- Email: [email protected]
Genetic differentiation between cultured and wild populations of Paralichthys olivaceus based on AFLP markers
Biochemical Systematics and Ecology 68 (2016) 230e235
Contents lists available at ScienceDirect
Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco
Genetic differentiation between cultured and wild populations of Paralichthys olivaceus based on AFLP markers Na Song a, Xiumei Zhang a, Zhiqiang Han b, Tianxiang Gao b, * a b
Fisheries College, Ocean University of China, Qingdao 266003, China Fishery College, Zhejiang Ocean University, Zhoushan 316022, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 May 2016 Received in revised form 23 July 2016 Accepted 30 July 2016 Available online 9 August 2016
Paralichthys olivaceus is a warm-temperature benthic species distributed in the western Pacific Ocean from the Kuril Islands, Japan to the South China Sea. In the present study AFLP (amplified fragment length polymorphism) marker was employed to examine the genetic differences between cultured and wild populations of P. olivaceus. The results showed that the gene diversity and Shannon's information index of cultured populations (h ¼ 0.130e0.150; I ¼ 0.201e0.236) were similar with wild populations (h ¼ 0.123e0.136; I ¼ 0.199e0.220). Pairwise Fst and AMOVA revealed significant genetic differentiation among them, indicating cultured populations exhibited distinctive heterogeneity with wild populations. The results of present study suggested that broods of this study should not be released into natural sea areas due to its genetic alterations. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Paralichthys olivaceus AFLP Genetic differentiation Cultured population Wild population
1. Introduction Japanese flounder, Paralichthys olivaceus, is a benthic and economical flatfish in the family Bothidae, which distributes throughout the western Pacific Ocean from the Kuril Islands, Japan to the South China Sea (Li and Wang, 1995; Masuda and Tsukamoto, 1998). This species is endemic to the western Pacific Ocean, and is the most common flatfish species raised in China, Japan and Korea due to its rapid growth, delicious quality and good adaptability. With the heavy exploitation of the fishery resource, market landings of P. olivaceus began to decline since 1970 s, while the aquaculture productions have shown a trend of sustained growth since 1980 s, exceeding fishing productions (FAO, 2008). In order to protect and recover the natural population of P. olivaceus, more and more cultured individuals has been released into sea areas (Tomiyama et al., 2008). In Shandong Province of China, the number of released individuals varied from less than 200,000 individuals at 2005 to more than 18,000,000 individuals at 2014. Some studies have proved that hatchery-reared individuals may have a negative effect on the variability of recipient wild populations (Goodman, 2005; Jonsson and Jonsson, 2006). Hatchery-reared individuals may compete for food, space with native, and even spread parasites and diseases (Jonsson et al., 1991; Bakke et al., 1990; Jonsson and Jonsson, 2006). When hatchery-reared broods are released into nature, their genetic effect on wild populations has also attracted great attention. Reduced genetic diversity of cultured fish has been reported (Kohlmann and Kersten, 1999; Skaala et al., 2004), which can cause a reduction in fitness because mean phenotypes could be shifted by inbreeding (Lynch, 1991). When these hatcheryreared individuals are released into natural waters, they may change the genetic variability of recipient populations
* Corresponding author. E-mail address: [email protected] (T. Gao). http://dx.doi.org/10.1016/j.bse.2016.07.025 0305-1978/© 2016 Elsevier Ltd. All rights reserved.
N. Song et al. / Biochemical Systematics and Ecology 68 (2016) 230e235
231
through reproduction behavior (Bert et al., 2007). So, it is very important to monitor the genetic diversity of released broods to avoid the genetic alteration of recipient wild populations. Until now various molecular markers have been successfully applied to survey genetic influence of stock enhancement. For example, Araki et al. (2007) found that even a few generations of domestication may have negative effects on natural reproduction in the wild by reconstructing a three-generation pedigree with microsatellite markers and the results suggested that the repeated use of captive-reared parents to supplement wild populations should be carefully reconsidered. Comparative studies on the genetic differences of Paralichthys olivaceus between cultured and wild population have been conducted by different molecular markers until now. The screening of genetic variations by earlier allozyme markers revealed significant genetic differentiation between wild and cultured-released populations but no reduced genetic diversity were obtained (Liu et al., 1997). However, recent analysis by allozyme markers, mitochondrial DNA and microsatellite DNA have detected obvious reduced genetic diversity of cultured P. olivaceus (Yoshida et al., 2000; You et al., 2001; Sekino et al., 2002). Amplified fragment length polymorphism (AFLP) analysis is a PCR-based, muti-locus fingerprinting technique that combines the strengths and overcomes the weaknesses of the RFLP and RAPD methods (Vos et al., 1995). It is an effective molecular maker and widely used to study interspecific genetic diversity because it allows fast and efficient generation of a large amount of genetic data (Wang et al., 2000; Liu et al., 2009). It also has been employed to detect loss of the genetic diversity in cultured populations of various fish species, (Wang et al., 2002). Xu et al. (2006) evaluated the genetic diversity of four wild geographical populations of Japanese flounder by AFLP marker and a certain extent of differentiation among them was detected. Moreover, Zhang et al. (2004) found smaller number of total loci for cultured populations and no genetic differentiation between wild and farmed populations by AFLP marker. In the present study, two wild and four cultured populations were collected from Chinese coastal waters to examine the present population genetic diversity and variability of P. olivaceus. The results of the present study will reveal the genetic structure and diversity of this economically important species and provide vital information for sustainable exploitation, aquaculture and management of its natural populations.
2. Material and methods 2.1. Fish samples Two wild populations (Qw and Ww) were collected from nature waters and four cultured populations were collected from hatchery during December 2007 to April 2009. Moreover, one cultured population Rc was obtained from random sampling of cultured stock for releasing in Rongcheng at May 2008 (Fig. 1 Table 1). All individuals were identified based on morphological characteristics, and a piece of muscle tissue was obtained from each individual and preserved in 95% ethanol or directly extracted from frozen samples.
Fig. 1. Map showing sample locations of P. olivaceus. Dl: Dalian, Zs: Zhoushan, Rc: Rongcheng, Rz: Rizhao, Ww: Weihai, Qw: Qingdao.
232
N. Song et al. / Biochemical Systematics and Ecology 68 (2016) 230e235
Table 1 Sampling sites, date of collection and sample size of P. olivaceus in the present study and several genetic diversity indices. ID
Sampling site
Sample size
Date of collection
Number of loci
Number of polymorphic loci
Proportion of polymorphic loci
Nei's gene diversity
Dl Zs Rc Rz Ww Qw Total
Dalian, Liaoning Province Zhoushan, Zhejiang Province Rongcheng, Shandong Province Rizhao, Shandong Province Weihai, Shandong Province Qingdao, Shandong Province y
14 16 16 13 17 12 88
2008.10 2008.09 2008.05 2007.12 2008.12 2009.04 y
233 246 249 221 258 237 304
115 138 130 102 152 123 208
49.36% 56.10% 52.21% 46.15% 58.91% 51.90% 68.42%
0.211 0.236 0.210 0.201 0.220 0.199 0.221
± ± ± ± ± ± ±
0.251 0.253 0.245 0.259 0.236 0.234 0.232
Shannon's information index 1.494 1.561 1.522 1.462 1.589 1.519 1.684
± ± ± ± ± ± ±
0.501 0.497 0.501 0.500 0.493 0.501 0.466
2.2. Genomic DNA extraction and AFLP method Genomic DNA was isolated from muscle tissue by proteinase K digestion followed by a standard phenolechloroform method. We conducted procedures of AFLP according to methods by Vos et al. (1995) and Wang et al. (2000). All the PCR products were run on 6.0% denaturing polyacrylamide gel electrophoresis (PAGE) for 2.5 h at 50 C on the Sequi-Gen GT Sequencing Cell (Bio-Rad, USA), and finally detected using the silver staining technique modified from Merril et al. (1979). Sequences of AFLP adapters, primers, and four selective primer combinations (EAAC-MCTA, EAGA-MCAA, EAGA- MCTA and EAAC-MCTC) used in the present study are listed in Table 2. 2.3. Data analysis All clear and unambiguous AFLP bands were scored for presence (1) or absence (0), and transformed into 0/1 binary character matrix in Microsoft Office Excel. Percentages of polymorphic loci, Nei's genetic diversity and Shannon diversity index were calculated by POPGENE Version 1.32. Similarity indices among individuals were calculated according to the formula S ¼ 2Nab/(Na þ Nb) (Nei and Li, 1979), where Na and Nb are the number of bands in individual a and b respectively, and Nab is the number of shared bands. Genetic distances were computed using the formula D ¼ -ln S (Nei and Li, 1979). ARLEQUIN version 3.0 was used to calculate pairwise fixation index Fst between pairs of population samples and the significance of the Fst was tested by 10,000 permutations for each pairwise comparison (Excoffier et al., 2005). When multiple comparisons were performed, P values were adjusted using the sequential Bonferroni procedure (Rice, 1989). To further examine hierarchical population structure as well as the geographical pattern of population subdivision, we used analysis of molecular variance (AMOVA) (Excoffier et al., 1992). 3. Results All clear and unambiguous bands were plotted in the Microsoft Office Excel. A total of 304 bands were identified by 4 selective primer combinations for 88 individuals, of which 208 loci were polymorphic loci (Table 1). The number of bands generated for each primer combinations varied from 54 to 101, and percentage of polymorphic loci varied from 59.04% to 77.27%, respectively (Table 3). The primer combination EAGA/MCTA generated the most bands and the percentage of polymorphic loci of EAAC/MCTC was the highest. For 6 populations, the number of generated bands ranged from 221 to 258, and percentage of polymorphic loci for each population ranged from 46.15% to 58.91%, respectively. The wild population Ww obtained the most loci and percentage of polymorphic loci. The results exhibited that no obvious differences for genetic diversity were obtained. Assuming HardyeWeinberg equilibrium, population Zs showed highest Nei's genetic diversity
Table 2 Adapter and primer combinations sequences used in the study. Sequence (50 d30 )
Primer Adapter
Pre-amplification primer Selective amplification primer
EcoRI-1 adapter EcoRI-2 adapter MseI-1 adapter MseI-2 adapter EcoRI MseI EAAC-MCTA EAGA-MCAA EAGA- MCTA EAAC-MCTC
CTCGTAGACTGCGTACC AATTGGTACGCAGTCTAC GACGTGAGTCCTGAG TACTCAGGACTCATGACTGCGTACCAATTC GATGAGTCCTGAGTAA GACTGCGTACCAATTCAAC GATGAGTCCTGAGTAACTA -GACTGCGTACCAATTCAGA -GATGAGTCCTGAGTAACAA GACTGCGTACCAATTCAGA GATGAGTCCTGAGTAACTA GACTGCGTACCAATTCAAC GATGAGTCCTGAGTAACTC0
N. Song et al. / Biochemical Systematics and Ecology 68 (2016) 230e235
233
Table 3 Number of bands generated by four primer combinations. Primers
EAAC/MCTA
EAGA/MCAA
EAGA/MCTA
EAAC/MCTC
Number of loci Number of polymorphic loci Proportion of polymorphic loci
54 34 62.96%
83 49 59.04%
101 76 75.25%
66 51 77.27%
(0.236 ± 0.253) and population Qw showed highest Shannon’ s information index (1.589 ± 0.493), while the wild population Qw showed the lowest Nei's genetic diversity (0.199 ± 0.234) and population Rz showed lowest Shannon’ s information index (1.462 ± 0.500). We constructed UPGMA tree based on Nei's genetic distance for 88 individuals (Fig. 2). The topology of the UPGMA tree was shallow and all individuals of 6 populations mixed with each other. Some small branches corresponding to different locations were detected, which suggested genetic differences among populations. The results of AMOVA indicated that 86.71% of the genetic variation existed within populations and 13.29% among populations when all six populations were pooled into one group (Table 4). Two groups were defined to do further AMOVA analysis. Four cultured populations were pooled to one group, and two wild populations were pooled to another group. The results showed that genetic variation among groups was only 0.81% and within populations was 86.38%. Most of the pairwise Fst values were high and significant after sequential Bonferroni correction, and pairwise Fst between two wild populations was lowest (Table 5). 4. Discussions Many studies showed that amplified fragment length polymorphism (AFLP) markers were effective to study genetic diversity of many marine fishes (Liu et al., 2009; Chen et al., 2014), and it is also widely used in the genetic comparative analysis
Fig. 2. UPGMA tree of 88 P. olivaceus individuals based on Nei's genetic distance.
Table 4 Results of AMOVA on P. olivaceus Source of variation One gene pool Among populations Within populations Two gene pools Among groups Within groups Within populations
Degrees of freedoms
Sum of squares
Variance components
Percentage of variation
5 82
323.891 1638.745
3.06328 Va 19.98470 Vb
13.29 86.71
1 4 82
71.444 252.447 1638.745
0.18699 Va 2.96383 Vb 19.98470 Vc
0.81 12.81 86.38
One gene pool: all populations were pooled to one group. Two gene pools: population Dl, Zs, Rc and Rz were pooled to form cultured group, and populations Ww and Qw were pooled to form wild group.
234
N. Song et al. / Biochemical Systematics and Ecology 68 (2016) 230e235
Table 5 Pairwise Fst (below diagonal) among six populations of P. olivaceus based on AFLP data.
Dl Zs Rc Rz Ww Qw
Dl
Zs
Rc
RZ
Ww
0.152* 0.110* 0.167* 0.110* 0.169*
0.152* 0.200* 0.152* 0.143*
0.132* 0.079* 0.127*
0.104* 0.152*
0.056*
Qw
*The Fst values are significant after the sequential Bonferroni procedure (P < 0.01).
between wild and cultured populations (Wang et al., 2007). In the present study, four selective amplification primers were used to access the genetic status of P. olivaceus. A total of 304 bands were identified and the percentage of polymorphic loci was 68.42%. Zhang et al. 2004 generated 797 bands by 7 selective amplification primers and the percentage of polymorphic loci was lower than that of the present study. However, the gene diversity and Shannon's information index exhibited no obvious difference for six populations between the wild and cultured populations in this study, which was in contrast with Zhang et al. (2004). Moreover, for the same samples in the present study, Song et al. (2011) detect reduced genetic diversity of cultured population by mitochondrial DNA. It is not surprising because the same situation has been reported in striped mullet (Liu et al., 2009), spottedtail goby (Song et al., 2010). Mitochondrial DNA is haploid, maternally inherited, lack of recombination and has a fourfold lower effective population size (Domingues et al., 2007). Although population Zs had the higher diversity in the present study, its proportion of polymorphic loci was not highest. It is very important to use some more sensitive molecular markers to do further genetic analysis for P. olivaceus. In the present study, high pairwise Fst between wild and cultured populations suggested strong genetic differentiation among them. Cultured populations exhibited different genetic structure, which may be due to isolated farm-propagation. High genetic variation within populations may lead to failure to detect genetic differentiation among groups. In most cases, genetic changes for broods were inevitable because smaller numbers of broodstocks were used in the hatchery, and sometimes they even were used over succeeding generations (Waples and Do, 1994; Bert et al., 2007). Smaller broodstocks may lead to unequal contributions of broodstock individuals to broods and inbreeding in broodstocks (Bert et al., 2007). Genetic drift over generations will accumulate when smaller broodstocks were used in the hatchery, and decrease the fitness of hatchery broods by reducing their genetic variability, changing genetic composition, and increasing genetic load (Calcagnotto and Toledo-Filho, 2000). Compared with genetic differentiation between two wild populations, strong genetic differentiation between cultured and wild populations and among cultured populations suggested genetic alterations of P. olivaceus in these farms. The recipient wild populations may undergo dramatic genetic changes if we released these broods into recipient populations. The released specimens may alter the genetic diversity, decrease the fitness and reduce the effective population size of the mixed populations by some ecological and biological interactions with wild individuals (Bert et al., 2007). Genetic variability is very important for long-term survival of enhanced populations (Lande, 1995), and in the stock enhancement operations maintaining the genetic diversity of broodstocks is the most important for sustainable exploration (Moran, 2002). Actually stock enhancement may not be the best measure for recovering the natural resources because we cannot predict the enhancement effect (Mustafa, 2003), and it should be carried out combined with other protective measures like artificial reefs or habitat conservations (Waples and Drake, 2004). In the present study genetic alterations of cultured populations indicated that we should not release these broods into nature waters. Before we decide to conduct stock enhancement, we must avoid the genetic heterogeneity of broodstocks and its offsprings with recipient populations. Therefore, if we want to recover natural resources and start a stock enhancement program, it is necessary to evaluate the genetic status of P. olivaceus and begin genetic monitoring management. Acknowledgments Thank Prof. Y.P. Ren, Prof. Z.Q. Jiang, Prof. B.N. Shui, and Dr. Q., Liu for collecting the samples. This work was supported by the National Program on Key Basic Research Project (973 Program) (2015CB453302) and the Public Science and Technology Research Funds Projects of Ocean (201405010 and 201305043). References Araki, H., Cooper, B., Blouin, M.S., 2007. Genetic effects of captive breeding cause a rapid, cumulative fitness decline in the wild. Science 318, 100e103. Bakke, T.A., Jansen, P.A., Hansen, L.R., 1990. Differences in the host-resistance of Atlantic salmon, Salmo salar L, stocks to the Monogenean Gyrodactylus salaris Malmberg, 1957. J. Fish Biol. 37, 577e587. Bert, T.M., Crawford, C., Tringali, M.D., Seyoum, S., Galvin, J.L., Higham, M., Lund, C., 2007. Genetic management of hatchery-based stock enhancement. In: Bert, T.M. (Ed.), Ecological and Genetic Implications of Aquaculture Activities. Springer Publications, New York, USA, pp. 123e174. Calcagnotto, D., Toledo-Filho, S.D.A., 2000. Loss of genetic variability at the transferrin locus in five hatchery stocks of tambaqui (Colossoma macropomum). Genet. Mol. Biol. 23, 127e130. Chen, W., Hong, W.S., Chen, S.X., Wang, Q., Zhang, Q.Y., 2014. AFLP analysis of genetic structure of Boleophthalmus pectinirostris populations from the coastal waters of Northwest Pacific. J. Fish. Sci. China 21, 1020e1028.
N. Song et al. / Biochemical Systematics and Ecology 68 (2016) 230e235
235
Domingues, V.S., Faria, C., Stefanni, S., Santos, R.S., Brito, A., Almada, V.C., 2007. Genetic divergence in the Atlantic-Mediterranean Montagu’ s blenny, Coryphoblennius galerita (Linnaeus 1758) revealed by molecular and morphological characters. Mol. Ecol. 16, 3592e3605. Excoffier, L., Smouse, P.E., Quattro, J.M., 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131, 479e491. Excoffier, L., Laval, G., Schneider, S., 2005. Arlequin version 3.0: an integrated software package for population genetics data analysis. Evol. Bioinforma. 1, 47e50. FAO, 2008. The State of World Fisheries and Aquaculture. Food and Agriculture Organization of the United Nations, Rome. Goodman, D., 2005. Selection equilibrium for hatchery and wild spawning fitness in integrated breeding programs. Can. J. Fish. Aquatic Sci. 62, 374e389. Skaala, F., Hbyheim, B., Glover, K., Dahle, G., 2004. Microsatellite analysis in domesticated and wild Atlantic salmon (Salmo saar L.): allelic diversity and identification of individuals. Aquaculture 240, 131e143. Jonsson, B., Jonsson, N., Hansen, L.P., 1991. Differences in life history and migratory behaviour between wild and hatchery-reared Atlantic salmon in nature. Aquaculture 98, 69e78. Jonsson, B., Jonsson, N., 2006. Cultured Atlantic salmon in nature: a review of their ecology and interaction with wild fish. ICES J. Mar. Sci. 63, 1162e1181. Kohlmann, K., Kersten, P., 1999. Genetic variability of German and foreign common carp (Cyprinus carpio L.) populations. Aquaculture 173, 435e445. Lande, R., 1995. Breeding plans for small populations based on the dynamics of quantitative genetic variance. In: Ballou, D., Gilpin, M., Foose, T.J. (Eds.), Population Management for Survival and Recovery. Columbia University Press, New York, USA, pp. 318e340. Li, S., Wang, H.M., 1995. Fauna Sinica, Osfichthyes, Pleuronectiformes. Science Press, Beijing. Liu, S., Ikeda, M., Fujio, Y., 1997. Genetic features of natural and cultured populations in plaice (Paralichthys olivaceus). Tohoku J. Agric. Res. 47, 85e96. Liu, J.Y., Lun, Z.R., Zhang, J.B., Yang, T.B., 2009. Population genetic structure of striped mullet, Mugil cephalus, along the coast of China, inferred by AFLP fingerprinting. Biochem. Syst. Ecol. 37, 266e274. Lynch, M., 1991. The genetic interpretation of inbreeding depression and outbreeding depression. Evolution 45, 622e629. Masuda, R., Tsukamoto, K., 1998. Stock enhancement in Japan: review and perspective. Bull. Mar. Sci. 62, 337e358. Merril, C.R., Switzer, R.C., Van Keuren, M.L., 1979. Trace polypeptides in cellular extracts and human body fluid detected by two-dimensional electrophoresis and a highly sensitive silver stain. Proc. Natl. Acad. Sci. U. S. A. 76, 4335e4339. Moran, P., 2002. Current conservation genetics: building an ecological approach to the synthesis of molecular and quantitative genetic methods. Ecol. Freshw. Fish 11, 30e55. Mustafa, S., 2003. Stock enhancement and sea ranching: objectives and potential. Rev. Fish Biol. Fish. 13, 141e149. Nei, M., Li, W.H., 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. U. S. A. 76, 5269e5273. Rice, W.R., 1989. Analyzing tables of statistical tests. Evolution 43, 223e225. Sekino, M., Hara, M., Taniguchi, N., 2002. Loss of microsatellite and mitochondrial DNA variability in hatchery strains of Japanese flounder Paralichthys olivaceus. Aquaculture 213, 101e122. Song, N., Zhang, X.M., Gao, T.X., Yanagimoto, T., 2011. Genetic variability in eight cultured and two wild populations of Japanese Flounder, Paralichthys olivaceus, based on the mitochondrial DNA control region. J. World Aquac. Society 42, 512e520. Song, N., Zhang, X.M., Gao, T.X., 2010. Genetic diversity and population structure of spottedtail goby (Synechogobius ommaturus) based on AFLP analysis. Biochem. Syst. Ecol. 38, 1089e1095. Tomiyama, T., Watanabe, M., Fujita, T., 2008. Community-based stock enhancement and risheries management of the Japanese flounder in Fukushima, Japan. Rev. Fish. Sci. 16, 146e153. Vos, P., Hogers, R., Bleeker, M., Reijans, M., Van De Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M., Zabeau, M., 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23, 4407e4414. Wang, Z.Y., Jayasankar, P., Khoo, S.K., 2000. AFLP fingerprinting reveals genetic variability in common carp stocks from Indonesia. Asian Fish. Sci. 13, 139e147. Wang, Z.Y., Wang, Y.L., Lin, L., Khoo, S.K., Okamoto, N., 2002. Genetic polymorphisms in wild and cultured large yellow croaker Pseudosciaena crocea using AFLP fingerprinting. J. Fish. Sci. China 9, 198e202 (In Chinese with an English abstract). Wang, W., Chen, L., Yang, P., Hou, L., He, C., Gu, Z., Liu, Z., 2007. Assessing genetic diversity of populations of top mouth culter (Culter alburnus) in China using AFLP markers. Biochem. Syst. Ecol. 35, 662e669. Waples, R.S., Drake, J., 2004. Risk/benefit considerations for marine stock enhancement: a Pacific salmon perspective. In: Leber, K.M., Kitada, S., Blankenship, H.L., Sva sand, T. (Eds.), Stock Enhancement and Sea Ranching: Developments, Pitfalls, and Opportunities. Blackwell Publishing, Oxford, England, pp. 260e306. Waples, R.S., Do, Chi, 1994. Genetic risk associated with supplementation of Pacific salmonids: captive broodstock programs. Can. J. Fish. Aquatic Sci. 51, 310e329. Xu, X.F., Zhang, Q.Q., Wang, Z.G., Zhang, Z.F., Bao, Z.M., Heisuke, N., 2006. Assessing genetic diversity of wild populations of Japanese flounder using AFLP markers. Acta Oceanol. Sin. 25, 82e89. Yoshida, K., Takagi, M., Taniguchi, N., 2000. Genetic variability and divergence of wild and artificially raised Japanese flounder Paralichthys olivaceus inferred from microsatellite analysis. Fish Genet. Breed Sci. 29, 93e102 (in Japanese). You, F., Wang, K.L., Xiang, J.H., Xu, C., 2001. Comparative analysis of biochemical genetic structure and variance between natural and cultured stocks on the left-eyed flounder. Paralichthys olivaceus off Shandong Coast. waters. Oceanol. Limnologia Sinica 32, 513e518 (In Chinese with an English abstract). Zhang, Q.Q., Xu, X.F., Qi, J., Wang, X.L., Bao, Z.M., 2004. The genetic diversity of wild and farmed Japanese flounder populations. Period. Ocean Univ. China 34, 816e820 (In Chinese with an English abstract).
Contents lists available at ScienceDirect
Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco
Genetic differentiation between cultured and wild populations of Paralichthys olivaceus based on AFLP markers Na Song a, Xiumei Zhang a, Zhiqiang Han b, Tianxiang Gao b, * a b
Fisheries College, Ocean University of China, Qingdao 266003, China Fishery College, Zhejiang Ocean University, Zhoushan 316022, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 May 2016 Received in revised form 23 July 2016 Accepted 30 July 2016 Available online 9 August 2016
Paralichthys olivaceus is a warm-temperature benthic species distributed in the western Pacific Ocean from the Kuril Islands, Japan to the South China Sea. In the present study AFLP (amplified fragment length polymorphism) marker was employed to examine the genetic differences between cultured and wild populations of P. olivaceus. The results showed that the gene diversity and Shannon's information index of cultured populations (h ¼ 0.130e0.150; I ¼ 0.201e0.236) were similar with wild populations (h ¼ 0.123e0.136; I ¼ 0.199e0.220). Pairwise Fst and AMOVA revealed significant genetic differentiation among them, indicating cultured populations exhibited distinctive heterogeneity with wild populations. The results of present study suggested that broods of this study should not be released into natural sea areas due to its genetic alterations. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Paralichthys olivaceus AFLP Genetic differentiation Cultured population Wild population
1. Introduction Japanese flounder, Paralichthys olivaceus, is a benthic and economical flatfish in the family Bothidae, which distributes throughout the western Pacific Ocean from the Kuril Islands, Japan to the South China Sea (Li and Wang, 1995; Masuda and Tsukamoto, 1998). This species is endemic to the western Pacific Ocean, and is the most common flatfish species raised in China, Japan and Korea due to its rapid growth, delicious quality and good adaptability. With the heavy exploitation of the fishery resource, market landings of P. olivaceus began to decline since 1970 s, while the aquaculture productions have shown a trend of sustained growth since 1980 s, exceeding fishing productions (FAO, 2008). In order to protect and recover the natural population of P. olivaceus, more and more cultured individuals has been released into sea areas (Tomiyama et al., 2008). In Shandong Province of China, the number of released individuals varied from less than 200,000 individuals at 2005 to more than 18,000,000 individuals at 2014. Some studies have proved that hatchery-reared individuals may have a negative effect on the variability of recipient wild populations (Goodman, 2005; Jonsson and Jonsson, 2006). Hatchery-reared individuals may compete for food, space with native, and even spread parasites and diseases (Jonsson et al., 1991; Bakke et al., 1990; Jonsson and Jonsson, 2006). When hatchery-reared broods are released into nature, their genetic effect on wild populations has also attracted great attention. Reduced genetic diversity of cultured fish has been reported (Kohlmann and Kersten, 1999; Skaala et al., 2004), which can cause a reduction in fitness because mean phenotypes could be shifted by inbreeding (Lynch, 1991). When these hatcheryreared individuals are released into natural waters, they may change the genetic variability of recipient populations
* Corresponding author. E-mail address: [email protected] (T. Gao). http://dx.doi.org/10.1016/j.bse.2016.07.025 0305-1978/© 2016 Elsevier Ltd. All rights reserved.
N. Song et al. / Biochemical Systematics and Ecology 68 (2016) 230e235
231
through reproduction behavior (Bert et al., 2007). So, it is very important to monitor the genetic diversity of released broods to avoid the genetic alteration of recipient wild populations. Until now various molecular markers have been successfully applied to survey genetic influence of stock enhancement. For example, Araki et al. (2007) found that even a few generations of domestication may have negative effects on natural reproduction in the wild by reconstructing a three-generation pedigree with microsatellite markers and the results suggested that the repeated use of captive-reared parents to supplement wild populations should be carefully reconsidered. Comparative studies on the genetic differences of Paralichthys olivaceus between cultured and wild population have been conducted by different molecular markers until now. The screening of genetic variations by earlier allozyme markers revealed significant genetic differentiation between wild and cultured-released populations but no reduced genetic diversity were obtained (Liu et al., 1997). However, recent analysis by allozyme markers, mitochondrial DNA and microsatellite DNA have detected obvious reduced genetic diversity of cultured P. olivaceus (Yoshida et al., 2000; You et al., 2001; Sekino et al., 2002). Amplified fragment length polymorphism (AFLP) analysis is a PCR-based, muti-locus fingerprinting technique that combines the strengths and overcomes the weaknesses of the RFLP and RAPD methods (Vos et al., 1995). It is an effective molecular maker and widely used to study interspecific genetic diversity because it allows fast and efficient generation of a large amount of genetic data (Wang et al., 2000; Liu et al., 2009). It also has been employed to detect loss of the genetic diversity in cultured populations of various fish species, (Wang et al., 2002). Xu et al. (2006) evaluated the genetic diversity of four wild geographical populations of Japanese flounder by AFLP marker and a certain extent of differentiation among them was detected. Moreover, Zhang et al. (2004) found smaller number of total loci for cultured populations and no genetic differentiation between wild and farmed populations by AFLP marker. In the present study, two wild and four cultured populations were collected from Chinese coastal waters to examine the present population genetic diversity and variability of P. olivaceus. The results of the present study will reveal the genetic structure and diversity of this economically important species and provide vital information for sustainable exploitation, aquaculture and management of its natural populations.
2. Material and methods 2.1. Fish samples Two wild populations (Qw and Ww) were collected from nature waters and four cultured populations were collected from hatchery during December 2007 to April 2009. Moreover, one cultured population Rc was obtained from random sampling of cultured stock for releasing in Rongcheng at May 2008 (Fig. 1 Table 1). All individuals were identified based on morphological characteristics, and a piece of muscle tissue was obtained from each individual and preserved in 95% ethanol or directly extracted from frozen samples.
Fig. 1. Map showing sample locations of P. olivaceus. Dl: Dalian, Zs: Zhoushan, Rc: Rongcheng, Rz: Rizhao, Ww: Weihai, Qw: Qingdao.
232
N. Song et al. / Biochemical Systematics and Ecology 68 (2016) 230e235
Table 1 Sampling sites, date of collection and sample size of P. olivaceus in the present study and several genetic diversity indices. ID
Sampling site
Sample size
Date of collection
Number of loci
Number of polymorphic loci
Proportion of polymorphic loci
Nei's gene diversity
Dl Zs Rc Rz Ww Qw Total
Dalian, Liaoning Province Zhoushan, Zhejiang Province Rongcheng, Shandong Province Rizhao, Shandong Province Weihai, Shandong Province Qingdao, Shandong Province y
14 16 16 13 17 12 88
2008.10 2008.09 2008.05 2007.12 2008.12 2009.04 y
233 246 249 221 258 237 304
115 138 130 102 152 123 208
49.36% 56.10% 52.21% 46.15% 58.91% 51.90% 68.42%
0.211 0.236 0.210 0.201 0.220 0.199 0.221
± ± ± ± ± ± ±
0.251 0.253 0.245 0.259 0.236 0.234 0.232
Shannon's information index 1.494 1.561 1.522 1.462 1.589 1.519 1.684
± ± ± ± ± ± ±
0.501 0.497 0.501 0.500 0.493 0.501 0.466
2.2. Genomic DNA extraction and AFLP method Genomic DNA was isolated from muscle tissue by proteinase K digestion followed by a standard phenolechloroform method. We conducted procedures of AFLP according to methods by Vos et al. (1995) and Wang et al. (2000). All the PCR products were run on 6.0% denaturing polyacrylamide gel electrophoresis (PAGE) for 2.5 h at 50 C on the Sequi-Gen GT Sequencing Cell (Bio-Rad, USA), and finally detected using the silver staining technique modified from Merril et al. (1979). Sequences of AFLP adapters, primers, and four selective primer combinations (EAAC-MCTA, EAGA-MCAA, EAGA- MCTA and EAAC-MCTC) used in the present study are listed in Table 2. 2.3. Data analysis All clear and unambiguous AFLP bands were scored for presence (1) or absence (0), and transformed into 0/1 binary character matrix in Microsoft Office Excel. Percentages of polymorphic loci, Nei's genetic diversity and Shannon diversity index were calculated by POPGENE Version 1.32. Similarity indices among individuals were calculated according to the formula S ¼ 2Nab/(Na þ Nb) (Nei and Li, 1979), where Na and Nb are the number of bands in individual a and b respectively, and Nab is the number of shared bands. Genetic distances were computed using the formula D ¼ -ln S (Nei and Li, 1979). ARLEQUIN version 3.0 was used to calculate pairwise fixation index Fst between pairs of population samples and the significance of the Fst was tested by 10,000 permutations for each pairwise comparison (Excoffier et al., 2005). When multiple comparisons were performed, P values were adjusted using the sequential Bonferroni procedure (Rice, 1989). To further examine hierarchical population structure as well as the geographical pattern of population subdivision, we used analysis of molecular variance (AMOVA) (Excoffier et al., 1992). 3. Results All clear and unambiguous bands were plotted in the Microsoft Office Excel. A total of 304 bands were identified by 4 selective primer combinations for 88 individuals, of which 208 loci were polymorphic loci (Table 1). The number of bands generated for each primer combinations varied from 54 to 101, and percentage of polymorphic loci varied from 59.04% to 77.27%, respectively (Table 3). The primer combination EAGA/MCTA generated the most bands and the percentage of polymorphic loci of EAAC/MCTC was the highest. For 6 populations, the number of generated bands ranged from 221 to 258, and percentage of polymorphic loci for each population ranged from 46.15% to 58.91%, respectively. The wild population Ww obtained the most loci and percentage of polymorphic loci. The results exhibited that no obvious differences for genetic diversity were obtained. Assuming HardyeWeinberg equilibrium, population Zs showed highest Nei's genetic diversity
Table 2 Adapter and primer combinations sequences used in the study. Sequence (50 d30 )
Primer Adapter
Pre-amplification primer Selective amplification primer
EcoRI-1 adapter EcoRI-2 adapter MseI-1 adapter MseI-2 adapter EcoRI MseI EAAC-MCTA EAGA-MCAA EAGA- MCTA EAAC-MCTC
CTCGTAGACTGCGTACC AATTGGTACGCAGTCTAC GACGTGAGTCCTGAG TACTCAGGACTCATGACTGCGTACCAATTC GATGAGTCCTGAGTAA GACTGCGTACCAATTCAAC GATGAGTCCTGAGTAACTA -GACTGCGTACCAATTCAGA -GATGAGTCCTGAGTAACAA GACTGCGTACCAATTCAGA GATGAGTCCTGAGTAACTA GACTGCGTACCAATTCAAC GATGAGTCCTGAGTAACTC0
N. Song et al. / Biochemical Systematics and Ecology 68 (2016) 230e235
233
Table 3 Number of bands generated by four primer combinations. Primers
EAAC/MCTA
EAGA/MCAA
EAGA/MCTA
EAAC/MCTC
Number of loci Number of polymorphic loci Proportion of polymorphic loci
54 34 62.96%
83 49 59.04%
101 76 75.25%
66 51 77.27%
(0.236 ± 0.253) and population Qw showed highest Shannon’ s information index (1.589 ± 0.493), while the wild population Qw showed the lowest Nei's genetic diversity (0.199 ± 0.234) and population Rz showed lowest Shannon’ s information index (1.462 ± 0.500). We constructed UPGMA tree based on Nei's genetic distance for 88 individuals (Fig. 2). The topology of the UPGMA tree was shallow and all individuals of 6 populations mixed with each other. Some small branches corresponding to different locations were detected, which suggested genetic differences among populations. The results of AMOVA indicated that 86.71% of the genetic variation existed within populations and 13.29% among populations when all six populations were pooled into one group (Table 4). Two groups were defined to do further AMOVA analysis. Four cultured populations were pooled to one group, and two wild populations were pooled to another group. The results showed that genetic variation among groups was only 0.81% and within populations was 86.38%. Most of the pairwise Fst values were high and significant after sequential Bonferroni correction, and pairwise Fst between two wild populations was lowest (Table 5). 4. Discussions Many studies showed that amplified fragment length polymorphism (AFLP) markers were effective to study genetic diversity of many marine fishes (Liu et al., 2009; Chen et al., 2014), and it is also widely used in the genetic comparative analysis
Fig. 2. UPGMA tree of 88 P. olivaceus individuals based on Nei's genetic distance.
Table 4 Results of AMOVA on P. olivaceus Source of variation One gene pool Among populations Within populations Two gene pools Among groups Within groups Within populations
Degrees of freedoms
Sum of squares
Variance components
Percentage of variation
5 82
323.891 1638.745
3.06328 Va 19.98470 Vb
13.29 86.71
1 4 82
71.444 252.447 1638.745
0.18699 Va 2.96383 Vb 19.98470 Vc
0.81 12.81 86.38
One gene pool: all populations were pooled to one group. Two gene pools: population Dl, Zs, Rc and Rz were pooled to form cultured group, and populations Ww and Qw were pooled to form wild group.
234
N. Song et al. / Biochemical Systematics and Ecology 68 (2016) 230e235
Table 5 Pairwise Fst (below diagonal) among six populations of P. olivaceus based on AFLP data.
Dl Zs Rc Rz Ww Qw
Dl
Zs
Rc
RZ
Ww
0.152* 0.110* 0.167* 0.110* 0.169*
0.152* 0.200* 0.152* 0.143*
0.132* 0.079* 0.127*
0.104* 0.152*
0.056*
Qw
*The Fst values are significant after the sequential Bonferroni procedure (P < 0.01).
between wild and cultured populations (Wang et al., 2007). In the present study, four selective amplification primers were used to access the genetic status of P. olivaceus. A total of 304 bands were identified and the percentage of polymorphic loci was 68.42%. Zhang et al. 2004 generated 797 bands by 7 selective amplification primers and the percentage of polymorphic loci was lower than that of the present study. However, the gene diversity and Shannon's information index exhibited no obvious difference for six populations between the wild and cultured populations in this study, which was in contrast with Zhang et al. (2004). Moreover, for the same samples in the present study, Song et al. (2011) detect reduced genetic diversity of cultured population by mitochondrial DNA. It is not surprising because the same situation has been reported in striped mullet (Liu et al., 2009), spottedtail goby (Song et al., 2010). Mitochondrial DNA is haploid, maternally inherited, lack of recombination and has a fourfold lower effective population size (Domingues et al., 2007). Although population Zs had the higher diversity in the present study, its proportion of polymorphic loci was not highest. It is very important to use some more sensitive molecular markers to do further genetic analysis for P. olivaceus. In the present study, high pairwise Fst between wild and cultured populations suggested strong genetic differentiation among them. Cultured populations exhibited different genetic structure, which may be due to isolated farm-propagation. High genetic variation within populations may lead to failure to detect genetic differentiation among groups. In most cases, genetic changes for broods were inevitable because smaller numbers of broodstocks were used in the hatchery, and sometimes they even were used over succeeding generations (Waples and Do, 1994; Bert et al., 2007). Smaller broodstocks may lead to unequal contributions of broodstock individuals to broods and inbreeding in broodstocks (Bert et al., 2007). Genetic drift over generations will accumulate when smaller broodstocks were used in the hatchery, and decrease the fitness of hatchery broods by reducing their genetic variability, changing genetic composition, and increasing genetic load (Calcagnotto and Toledo-Filho, 2000). Compared with genetic differentiation between two wild populations, strong genetic differentiation between cultured and wild populations and among cultured populations suggested genetic alterations of P. olivaceus in these farms. The recipient wild populations may undergo dramatic genetic changes if we released these broods into recipient populations. The released specimens may alter the genetic diversity, decrease the fitness and reduce the effective population size of the mixed populations by some ecological and biological interactions with wild individuals (Bert et al., 2007). Genetic variability is very important for long-term survival of enhanced populations (Lande, 1995), and in the stock enhancement operations maintaining the genetic diversity of broodstocks is the most important for sustainable exploration (Moran, 2002). Actually stock enhancement may not be the best measure for recovering the natural resources because we cannot predict the enhancement effect (Mustafa, 2003), and it should be carried out combined with other protective measures like artificial reefs or habitat conservations (Waples and Drake, 2004). In the present study genetic alterations of cultured populations indicated that we should not release these broods into nature waters. Before we decide to conduct stock enhancement, we must avoid the genetic heterogeneity of broodstocks and its offsprings with recipient populations. Therefore, if we want to recover natural resources and start a stock enhancement program, it is necessary to evaluate the genetic status of P. olivaceus and begin genetic monitoring management. Acknowledgments Thank Prof. Y.P. Ren, Prof. Z.Q. Jiang, Prof. B.N. Shui, and Dr. Q., Liu for collecting the samples. This work was supported by the National Program on Key Basic Research Project (973 Program) (2015CB453302) and the Public Science and Technology Research Funds Projects of Ocean (201405010 and 201305043). References Araki, H., Cooper, B., Blouin, M.S., 2007. Genetic effects of captive breeding cause a rapid, cumulative fitness decline in the wild. Science 318, 100e103. Bakke, T.A., Jansen, P.A., Hansen, L.R., 1990. Differences in the host-resistance of Atlantic salmon, Salmo salar L, stocks to the Monogenean Gyrodactylus salaris Malmberg, 1957. J. Fish Biol. 37, 577e587. Bert, T.M., Crawford, C., Tringali, M.D., Seyoum, S., Galvin, J.L., Higham, M., Lund, C., 2007. Genetic management of hatchery-based stock enhancement. In: Bert, T.M. (Ed.), Ecological and Genetic Implications of Aquaculture Activities. Springer Publications, New York, USA, pp. 123e174. Calcagnotto, D., Toledo-Filho, S.D.A., 2000. Loss of genetic variability at the transferrin locus in five hatchery stocks of tambaqui (Colossoma macropomum). Genet. Mol. Biol. 23, 127e130. Chen, W., Hong, W.S., Chen, S.X., Wang, Q., Zhang, Q.Y., 2014. AFLP analysis of genetic structure of Boleophthalmus pectinirostris populations from the coastal waters of Northwest Pacific. J. Fish. Sci. China 21, 1020e1028.
N. Song et al. / Biochemical Systematics and Ecology 68 (2016) 230e235
235
Domingues, V.S., Faria, C., Stefanni, S., Santos, R.S., Brito, A., Almada, V.C., 2007. Genetic divergence in the Atlantic-Mediterranean Montagu’ s blenny, Coryphoblennius galerita (Linnaeus 1758) revealed by molecular and morphological characters. Mol. Ecol. 16, 3592e3605. Excoffier, L., Smouse, P.E., Quattro, J.M., 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131, 479e491. Excoffier, L., Laval, G., Schneider, S., 2005. Arlequin version 3.0: an integrated software package for population genetics data analysis. Evol. Bioinforma. 1, 47e50. FAO, 2008. The State of World Fisheries and Aquaculture. Food and Agriculture Organization of the United Nations, Rome. Goodman, D., 2005. Selection equilibrium for hatchery and wild spawning fitness in integrated breeding programs. Can. J. Fish. Aquatic Sci. 62, 374e389. Skaala, F., Hbyheim, B., Glover, K., Dahle, G., 2004. Microsatellite analysis in domesticated and wild Atlantic salmon (Salmo saar L.): allelic diversity and identification of individuals. Aquaculture 240, 131e143. Jonsson, B., Jonsson, N., Hansen, L.P., 1991. Differences in life history and migratory behaviour between wild and hatchery-reared Atlantic salmon in nature. Aquaculture 98, 69e78. Jonsson, B., Jonsson, N., 2006. Cultured Atlantic salmon in nature: a review of their ecology and interaction with wild fish. ICES J. Mar. Sci. 63, 1162e1181. Kohlmann, K., Kersten, P., 1999. Genetic variability of German and foreign common carp (Cyprinus carpio L.) populations. Aquaculture 173, 435e445. Lande, R., 1995. Breeding plans for small populations based on the dynamics of quantitative genetic variance. In: Ballou, D., Gilpin, M., Foose, T.J. (Eds.), Population Management for Survival and Recovery. Columbia University Press, New York, USA, pp. 318e340. Li, S., Wang, H.M., 1995. Fauna Sinica, Osfichthyes, Pleuronectiformes. Science Press, Beijing. Liu, S., Ikeda, M., Fujio, Y., 1997. Genetic features of natural and cultured populations in plaice (Paralichthys olivaceus). Tohoku J. Agric. Res. 47, 85e96. Liu, J.Y., Lun, Z.R., Zhang, J.B., Yang, T.B., 2009. Population genetic structure of striped mullet, Mugil cephalus, along the coast of China, inferred by AFLP fingerprinting. Biochem. Syst. Ecol. 37, 266e274. Lynch, M., 1991. The genetic interpretation of inbreeding depression and outbreeding depression. Evolution 45, 622e629. Masuda, R., Tsukamoto, K., 1998. Stock enhancement in Japan: review and perspective. Bull. Mar. Sci. 62, 337e358. Merril, C.R., Switzer, R.C., Van Keuren, M.L., 1979. Trace polypeptides in cellular extracts and human body fluid detected by two-dimensional electrophoresis and a highly sensitive silver stain. Proc. Natl. Acad. Sci. U. S. A. 76, 4335e4339. Moran, P., 2002. Current conservation genetics: building an ecological approach to the synthesis of molecular and quantitative genetic methods. Ecol. Freshw. Fish 11, 30e55. Mustafa, S., 2003. Stock enhancement and sea ranching: objectives and potential. Rev. Fish Biol. Fish. 13, 141e149. Nei, M., Li, W.H., 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. U. S. A. 76, 5269e5273. Rice, W.R., 1989. Analyzing tables of statistical tests. Evolution 43, 223e225. Sekino, M., Hara, M., Taniguchi, N., 2002. Loss of microsatellite and mitochondrial DNA variability in hatchery strains of Japanese flounder Paralichthys olivaceus. Aquaculture 213, 101e122. Song, N., Zhang, X.M., Gao, T.X., Yanagimoto, T., 2011. Genetic variability in eight cultured and two wild populations of Japanese Flounder, Paralichthys olivaceus, based on the mitochondrial DNA control region. J. World Aquac. Society 42, 512e520. Song, N., Zhang, X.M., Gao, T.X., 2010. Genetic diversity and population structure of spottedtail goby (Synechogobius ommaturus) based on AFLP analysis. Biochem. Syst. Ecol. 38, 1089e1095. Tomiyama, T., Watanabe, M., Fujita, T., 2008. Community-based stock enhancement and risheries management of the Japanese flounder in Fukushima, Japan. Rev. Fish. Sci. 16, 146e153. Vos, P., Hogers, R., Bleeker, M., Reijans, M., Van De Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M., Zabeau, M., 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23, 4407e4414. Wang, Z.Y., Jayasankar, P., Khoo, S.K., 2000. AFLP fingerprinting reveals genetic variability in common carp stocks from Indonesia. Asian Fish. Sci. 13, 139e147. Wang, Z.Y., Wang, Y.L., Lin, L., Khoo, S.K., Okamoto, N., 2002. Genetic polymorphisms in wild and cultured large yellow croaker Pseudosciaena crocea using AFLP fingerprinting. J. Fish. Sci. China 9, 198e202 (In Chinese with an English abstract). Wang, W., Chen, L., Yang, P., Hou, L., He, C., Gu, Z., Liu, Z., 2007. Assessing genetic diversity of populations of top mouth culter (Culter alburnus) in China using AFLP markers. Biochem. Syst. Ecol. 35, 662e669. Waples, R.S., Drake, J., 2004. Risk/benefit considerations for marine stock enhancement: a Pacific salmon perspective. In: Leber, K.M., Kitada, S., Blankenship, H.L., Sva sand, T. (Eds.), Stock Enhancement and Sea Ranching: Developments, Pitfalls, and Opportunities. Blackwell Publishing, Oxford, England, pp. 260e306. Waples, R.S., Do, Chi, 1994. Genetic risk associated with supplementation of Pacific salmonids: captive broodstock programs. Can. J. Fish. Aquatic Sci. 51, 310e329. Xu, X.F., Zhang, Q.Q., Wang, Z.G., Zhang, Z.F., Bao, Z.M., Heisuke, N., 2006. Assessing genetic diversity of wild populations of Japanese flounder using AFLP markers. Acta Oceanol. Sin. 25, 82e89. Yoshida, K., Takagi, M., Taniguchi, N., 2000. Genetic variability and divergence of wild and artificially raised Japanese flounder Paralichthys olivaceus inferred from microsatellite analysis. Fish Genet. Breed Sci. 29, 93e102 (in Japanese). You, F., Wang, K.L., Xiang, J.H., Xu, C., 2001. Comparative analysis of biochemical genetic structure and variance between natural and cultured stocks on the left-eyed flounder. Paralichthys olivaceus off Shandong Coast. waters. Oceanol. Limnologia Sinica 32, 513e518 (In Chinese with an English abstract). Zhang, Q.Q., Xu, X.F., Qi, J., Wang, X.L., Bao, Z.M., 2004. The genetic diversity of wild and farmed Japanese flounder populations. Period. Ocean Univ. China 34, 816e820 (In Chinese with an English abstract).