in this study were cultured in the medium containing crystal violet to inhibit Gram-positive bacteria, we could not obtain Gram-negative DF-degrading bacteria (data not shown). This indicated that Gram-positive bacteria such as genus Terrabacter, Rhodococcus and Janibacter may be the most dominant DFdegrading bacteria in our activated sludge samples. To determine the extent of sequence similarity between the dbfA1A2 homologues from the five selected strains and the dbfA1A2 genes from strain DBF63, we conducted PCR amplification and sequencing analysis of the genes were conducted. In the five strains analyzed here, PCR amplification using the dbfA1A2-specific primers consistently produced a 1.8-kb DNA fragment corresponding to the size of the dbfA1A2 gene (data not shown). DNA sequencing revealed that the PCRamplified dbfA1A2 homologues from the five selected strains were almost identical to the dbfA1A2 genes of strain DBF63. Since the lineage of the dbfA1A2 homologues is less diverged (99–100% sequence identity) than that of the hosts, as determined by 16S rRNA gene sequence analysis, the dbfA1A2 genes might have spread among these bacterial strains by lateral transferring events, e.g., the transfer of plasmids. Recently, Nojiri et al. [17] reported that the DF and fluorene (FN) catabolic gene in strain DBF63 were located on two large linear plasmids pDBF1 and pDBF2. On the other hand, the circular plasmid-borne gene code for DF catabolism

Strain DBF63 ORF14

OR F11

p h tA1 A2

3.3. Genetic organization of the dbfA1A2-flanking regions in DF-utilizing isolates We tried to clarify over which length DNA regions being highly homologous to strain DBF63 have been conserved among these strains. Southern blot hybridization analysis under high-stringency conditions was performed using the selected genes within the 20-kb segment of both pht and dbf–fln gene clusters from strain DBF63 [25,26] as probes (Table 3, Fig. 2). Concerning strains DFA1 and DFA10 belonging to the genus Terrabacter and Janibacter, respectively, strong hybridized signals with the same size of DNA fragments as strain DBF63, were observed using any of the probes tested. In addition, PCR experiments showed that the organization of each ORF was also completely the same as that of strain DBF63 (data not shown). By contrast, in Rhodococcus sp. strains DFA3, DFA7 and DFA9, the conserved region was extended only within the 10.0-kb BamHI fragment, and hybridized signals were not observed when phtB and flnC genes were used as probes (Fig. 2). On the other hand, another DNA region containing dbfA1A2 homologues in strain DFA3 was extended within the shorter 4.3-kb BamHI fragment (Fig. 2). These results imply that the DNA regions upstream and downstream of the conserved 10.0- and 4.3-kb BamHI segments in Rhodococcus strains are clearly different from those in Terrabacter and Janibacter strains.

B

B

phtBA3 p h tA4 p h tC phtR flnR

flnB dbfA1 A2

flnE

B

f l nD1

B

1 kb ORF18

ORF16 f l nC

B

19 ORF20

Strains DFA1 and 10 Strains DFA3, 7 and 9 Strain DFA3

P

pA3L101

B

C P

pA3S4

Sp B

Sp

P

pA3S15

Fig. 2. Schematic overview of the Southern blot analysis of the BamHI-digested total DNA prepared from five strains DFA1, DFA10, DFA3, DFA7 and DFA9 using 10 ORFs within 20-kb DNA segment of pht and dbf–fln gene clusters of Terrabacter sp. strain DBF63 [25,26] as probes. Total DNA of Terrabacter sp. strain DBF63 was used as a positive control. Boxes represent the sizes of BamHI fragments hybridized with respective probes. The shaded ORFs indicated the probes used in this study. Restriction enzyme site designation: B, BamHI; C, ClaI; P, PstI; Sp, SphI.

T. Noumura et al. / FEMS Microbiology Letters 239 (2004) 147–155

153

3.4. Sequence analyses of the flanking regions of two dbfA1A2 homologues in strain DFA3 Several genetic elements have been reported to be involved in the gene rearrangement or the gene transposition in the border regions described above [24]. Hence, we cloned and sequenced the corresponding border regions of 10.0- and 4.3-kb BamHI segments from strain DFA3, which harbors two copies of dbfA1A2 homologues (dbfA1A2DFA3). We obtained two cosmid clones, designated pA3L and pA3S (Table 1). The restriction maps and Southern blot analyses of the two cosmid clones showed the same hybridization pattern in the downstream regions of both dbfA1A2DFA3 in pA3L and in pA3S (data not shown). Subcloning and sequencing analyses of the 3.8-kb ClaI–PstI fragment located on 2.7-kb upstream of dbfA1A2DFA3 genes in cosmid pA3L (designated pA3L101), and those of the 4.5-kb PstI and the 2.9-kb SphI fragments located on upstream and downstream, respectively, of dbfA1A2DFA3 genes in cosmid pA3S (pA3S4 and pA3S15, respectively), were conducted (Figs. 2 and 3). Sequence analysis of plasmid pA3S15 showed that the downstream region of dbfA1A2DFA3 was highly conserved until the end of ORF16DBF63 (91–97% sequence identity), but abruptly became completely unrelated in the region beyond this border (Fig. 3(a)). However, in the non-homologous region, there are no genes involved in the gene transfer or gene rearrangement. Instead, there was ORF1S which seems to be a remnant of gene homologous to the putative phthalate ester hydrolase (PehA) of Arthrobacter keyseri 12B (81% amino sequence identity) [9,27]. However, we can speculate that some part of the dbfA1A2DFA3 downstream flanking region has been recruited from other loci, because the G + C content of the downstream sequence from the border region (60.3%) was lower than the G + C content of the sequence around dbfA1A2DFA3 (68.1%) (Fig. 3(a)). By contrast, the analysis of the dbfA1A2DFA3 upstream region from plasmid pA3L101 showed that the sequences were still very similar until the middle of phtDBF63 (>97% sequence identity) and then abruptly became completely unrelated beyond this border (Fig. 3(b)). Just upstream of the border region, there was ORF1L which is homologous to the genes encoding 2hydroxypenta-2,4-dienoate hydratases (e.g., TodG from toluene-degrader Pseudomonas putida strain F1, U09250, 53% identity). Also, in a further upstream region, there was ORF2L which seems to be a remnant of insertion sequence (IS) homologous to IS1557 of Micrococcus strain (Z96935). Similarly, the sequence analysis of plasmid pA3S4 exhibited that the upstream region were still very conserved until the middle of flnRDBF63(88–99% sequence identity), and then abruptly became completely unrelated beyond this border (Fig. 3(c)). In the non-homologous region, there is ORF2S

Fig. 3. Physical maps of the DNA regions flanking the dbfA1A2 gene homologues in Rhodococcus sp. strain DFA3. (a) pA3S15, (b) pA3L101 and (c) pA3S4 (see Fig. 2). These maps were made based on the combination of the results of Southern blot and sequence analyses. The pht and dbf–fln catabolic gene clusters of Terrabacter sp. strain DBF63 was used for comparison [25,26]. The G + C content was calculated based on DNA sequences. The highly conserved regions between strains DBF63 and DFA3 were represented with dots, and identities (%) at DNA level were shown. ORFs homologous to transposases and the remnant of transposase are shown by gray pentagons. Inverted repeats were shown by black boxes. Restriction enzyme site designation: C, ClaI; Sp, SphI; and P, PstI.

homologous to putative transposase gene from Rhodococcus strain DK17 (AY502076). In flanking regions of this transposase-encoding gene, there were 19-bp-long terminal inverted repeats. These results suggested that the IS-like elements might be involved in DF-catabolic operon rearrangements in strain DFA3. Kulakov et al. [28] have reported that a new insertion sequence (IS2112) that found in R. rhodochrous NCIMB 13064 is involved in rearrangement of haloalkane catabolic operon. This result is supported by the evidence that the sequence homologous to IS2112 were also detected in haloalkane degrader Rhodococcus strains NCIMB 13064, NCIMB 13065, TB2, Y2, GJ70 and M15-3 [28]. Within the conserved region, there were also several differences. Sequence comparison of the downstream

154

T. Noumura et al. / FEMS Microbiology Letters 239 (2004) 147–155

region of flnD1 in strains DBF63 and DFA3 revealed that the ORF16DBF63 was divided into two ORFs (ORF16a and ORF16b) in strain DFA3 (Fig. 3(a)). Recently, Habe et al. [26] reported that FlnD1DBF63 and ORF16DBF63 product consisted of a class III two-subunit extradiol dioxygenase and that ORF16DBF63 showed the modular nature of two genes encoding an extradiol dioxygenase small subunit and a putative [3Fe–4S] type of ferredoxin. Therefore, in strain DFA3, FlnD1DFA3 and ORF16a product were predicted to be the components of a two-subunit extradiol dioxygenase. We amplified by PCR the DNA fragments containing only flnD1DFA3 and flnD1DFA3-ORF16a with SD sequences, cloned these genes using vector pUC119 (pA3S501 and pA3S502, respectively, Fig. 3(a)), and transformed E. coli HB101 cells with pA3S501 and pA3S502. As a result, only the culture broth of E. coli cells harboring pA3S502 containing flnD1DFA3-ORF16a exhibited the yellow color derived from meta-cleavage product of DHB. SDS–PAGE showed that FlnD1DFA3 (29-k) and ORF16a product (10-k), which correspond to the predicted molecular masses of 30,666 and 9870, respectively, were expressed in the presence of IPTG at final concentrations of 0, 0.1, 0.5, and 1 mM (data not shown). From these results, it was confirmed that ORF16a product (small subunit) and FlnD1DFA3 (large subunit) constituted the two-subunit extradiol dioxygenase. We designated ORF16a as flnD2DFA3. Interestingly, the sequence comparison of flnD1DFA3 with flnD1DBF63 indicated that there is a 24-bp deletion of nucleotides within flnD1DFA3 (data not shown). Pries et al. [29] reported that spontaneous deletion (33-bp) occurring in the dhlA gene for dehaloalkane dehalogenase of Xanthobacter autrophicus strain GJ10 expanded the substrate range to 1-chlorohexane. Similarly, this 24 base pair sequence deletion that occurred in extradiol dioxygenase in strain DFA3 may cause the alteration of extradiol dioxygenase activity. Hence, detailed comparison analysis of the activities of these FlnD enzymes toward several substrates is now underway. In summary, the presence of the highly conserved genetic region flanking the dbfA1A2 genes in all DF-degrading isolates strongly suggests that this gene structure was distributed in Actinobacteria in the environment by several mechanisms. Detailed study of the mobile element carrying the dbfA1A2 genes should provide important and interesting information for clarifying the evolutionary mechanisms of DF-degradation in environment.

Acknowledgement Part of this study was supported by the Program for Promotion of Basic Research Activities for Innovative Bioscience (PROBRAIN).

References [1] Poland, A. and Knutson, J.C. (1982) 2,3,7,8-Tetrachlorodibenzop-dioxin and related halogenated aromatic hydrocarbons: examination of the mechanism of toxicity. Ann. Rev. Pharmacol. Toxicol. 22, 517–554. [2] Safe, S. (1990) Polychlorinated biphenyls (PCBs), dibenzofurans (PCDFs), and related compounds: environmental and mechanistic considerations which support the development of toxic equivalency factors. CRC Crit. Rev. Toxicol. 21, 51–88. [3] Strubel, V., Rast, H.G., Fietz, W., Knackmuss, H.J. and Engesser, K.H. (1989) Enrichment of dibenzofuran utilizing bacteria with high co-metabolic potential towards dibenzodioxin and other anellated aromatics. FEMS Microbiol. Lett. 58, 233– 238. [4] Engesser, K.H., Strubel, V., Christoglou, K., Fischer, P. and Rast, H.G. (1989) Dioxygenolytic cleavage of aryl ether bonds: 1,10-dihydro-1,10-dihydroxyfluoren-9-one, a novel arene dihydrodiol as evidence for angular dioxygenation of dibenzofuran. FEMS Microbiol. Lett. 65, 205–210. [5] Wittich, R.-M., Wilkes, H., Sinnwell, V., Francke, W. and Fortnagel, P. (1992) Metabolism of dibenzo-p-dioxin by Sphingomonas sp. strain RW1. Appl. Environ. Microbiol. 58, 1005–1010. [6] Monna, L., Omori, T. and Kodama, T. (1993) Microbial degradation of dibenzofuran, fluorene, and dibenzo-p-dioxin by Staphylococcus auriculans DBF63. Appl. Environ. Microbiol. 59, 285–289. [7] Fukuda, K., Nagata, S. and Taniguchi, H. (2002) Isolation and characterization of dibenzofuran-degrading bacteria. FEMS Microbiol. Lett. 208, 179–185. [8] Iida, T., Mukouzaka, Y., Nakamura, K. and Kudo, T. (2002) Plasmid-borne gene code for an angular dioxygenase involved in dibenzofuran degradation by Terrabacter sp. strain YK3. Appl. Environ. Microbiol. 68, 3716–3723. [9] Iida, T., Mukouzaka, Y., Nakamura, K., Yamaguchi, I. and Kudo, T. (2002) Isolation and characterization of dibenzofurandegrading actinomycetes: analysis of multiple extradiol dioxygenase genes in dibenzofuran-degrading Rhodococcus species. Biosci. Biotechnol. Biochem. 66, 1462–1472. [10] Fuse, H., Takimura, O., Murakami, K., Inoue, H. and Yamaoka, Y. (2003) Degradation of chlorinated biphenyl, dibenzofuran, and dibenzo-p-dioxion by marine bacteria that degrade biphenyl, carbazole, or dibenzofuran. Biosci. Biotechnol. Biochem. 67, 1121–1125. [11] Wilkes, H., Wittich, R.-M., Timmis, K.N., Fortnagel, P. and Francke, W. (1996) Degradation of chlorinated dibenzofuran and dibenzo-p-dioxin by Sphingomonas sp. strain RW1. Appl. Environ. Microbiol. 62, 367–371. [12] Kimura, N. and Urushigawa, Y. (2001) Metabolism of dibenzo-pdioxin and chlorinated dibenzo-p-dioxin by a gram-positive bacterium, Rhodococcus opacus SAO101. J. Biosci. Bioeng. 92, 138–143. [13] Habe, H., Chung, J.S., Lee, J.H., Kasuga, K., Yoshida, T., Nojiri, H. and Omori, T. (2001) Degradation of chlorinated dibenzofurans and dibenzo-p-dioxins by two types of bacteria having angular dioxygenases with different features. Appl. Environ. Microbiol. 67, 3610–3617. [14] Habe, H., Ide, K., Yotsumoto, M., Tsuji, H., Yoshida, T., Nojiri, H. and Omori, T. (2002) Degradation characteristics of a dibenzofuran-degrader Terrabacter sp. strain DBF63 toward chlorinated dioxins in soil. Chemosphere 48, 201–207. [15] Kasuga, K., Nojiri, H., Yamane, H., Kodama, T. and Omori, T. (1997) Cloning and characterization of the genes involved in the degradation of dibenzofuran by Terrabacter sp. strain DBF63. J. Ferment. Bioeng. 84, 387–399.

T. Noumura et al. / FEMS Microbiology Letters 239 (2004) 147–155 [16] Kasuga, K., Habe, H., Chung, J.S., Yoshida, T., Nojiri, H., Yamane, H. and Omori, T. (2001) Isolation and characterization of the genes encoding a novel oxygenase component of angular dioxygenase from the gram-positive dibenzofuran-degrader Terrabacter sp. strain DBF63. Biochem. Biophys. Res. Commun. 283, 195–204. [17] Nojiri, H., Kamakura, M., Urata, M., Tanaka, T., Chung, J.S., Takemura, T., Yoshida, T., Habe, H. and Omori, T. (2002) Dioxin catabolic genes are dispersed on the Terrabacter sp. DBF63 genome. Biochem. Biophys. Res. Commun. 296, 233–240. [18] Armengaud, J., Happe, B. and Timmis, K.N. (1998) Genetic analysis of dioxin dioxygenase of Sphingomonas sp. strain RW1: catabolic genes dispersed on the genome. J. Bacteriol. 180, 3954– 3966. [19] Ka¨stner, M., Breuer-Jammali, M. and Mahro, B. (1994) Enumeration and characterization of the soil microflora from hydrocarboncontaminated soil sites able to mineralize polycyclic aromatic hydrocarbons (PAH). Appl. Microbiol. Biotechnol. 41, 267–273. [20] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. [21] Altschul, S.F., Madden, T.L., Schafer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucleic Acid Res. 25, 3389–3402. [22] Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence aligment through sequence weighting, positions-specific gap penalties and weight matric choice. Nucleic Acid Res. 22, 4673–4680.

155

[23] Shine, J. and Dalgarno, L. (1975) Determination of cistron specificity in bacterial ribosomes. Nature 254, 34–38. [24] Poelarends, G.J., Kulakov, L.A., Larkin, M.J., van HylckamaVlieg, J.E. and Janssen, D.B. (2000) Role of horizontal gene transfer and gene integration in evolution of 1,3-dichloropropeneand 1,2-dibromoethane-degradative pathways. J. Bacteriol. 182, 2191–2199. [25] Habe, H., Miyakoshi, M., Chung, J.S., Kasuga, K., Yoshida, T., Nojiri, H. and Omori, T. (2003) Phthalate catabolic gene cluster is linked to the angular dioxygenase gene in Terrabacter sp. strain DBF63. Appl. Microbiol. Biotechnol. 61, 44–54. [26] Habe, H., Chung, J.S., Kato, H., Ayabe, Y., Kasuga, K., Yoshida, T., Nojiri, H., Yamane, H. and Omori, T. (2004) Characterization of the upper pathway genes for fluorene metabolism in Terrabacter sp. strain DBF63. J. Bacteriol. 186, 5938–5944. [27] Eaton, R. (2001) Plasmid-encoded phthalate catabolic pathway in Arthrobacter keyseri 12B. J. Bacteriol. 183, 3689–3703. [28] Kulakov, L.A., Poelarends, G.J., Jansssen, D.B. and Larkin, M.J. (1999) Characterization of IS2112, a new insertion sequence from Rhodococcus, and its relationship with mobile elements belonging to the IS110 family. Microbiology 145, 561–568. [29] Pries, F., van den Wijngaard, A.J., Bos, R., Pentenga, M. and Janssen, D.B. (1994) The role of spontaneous cap domain mutation in haloalkane dehalogenase specificity and evolution. J. Biol. Chem. 269, 17490–17494. [30] Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC119 vectors. Gene 33, 103–119.