- Email: [email protected]
Genetic diversity and clonal evolution of carbapenem-resistant Acinetobacter baumannii isolates from Portugal and the dissemination of ST118
International Journal of Antimicrobial Agents 40 (2012) 398–403
Contents lists available at SciVerse ScienceDirect
International Journal of Antimicrobial Agents journal homepage: http://www.elsevier.com/locate/ijantimicag
Genetic diversity and clonal evolution of carbapenem-resistant Acinetobacter baumannii isolates from Portugal and the dissemination of ST118 V. Manageiro , D. Jones-Dias , E. Ferreira , D. Louro , Antimicrobial Resistance Surveillance Program in Portugal, M. Canic¸a ∗ National Reference Laboratory of Antimicrobial Resistances, Department of Infectious Diseases, National Institute of Health Dr Ricardo Jorge, Av. Padre Cruz, 1649-016 Lisbon, Portugal
a r t i c l e
i n f o
Article history: Received 7 March 2012 Accepted 11 June 2012 Keywords: OXA-23 OXA-24 ST118 Switching ISAba1 XDR
a b s t r a c t In this study, 116 multidrug-resistant Acinetobacter baumannii (MDR-Ab) isolates recovered in various regions of Portugal were studied. All isolates were non-susceptible to tigecycline; one isolate was also non-susceptible to colistin, making it a step closer to pandrug resistance. Among 72 isolates tested by PFGE, 98.6% carried blaOXA-66 , 1.4% blaOXA-104 , 77.8% blaOXA-23 , 23.6% blaOXA-24 , 18.1% blaTEM-1 and 1.4% blaCTX-M-15-like genes. No OXA-58 or metallo--lactamase-encoding genes were detected. ISAba1 was found in 58/72 isolates (80.6%). Among these, ISAba1 was found upstream of blaOXA-51-like in 54 isolates. All but two of these isolates also carried ISAba1–blaOXA-23 , highlighting the coexistence of ISAba1–blaOXA-51-like and ISAba1–blaOXA-23 genetic platforms, emphasising the importance of mobile genetic elements in the dissemination of carbapenem-hydrolysing class D -lactamase genes. Tn2006-like and Tn2008-like, found within ST92 and ST118, may reflect either multiple genetic structures in the origin of blaOXA-23 acquisition or interclonal complex evolution. These results indicate that there may exist different genetic origins for carbapenem resistance among MDR-Ab isolates. Six PFGE profiles were associated with three major sequence types, with ST118 (OXA-23- or OXA-24-producer) being widely disseminated since 2009. ST98 (described so far as endemic in Portugal) and ST92 (which co-existed with ST98 before 2009) appeared to have been gradually replaced by ST118. The new ST188 (OXA-104-producer) was detected for the first time in this country. Identification of an extensively drug-resistant ST118 and carbapenemresistant ST92, ST98 and ST118 isolates, both in community and healthcare facilities, demonstrates the menace of A. baumannii-associated infections. © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
1. Introduction Acinetobacter baumannii is a ubiquitous pathogen responsible for asymptomatic colonisation as well as both community and healthcare-associated infections [1,2], being naturally resistant to aminopenicillins, amoxicillin/clavulanic acid, cefazolin, cefotaxime, ceftriaxone, ertapenem, trimethoprim and fosfomycin [3]. A. baumannii isolates are also reported worldwide as the cause of several nosocomial outbreaks with considerable clinical and economic costs [1]. Extensive use of antimicrobial chemotherapy, particularly carbapenems, has contributed to the appearance of carbapenem-hydrolysing class D -lactamases (CHDLs) and further emergence of multidrug-resistant A. baumannii (MDR-Ab) isolates [4]. These enzymes include the acquired OXA-23, OXA-24 (alternate names OXA-40 and OXA-33) and OXA-58 as well as intrinsic OXA51 -lactamases [5,6]. Noteworthy, the genetic region upstream
∗ Corresponding author. Tel.: +351 21 751 9246; fax: +351 21 751 9246. E-mail address: [email protected] (M. Canic¸a).
of CHDLs frequently includes the insertion sequence (IS) ISAba1, which has been shown to provide promoter sequences that enhance the expression of these genes [7–9]. In this study, we report an evaluation of CHDL-producing A. baumannii isolates collected from various regions of Portugal as well as the connection between their susceptibility and genetic profile.
2. Materials and methods 2.1. Bacterial strain collection This study included 116 non-repetitive clinical A. baumannii isolates collected consecutively between April 2009 and April 2010 in nine Portuguese hospitals from four different geographic regions (each with between 100 and 743 beds), belonging to the Antibiotic Resistance Surveillance Program in Portugal (ARSIP). All isolates for the study were identified in the respective hospital laboratories as carbapenem-non-susceptible A. baumannii by different systems (ATB G-5, VITEK 1, VITEK 2 and Phoenix) and were then sent to the National Institute of Health in Lisbon (Portugal).
0924-8579/$ – see front matter © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. http://dx.doi.org/10.1016/j.ijantimicag.2012.06.013
V. Manageiro et al. / International Journal of Antimicrobial Agents 40 (2012) 398–403
399
2.2. Antimicrobial susceptibility testing
2.6. Identification of PCR-based sequence groups
Antimicrobial susceptibility of all clinical isolates was analysed by the disk diffusion method and the results were interpreted according to the clinical breakpoints (2010 recommendations) of the Antibiogram Committee of the French Society for Microbiology (CA-SFM) (http://www.sfm-microbiologie.org/). Among all the isolates, 20 isolates representative of each pulsed-field gel electrophoresis (PFGE) profile and hospital (Fig. 1) and subjected to multilocus sequence typing (MLST) were also evaluated for carbapenem susceptibility through broth microdilution and for tigecycline and colistin susceptibility through Etest (bioMérieux, Marcy l’Étoile, France). These results were interpreted according to European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoints v.2.0 (http://www.eucast.org/clinical breakpoints/). Since EUCAST still considers there is insufficient evidence to establish tigecycline breakpoints for Acinetobacter spp., the EUCAST non-species-specific minimum inhibitory concentration (MIC) breakpoints (susceptible, ≤0.25 mg/L, resistant, >0.5 mg/L) were applied to interpret susceptibility to this antibiotic. Isolates were scored as MDR or extensively drug-resistant bacteria according to recently proposed standardised international terminology [10].
Clonal lineages of the 20 MDR-Ab isolates were determined by a multiplex PCR designed to selectively amplify group 1 or group 2 alleles of the ompA, csuE and blaOXA-51-like genes as previously described [15].
2.3. PCR amplification and gene sequencing All isolates were subjected to a species confirmatory identification assay that was achieved through amplification of the blaOXA-51-like gene as previously described [11]. PCR and sequencing were used to detect and identify genes coding for CHDLs (blaOXA-23 , blaOXA-24 , blaOXA-51 and blaOXA-58 ) and class B metallo--lactamases (MBLs) (blaIMP , blaVIM and blaNDM ) among 72 isolates tested by PFGE. The presence of class A -lactamase-encoding genes (blaTEM , blaSHV and blaCTX-M ) was also investigated as previously described [12]. All PCR products were purified with ExoSAP-IT (USB Corp., Cleveland, OH) and were sequenced directly on both strands using an ABI3100 Automatic Sequencer (Applied Biosystems, Warrington, UK). PCR mapping experiments using combinations of ISAba1 with blaOXA-23- , blaOXA-24- and blaOXA-51-like primers were used to detect the genetic association between the insertion sequence and CHDLencoding genes (Table 1). 2.4. Pulsed-field gel electrophoresis analysis The genetic relatedness of 72 isolates representative of the different hospitals and years was investigated through a modified PFGE protocol [12] using ApaI to digest A. baumannii genomic DNA [13]. BioNumerics v.3.5 (Applied Maths, Sint-Martens-Latem, Belgium) was used for cluster analysis. Dice coefficients and the unweighted pair-group method (UPGMA) with the arithmetic averages clustering method were used for grouping analysis. Isolates with a Dice band-based similarity coefficient value of ≥80% were considered to belong to the same cluster. 2.5. Multilocus sequence typing analysis To compare single nucleotide polymorphisms with the wholegenome profile provided by PFGE, MLST was conducted on a set of 20 isolates representative of each PFGE profile and hospital. This analysis was performed through the identification of seven housekeeping genes (gltA, gyrB, gdhB, recA, cpn60, gpi and rpoD) as described previously [14]. The resulting sequences were analysed using BioNumerics v.3.5 software and were assigned to sequence types (STs) using the tools on the A. baumannii MLST webpage (http://pubmlst.org/abaumannii/).
2.7. Nucleotide sequence accession number The sequence of the blaOXA-104 -lactamase gene was submitted to the EMBL Nucleotide Sequence Database under accession no. FR667694. 3. Results and discussion Overall, 116 A. baumannii isolates were mainly from urine (39.7%), sputum (24.1%) and blood (11.2%), from male patients (55.2%) aged ≥65 years (69.0%), and from patients hospitalised in internal medicine services (44.1%), Intensive Care Units (11.2%) and surgery (11.2%). Seventeen of the isolates were identified as the cause of community-acquired infections according to US Centers for Disease Control and Prevention (CDC) definitions [16], the majority of which were from elderly patients (≥65 years old), admitted at the emergency room, and without information about previous hospitalisations. Disk diffusion testing indicated that all isolates were MDR and confirmed non-susceptibility to carbapenems (Table 2). In this study, after evaluation by the Etest method, tigecycline had reduced in vitro activity against MDR-Ab bacteria, with MICs between 1 mg/L and 128 mg/L (Fig. 1), as observed by others [17,18]. Use of Etest revealed that one isolate (INSRA9855) was non-susceptible to colistin (Fig. 1), which is of great concern considering the lack of treatment options to deal with MDR-Ab infections [19]. Following PCR and sequencing, all isolates were identified as carrying the blaOXA-51-like gene, specifically blaOXA-66 (98.6%) and blaOXA-104 (1.4%) (Fig. 1). Among these isolates, 56/72 (77.8%) carried blaOXA-23 , 17/72 (23.6%) blaOXA-24 , 13/72 (18.1%) blaTEM-1F and 1/72 (1.4%) blaCTX-M-15-like genes; none carried OXA-58 or MBLencoding genes. PFGE analysis revealed six profiles: 71 related (≥80% similarity) or indistinguishable (100% homology) MDR-Ab clones were grouped into five different clusters (I–V) and 1 MDR-Ab was genetically unrelated to the others (Fig. 1). All isolates, with the exception of the MDR-Ab with a unique PFGE profile, revealed a similarity coefficient value of ≥75%, which makes them epidemiologically very closely related. Those groups were correlated with CHDL production, carbapenem susceptibility profile, and with four distinct STs: ST92 (allelic profile 1-3-3-2-2-7-3); ST98 (allelic profile 112-3-2-2-3-3); ST118 (allelic profile 1-3-3-2-2-3-3); and the novel ST188 (allelic profile 31-33-67-40-16-58-7). Currently, two Acinetobacter MLST schemes are available for typing of A. baumannii strains, namely the Bartual scheme (http://pubmlst.org/abaumannii/) and the Pasteur scheme (http://www.pasteur.fr/mlst/Abaumannii.html). The two schemes have generally shown compatible results although a recent study has reported a higher resolution of the Bartual MLST scheme providing a better association between epidemiological features, occurrence of acquired OXA genes, and temporal distribution of the isolates [17]. In this study, genotype analysis together with identification of CHDL-encoding genes led to the detection of three major STs contributing to the high prevalence of carbapenem-resistant MDR-Ab in Portugal: ST92 (OXA-23-producer, mostly associated with TEM expression); and ST98 (OXA-24-producer); and ST118 (OXA-23- or OXA-24-producer, associated with CTX-M-15 in one isolate). ST98
400
V. Manageiro et al. / International Journal of Antimicrobial Agents 40 (2012) 398–403
Fig. 1. Pulsed-field gel electrophoresis (PFGE) dendrogram and genetic relatedness of 72 Acinetobacter baumannii isolates. Strain code, hospital code, region, ward, biological product, year of isolation, antibiotic susceptibility [by minimum inhibitory concentration (MIC)], detected -lactamases, genetic association between insertion sequence ISAba1 and carbapenem-hydrolysing class D -lactamase (CHDL)-encoding genes, multilocus sequence typing (MLST) and PFGE profile types (from 0001 to 0005 were defined as forming clusters I–V, respectively) are also shown. TEM, CTX-M, CHDLs and the presence of ISAba1 are indicated by black circles; a double black circle indicates the presence of two copies of ISAba1. Hospital ward: CA, community-acquired; ICU, Intensive Care Unit; IM, internal medicine; OP, ophthalmology; OT, orthopaedy; PN, pneumology; SUR, surgery; SURV, surgery vascular; Unk, unknown. Biological product: ba, bronchial aspirate; bl, blood; bs, bronchial secretion; ct, catheter; pe, purulent exudate; sp, sputum; ta, tracheal aspirate; ur, urine; w, wound. Antibiotics: I, imipenem; M, meropenem; T, tigecycline; C, colistin.
V. Manageiro et al. / International Journal of Antimicrobial Agents 40 (2012) 398–403
401
Table 1 Primers used for PCR amplification and sequencing of bla genes and the insertion sequence ISAba1 genetic region. Gene
Primer sequences
blaOXA-51-like blaOXA-23-like blaOXA-24-like blaOXA-58-like blaOXA-51-like blaOXA-23 blaOXA-24 blaIMP blaVIM blaNDM ISAba1b a b
Tannealing (◦ C)
PCR product (bp)/methoda
56 56 56 56 52 52 52 56 55 58 50
671/M-PCR 220/M-PCR 645/M-PCR 591/M-PCR 874/Seq. 847/Seq. 873/Seq. 133/PCR + Seq. 556/PCR + Seq. 359/PCR + Seq. variable/PCR + Seq.
Forward (5 → 3 )
Reverse (5 → 3 )
TTTATTTCAGCCTGCTCAC GATCGGATTGGAGAACCAG GATGAAGCTCAAACACAGG AAACCCACATACCAACCC CTCAAGTTACATTAATTAGC TTATTTTCTATTGATCTGGTG AATATTATACTCTAAGCCCC TCGTTTGAAGAAGTTAACGG GTTTGGTCGCATATCGCAAC GTTTGATCGTCAGGGATGGC CACGAATGCAGAAGTTG
TGAACAACCCATCCAGTTAACC CTGCTGTCCAATTTCAG ACGAATAGAACCAGACATTCC CGATCAGAATGTTCAAGC CTATAAAATACCTAATTGTTC AAATAATATTCAGCTGTTTTAATG TAAATGATTCCAAGATTTTCTAG CCACAAACCAAGTGACTAACT GGAATGACGAACTGTGCTTC AACGGTGATATTGTCACTGGT GTGTCATAGTATTCGTCG
Method used for screening and/or identification of genes: M-PCR, multiplex PCR; Seq., sequencing; PCR + Seq., PCR and sequencing. Primers from reference [7].
and ST92 are both single-locus variants of ST118, and all three belong to the same clonal complex, sharing a common ancestor [20–22]. Indeed, multiplex PCR for identification of clonal lineages revealed that all isolates belonged to international clone (IC) II, one of the three international clones of A. baumannii (IC I, II and III, previously designated European clones I, II and III, respectively) associated with multidrug resistance [23]. Although ST98 (described so far as endemic in Portugal) and ST92 were already present in the country before 2009 [17], epidemic ST118 was here detected at a national level for the first time, suggesting replacement of the pre-existing clones. This switch might be due to two independent phenomena: (i) importation of ST118 from other European countries [21,24] and subsequent acquisition of different resistance genes (blaOXA-24 or blaOXA-23 ); or (ii) evolution from the related OXA23-producing ST92 or OXA-24-producing ST98 (belonging to the same clonal complex), both cases followed by posterior spread. The geographic distance between continental and Autonomous Portuguese regions may be an explanation for both evolutionary processes.
In this study, ST118 and ST92 OXA-23 producers, already described in different continents [21,24,25], were the most successfully disseminated among healthcare facilities, suggesting clonal expansion of both lineages: ST118 was identified in all but one hospital and ST92 in all but two. Worryingly, Portugal may have features that favour the rapid adaptation of both STs in hospital settings. We were also able to identify two different epidemic local clones in hospitals G and E that constitute examples of such adaptation: OXA-24-producing ST118 (cluster IV) and OXA-23-producing ST118 (cluster V), respectively. The blaOXA-104 gene, a blaOXA-51-like gene, identified in a ST188 MDR-Ab that also harboured blaOXA-24 gene, carried 182 synonymous mutations compared with the first blaOXA-104 gene ever described [26]; molecular evolution of the blaOXA-104 gene suggests an adaptation of MDR-Ab to the selective pressure imposed by the clinical use of carbapenems. Interestingly, as shown in Figs. 1 and 2, we were able to find different genetic structures within the main single clone lineages of the study (ST92 and ST118). Briefly, ISAba1 was found in 58/72 MDR-Ab isolates (80.6%). Among these, ISAba1 was found upstream
Table 2 Antibiotic susceptibility as assessed by disk diffusion tests of 116 Acinetobacter baumannii isolates collected in Portuguese hospitals. Antimicrobial agent
Amoxicillin/clavulanic acid Ticarcillinb Piperacillinb Piperacillin/tazobactamb Cefoxitin Cefpodoxime Ceftazidimeb Cefotaxime Ceftriaxone Cefixime Aztreonam Cefepime Imipenemb Meropenem Ciprofloxacinb Norfloxacin Pefloxacin Kanamycin Gentamicinb Amikacinb Trimethoprim/sulfamethoxazoleb
Breakpoints (mm)a
Susceptibility of isolates (n = 116) No. (%) R
No. (%) IR
S
R
116 (100) 116 (100) 115 (99.1) 115 (99.1) 116 (100) 116 (100) 115 (99.1) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 115 (99.1) 116 (100) 116 (100) 116 (100) 66 (56.9) 69 (59.5) 50 (43.1) 116 (100)
116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 66 (56.9) 69 (59.5) 57 (49.1) 116 (100)
≥23 ≥22 ≥18 ≥19 ≥22 ≥24 ≥21 ≥26 ≥26 ≥25 ≥23 ≥21 ≥24 ≥22 ≥22 ≥25 ≥22 ≥17 ≥16 ≥17 ≥16
<16 <18 <12 <14 <15 <21 <19 <23 <23 <22 <21 <19 <17 <15 <22 <22 <16 <15 <16 <15 <13
R, resistant; IR, non-susceptible; S, sensitive. a Susceptibility scored according to the Antibiogram Committee of the French Society for Microbiology (CA-SFM) 2010 guidelines. b Antibiotics used in the therapy of multidrug-resistant A. baumannii infections [10], according to clinical indications and prevalence of acquired resistance. All other antibiotics constitute a supplementary list used for epidemiological surveillance of resistance or assistance in interpreting the results of susceptibility testing.
402
V. Manageiro et al. / International Journal of Antimicrobial Agents 40 (2012) 398–403
blaOXA-24
blaOXA-66
13
blaOXA-24
blaOXA-104
1
ISAba1
blaOXA-66
2
ISAba1
blaOXA-66
7
blaOXA-66
4
ISAba1
blaOXA-66
44
ISAba1
blaOXA-66
1
blaOXA-24 Tn2006-like ISAba1
blaOXA-23
ISAba1
Tn2008-like ISAba1
blaOXA-23 Tn2008-like
ISAba1
blaOXA-23 Tn2008-like
blaOXA-24
ISAba1
blaOXA-23
Fig. 2. Schematic representation of carbapenem-hydrolysing class D -lactamase (CHDL)-encoding genes (blaOXA-23 , blaOXA-24 , blaOXA-66 and blaOXA-104 ) in 72 multidrugresistant Acinetobacter baumannii (MDR-Ab) isolates, and their genetic association with insertion sequence ISAba1 among 58 isolates. The numbers of isolates of each structure are shown on the right. The blaOXA-23 gene can be associated with ISAba1 in two different genetic arrangements: flanked by two copies of ISAba1, in opposite orientations; and with one copy of ISAba1 upstream of the blaOXA-23 gene. Transposons Tn2006- and Tn2008-like, respectively, are represented by dashed lines.
of blaOXA-51-like in 54 isolates. All but two of these also carried the ISAba1–blaOXA-23 association, highlighting the coexistence of ISAba1–blaOXA-51-like and ISAba1–blaOXA-23 genetic platforms, in contrast to previous suggestions [7]. The remaining 18 isolates, mainly OXA-24-producers, showed no association between ISAba1 and blaOXA-51-like . The blaOXA-24 genes are usually associated with XerC/XerD-like recombination sites that mediate dissemination among different plasmids and the chromosome [27]. Among all OXA-23-producing isolates, 49/56 had one copy of ISAba1 in the surroundings (upstream) of the respective encoding gene; the remaining 7 isolates showed the presence of blaOXA-23 flanked by two copies of ISAba1, located in opposite orientations (Fig. 2), as previously described [24]. These two genetic structures are certainly embedded in transposon Tn2008 and Tn2006 platforms, respectively, since they are always described in association. Tn2006-like and Tn2008-like, found within ST92 and ST118 (Fig. 1), may reflect either multiple genetic structures in the origin of blaOXA-23 acquisition or interclonal complex evolution. This evidence agrees with previous findings regarding the functionality of Tn2006, which states that it can perform transposition [28]. These results indicate that there may exist different genetic origins for carbapenem resistance among MDR-Ab isolates. Indeed, previous studies (Manageiro V, unpublished data) revealed the existence of carbapenem-susceptible MDR-Ab ST98 isolates (collected between 2005 and 2006), which showed the absence of ISAba1 and CHDLs other than OXA-66. These susceptible isolates were indistinguishable (100% similarity) by PFGE, suggesting that they existed in Portugal before acquisition of the blaOXA-24 gene. In conclusion, this study provides new data regarding the molecular evolution and CHDL-mediated resistance of MDR-Ab in Portugal. Here we report the first appearance of the epidemic
ST118 OXA-23-producer, both in the community and in healthcare facilities, as well as one ST92 isolate co-producing OXA-23 and OXA-24. Overall, these results emphasise the need for concerted action to manage carbapenem use as well as to control the worldwide clonal expansion of MDR-Ab, where the mobile genetic element, ISAba1, has an important role.
Acknowledgments The authors thank the following laboratories participating in the Antibiotic Resistance Surveillance Program in Portugal (ARSIP) for sending A. baumannii isolates and laboratory records to the National Reference Laboratory of Antimicrobial Resistances at the National Institute of Health (Lisbon): North region—C.H. de Vila Real/Peso da Régua E.P.E. (A.P. Castro), C.H. de Vila Nova de Gaia/Espinho E.P.E. (L. Felício) and C.H. Póvoa de Varzim e Vila do Conde E.P.E. (F. Fonseca); Centre region—H. São Teotónio, Viseu (J. Ribeiro); Lisbon and Tagus Valley region—C.H. Cascais Condes de Castro Guimarães (A. Fonseca), H.G. Orta E.P.E. (J. Diogo), H. Reynaldo dos Santos (M. Rodrigues) and H. Militar de Belém (J. Lago); and Madeira Island—C.H. Funchal (T. Afonso). This publication made use of the A. baumannii MLST website (http://pubmlst.org/abaumannii/) developed by Keith Jolley [29], funded by the Wellcome Trust and sited at the University of Oxford (UK). Part of these results was presented previously at the European Scientific Conference on Applied Infectious Disease Epidemiology (ESCAIDE), 11–13 November 2010, Lisbon, Portugal. Funding: VM has received research funding from grant SFRH/BD/32578/2006 from the Fundac¸ão para a Ciência e a Tecnologia (Lisbon, Portugal). DJ-D has received research funding from
V. Manageiro et al. / International Journal of Antimicrobial Agents 40 (2012) 398–403
grant BRJ/02/DG/2009 from the National Institute of Health Dr Ricardo Jorge (Lisbon, Portugal). Competing interests: None declared. Ethical approval: Not required. References [1] Munoz-Price LS, Weinstein RA. Acinetobacter infection. N Engl J Med 2008;358:1271–81. [2] Centers for Disease Control and Prevention (CDC). Acinetobacter baumannii infections among patients at military medical facilities treating injured U.S. service members, 2002–2004. MMWR Morb Mortal Wkly Rep 2004;53:1063–6. [3] Leclercq R, Canton R, Brown DF, Giske CG, Heisig P, Macgowan AP, et al. EUCAST expert rules in antimicrobial susceptibility testing. Clin Microbiol Infect 2011, http://dx.doi.org/10.1111/j.1469-0691.2011.03703.x Epub ahead of print. [4] Perez F, Hujer AM, Hujer KM, Decker BK, Rather PN, Bonomo RA. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob Agents Chemother 2007;51:3471–84. [5] Poirel L, Naas T, Nordmann P. Diversity, epidemiology, and genetics of class D -lactamases. Antimicrob Agents Chemother 2010;54:24–38. [6] Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev 2008;21:538–82. [7] Turton JF, Ward ME, Woodford N, Kaufmann ME, Pike R, Livermore DM, et al. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol Lett 2006;258:72–7. [8] Figueiredo S, Poirel L, Croize J, Recule C, Nordmann P. In vivo selection of reduced susceptibility to carbapenems in Acinetobacter baumannii related to ISAba1-mediated overexpression of the natural blaOXA-66 oxacillinase gene. Antimicrob Agents Chemother 2009;53:2657–9. [9] Chen TL, Lee YT, Kuo SC, Hsueh PR, Chang FY, Siu LK, et al. Emergence and distribution of plasmids bearing the blaOXA-51-like gene with an upstream ISAba1 in carbapenem-resistant Acinetobacter baumannii isolates in Taiwan. Antimicrob Agents Chemother 2010;54:4575–81. [10] Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 2012;18:268–81. [11] Turton JF, Woodford N, Glover J, Yarde S, Kaufmann ME, Pitt TL. Identification of Acinetobacter baumannii by detection of the blaOXA-51-like carbapenemase gene intrinsic to this species. J Clin Microbiol 2006;44:2974–6. [12] Mendonc¸a N, Leitão J, Manageiro V, Ferreira E, Canic¸a M. Spread of extendedspectrum -lactamase CTX-M-producing Escherichia coli clinical isolates in community and nosocomial environments in Portugal. Antimicrob Agents Chemother 2007;51:1946–55. [13] Seifert H, Dolzani L, Bressan R, van der Reijden T, van Strijen B, Stefanik D, et al. Standardization and interlaboratory reproducibility assessment of pulsed-field gel electrophoresis-generated fingerprints of Acinetobacter baumannii. J Clin Microbiol 2005;43:4328–35.
403
[14] Bartual SG, Seifert H, Hippler C, Luzon MA, Wisplinghoff H, Rodríguez-Valera F. Development of a multilocus sequence typing scheme for characterization of clinical isolates of Acinetobacter baumannii. J Clin Microbiol 2005;43: 4382–90. [15] Turton JF, Gabriel SN, Valderrey C, Kaufmann ME, Pitt TL. Use of sequencebased typing and multiplex PCR to identify clonal lineages of outbreak strains of Acinetobacter baumannii. Clin Microbiol Infect 2007;13:807–15. [16] Garner JS, Jarvis WR, Emori TG, Horan TC, Hughes JM. CDC definitions for nosocomial infections, 1988. Am J Infect Control 1988;16:128–40. [17] Grosso F, Quinteira S, Peixe L. Understanding the dynamics of imipenemresistant Acinetobacter baumannii lineages within Portugal. Clin Microbiol Infect 2011;17:1275–9. [18] Navon-Venezia S, Leavitt A, Carmeli Y. High tigecycline resistance in multidrugresistant Acinetobacter baumannii. J Antimicrob Chemother 2007;59:772–4. [19] Park YK, Jung SI, Park KH, Cheong HS, Peck KR, Song JH, et al. Independent emergence of colistin-resistant Acinetobacter spp. isolates from Korea. Diagn Microbiol Infect Dis 2009;64:43–51. [20] Fu Y, Zhou J, Zhou H, Yang Q, Wei Z, Yu Y, et al. Wide dissemination of OXA-23producing carbapenem-resistant Acinetobacter baumannii clonal complex 22 in multiple cities of China. J Antimicrob Chemother 2010;65:644–50. [21] Hamouda A, Evans BA, Towner KJ, Amyes SG. Characterization of epidemiologically unrelated Acinetobacter baumannii isolates from four continents by use of multilocus sequence typing, pulsed-field gel electrophoresis, and sequence-based typing of blaOXA-51-like genes. J Clin Microbiol 2010;48: 2476–83. [22] Runnegar N, Sidjabat H, Goh HM, Nimmo GR, Schembri MA, Paterson DL. Molecular epidemiology of multidrug-resistant Acinetobacter baumannii in a single institution over a 10-year period. J Clin Microbiol 2010;48:4051–6. [23] Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenemresistant Acinetobacter baumannii. J Antimicrob Chemother 2010;65: 233–8. [24] Mugnier PD, Poirel L, Naas T, Nordmann P. Worldwide dissemination of the blaOXA-23 carbapenemase gene of Acinetobacter baumannii. Emerg Infect Dis 2010;16:35–40. [25] Park YK, Lee GH, Baek JY, Chung DR, Peck KR, Song JH, et al. A single clone of Acinetobacter baumannii, ST22, is responsible for high antimicrobial resistance rates of Acinetobacter spp. isolates that cause bacteremia and urinary tract infections in Korea. Microb Drug Resist 2010;16:143–9. [26] Evans BA, Hamouda A, Towner KJ, Amyes SG. OXA-51-like -lactamases and their association with particular epidemic lineages of Acinetobacter baumannii. Clin Microbiol Infect 2008;14:268–75. [27] Merino M, Acosta J, Poza M, Sanz F, Beceiro A, Chaves F, et al. OXA-24 carbapenemase gene flanked by XerC/XerD-like recombination sites in different plasmids from different Acinetobacter species isolated during a nosocomial outbreak. Antimicrob Agents Chemother 2010;54:2724–7. [28] Mugnier PD, Poirel L, Nordmann P. Functional analysis of insertion sequence ISAba1, responsible for genomic plasticity of Acinetobacter baumannii. J Bacteriol 2009;191:2414–18. [29] Jolley KA, Chan MS, Maiden MC. mlstdbNet—distributed multi-locus sequence typing (MLST) databases. BMC Bioinformatics 2004;5:86.
Contents lists available at SciVerse ScienceDirect
International Journal of Antimicrobial Agents journal homepage: http://www.elsevier.com/locate/ijantimicag
Genetic diversity and clonal evolution of carbapenem-resistant Acinetobacter baumannii isolates from Portugal and the dissemination of ST118 V. Manageiro , D. Jones-Dias , E. Ferreira , D. Louro , Antimicrobial Resistance Surveillance Program in Portugal, M. Canic¸a ∗ National Reference Laboratory of Antimicrobial Resistances, Department of Infectious Diseases, National Institute of Health Dr Ricardo Jorge, Av. Padre Cruz, 1649-016 Lisbon, Portugal
a r t i c l e
i n f o
Article history: Received 7 March 2012 Accepted 11 June 2012 Keywords: OXA-23 OXA-24 ST118 Switching ISAba1 XDR
a b s t r a c t In this study, 116 multidrug-resistant Acinetobacter baumannii (MDR-Ab) isolates recovered in various regions of Portugal were studied. All isolates were non-susceptible to tigecycline; one isolate was also non-susceptible to colistin, making it a step closer to pandrug resistance. Among 72 isolates tested by PFGE, 98.6% carried blaOXA-66 , 1.4% blaOXA-104 , 77.8% blaOXA-23 , 23.6% blaOXA-24 , 18.1% blaTEM-1 and 1.4% blaCTX-M-15-like genes. No OXA-58 or metallo--lactamase-encoding genes were detected. ISAba1 was found in 58/72 isolates (80.6%). Among these, ISAba1 was found upstream of blaOXA-51-like in 54 isolates. All but two of these isolates also carried ISAba1–blaOXA-23 , highlighting the coexistence of ISAba1–blaOXA-51-like and ISAba1–blaOXA-23 genetic platforms, emphasising the importance of mobile genetic elements in the dissemination of carbapenem-hydrolysing class D -lactamase genes. Tn2006-like and Tn2008-like, found within ST92 and ST118, may reflect either multiple genetic structures in the origin of blaOXA-23 acquisition or interclonal complex evolution. These results indicate that there may exist different genetic origins for carbapenem resistance among MDR-Ab isolates. Six PFGE profiles were associated with three major sequence types, with ST118 (OXA-23- or OXA-24-producer) being widely disseminated since 2009. ST98 (described so far as endemic in Portugal) and ST92 (which co-existed with ST98 before 2009) appeared to have been gradually replaced by ST118. The new ST188 (OXA-104-producer) was detected for the first time in this country. Identification of an extensively drug-resistant ST118 and carbapenemresistant ST92, ST98 and ST118 isolates, both in community and healthcare facilities, demonstrates the menace of A. baumannii-associated infections. © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
1. Introduction Acinetobacter baumannii is a ubiquitous pathogen responsible for asymptomatic colonisation as well as both community and healthcare-associated infections [1,2], being naturally resistant to aminopenicillins, amoxicillin/clavulanic acid, cefazolin, cefotaxime, ceftriaxone, ertapenem, trimethoprim and fosfomycin [3]. A. baumannii isolates are also reported worldwide as the cause of several nosocomial outbreaks with considerable clinical and economic costs [1]. Extensive use of antimicrobial chemotherapy, particularly carbapenems, has contributed to the appearance of carbapenem-hydrolysing class D -lactamases (CHDLs) and further emergence of multidrug-resistant A. baumannii (MDR-Ab) isolates [4]. These enzymes include the acquired OXA-23, OXA-24 (alternate names OXA-40 and OXA-33) and OXA-58 as well as intrinsic OXA51 -lactamases [5,6]. Noteworthy, the genetic region upstream
∗ Corresponding author. Tel.: +351 21 751 9246; fax: +351 21 751 9246. E-mail address: [email protected] (M. Canic¸a).
of CHDLs frequently includes the insertion sequence (IS) ISAba1, which has been shown to provide promoter sequences that enhance the expression of these genes [7–9]. In this study, we report an evaluation of CHDL-producing A. baumannii isolates collected from various regions of Portugal as well as the connection between their susceptibility and genetic profile.
2. Materials and methods 2.1. Bacterial strain collection This study included 116 non-repetitive clinical A. baumannii isolates collected consecutively between April 2009 and April 2010 in nine Portuguese hospitals from four different geographic regions (each with between 100 and 743 beds), belonging to the Antibiotic Resistance Surveillance Program in Portugal (ARSIP). All isolates for the study were identified in the respective hospital laboratories as carbapenem-non-susceptible A. baumannii by different systems (ATB G-5, VITEK 1, VITEK 2 and Phoenix) and were then sent to the National Institute of Health in Lisbon (Portugal).
0924-8579/$ – see front matter © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. http://dx.doi.org/10.1016/j.ijantimicag.2012.06.013
V. Manageiro et al. / International Journal of Antimicrobial Agents 40 (2012) 398–403
399
2.2. Antimicrobial susceptibility testing
2.6. Identification of PCR-based sequence groups
Antimicrobial susceptibility of all clinical isolates was analysed by the disk diffusion method and the results were interpreted according to the clinical breakpoints (2010 recommendations) of the Antibiogram Committee of the French Society for Microbiology (CA-SFM) (http://www.sfm-microbiologie.org/). Among all the isolates, 20 isolates representative of each pulsed-field gel electrophoresis (PFGE) profile and hospital (Fig. 1) and subjected to multilocus sequence typing (MLST) were also evaluated for carbapenem susceptibility through broth microdilution and for tigecycline and colistin susceptibility through Etest (bioMérieux, Marcy l’Étoile, France). These results were interpreted according to European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoints v.2.0 (http://www.eucast.org/clinical breakpoints/). Since EUCAST still considers there is insufficient evidence to establish tigecycline breakpoints for Acinetobacter spp., the EUCAST non-species-specific minimum inhibitory concentration (MIC) breakpoints (susceptible, ≤0.25 mg/L, resistant, >0.5 mg/L) were applied to interpret susceptibility to this antibiotic. Isolates were scored as MDR or extensively drug-resistant bacteria according to recently proposed standardised international terminology [10].
Clonal lineages of the 20 MDR-Ab isolates were determined by a multiplex PCR designed to selectively amplify group 1 or group 2 alleles of the ompA, csuE and blaOXA-51-like genes as previously described [15].
2.3. PCR amplification and gene sequencing All isolates were subjected to a species confirmatory identification assay that was achieved through amplification of the blaOXA-51-like gene as previously described [11]. PCR and sequencing were used to detect and identify genes coding for CHDLs (blaOXA-23 , blaOXA-24 , blaOXA-51 and blaOXA-58 ) and class B metallo--lactamases (MBLs) (blaIMP , blaVIM and blaNDM ) among 72 isolates tested by PFGE. The presence of class A -lactamase-encoding genes (blaTEM , blaSHV and blaCTX-M ) was also investigated as previously described [12]. All PCR products were purified with ExoSAP-IT (USB Corp., Cleveland, OH) and were sequenced directly on both strands using an ABI3100 Automatic Sequencer (Applied Biosystems, Warrington, UK). PCR mapping experiments using combinations of ISAba1 with blaOXA-23- , blaOXA-24- and blaOXA-51-like primers were used to detect the genetic association between the insertion sequence and CHDLencoding genes (Table 1). 2.4. Pulsed-field gel electrophoresis analysis The genetic relatedness of 72 isolates representative of the different hospitals and years was investigated through a modified PFGE protocol [12] using ApaI to digest A. baumannii genomic DNA [13]. BioNumerics v.3.5 (Applied Maths, Sint-Martens-Latem, Belgium) was used for cluster analysis. Dice coefficients and the unweighted pair-group method (UPGMA) with the arithmetic averages clustering method were used for grouping analysis. Isolates with a Dice band-based similarity coefficient value of ≥80% were considered to belong to the same cluster. 2.5. Multilocus sequence typing analysis To compare single nucleotide polymorphisms with the wholegenome profile provided by PFGE, MLST was conducted on a set of 20 isolates representative of each PFGE profile and hospital. This analysis was performed through the identification of seven housekeeping genes (gltA, gyrB, gdhB, recA, cpn60, gpi and rpoD) as described previously [14]. The resulting sequences were analysed using BioNumerics v.3.5 software and were assigned to sequence types (STs) using the tools on the A. baumannii MLST webpage (http://pubmlst.org/abaumannii/).
2.7. Nucleotide sequence accession number The sequence of the blaOXA-104 -lactamase gene was submitted to the EMBL Nucleotide Sequence Database under accession no. FR667694. 3. Results and discussion Overall, 116 A. baumannii isolates were mainly from urine (39.7%), sputum (24.1%) and blood (11.2%), from male patients (55.2%) aged ≥65 years (69.0%), and from patients hospitalised in internal medicine services (44.1%), Intensive Care Units (11.2%) and surgery (11.2%). Seventeen of the isolates were identified as the cause of community-acquired infections according to US Centers for Disease Control and Prevention (CDC) definitions [16], the majority of which were from elderly patients (≥65 years old), admitted at the emergency room, and without information about previous hospitalisations. Disk diffusion testing indicated that all isolates were MDR and confirmed non-susceptibility to carbapenems (Table 2). In this study, after evaluation by the Etest method, tigecycline had reduced in vitro activity against MDR-Ab bacteria, with MICs between 1 mg/L and 128 mg/L (Fig. 1), as observed by others [17,18]. Use of Etest revealed that one isolate (INSRA9855) was non-susceptible to colistin (Fig. 1), which is of great concern considering the lack of treatment options to deal with MDR-Ab infections [19]. Following PCR and sequencing, all isolates were identified as carrying the blaOXA-51-like gene, specifically blaOXA-66 (98.6%) and blaOXA-104 (1.4%) (Fig. 1). Among these isolates, 56/72 (77.8%) carried blaOXA-23 , 17/72 (23.6%) blaOXA-24 , 13/72 (18.1%) blaTEM-1F and 1/72 (1.4%) blaCTX-M-15-like genes; none carried OXA-58 or MBLencoding genes. PFGE analysis revealed six profiles: 71 related (≥80% similarity) or indistinguishable (100% homology) MDR-Ab clones were grouped into five different clusters (I–V) and 1 MDR-Ab was genetically unrelated to the others (Fig. 1). All isolates, with the exception of the MDR-Ab with a unique PFGE profile, revealed a similarity coefficient value of ≥75%, which makes them epidemiologically very closely related. Those groups were correlated with CHDL production, carbapenem susceptibility profile, and with four distinct STs: ST92 (allelic profile 1-3-3-2-2-7-3); ST98 (allelic profile 112-3-2-2-3-3); ST118 (allelic profile 1-3-3-2-2-3-3); and the novel ST188 (allelic profile 31-33-67-40-16-58-7). Currently, two Acinetobacter MLST schemes are available for typing of A. baumannii strains, namely the Bartual scheme (http://pubmlst.org/abaumannii/) and the Pasteur scheme (http://www.pasteur.fr/mlst/Abaumannii.html). The two schemes have generally shown compatible results although a recent study has reported a higher resolution of the Bartual MLST scheme providing a better association between epidemiological features, occurrence of acquired OXA genes, and temporal distribution of the isolates [17]. In this study, genotype analysis together with identification of CHDL-encoding genes led to the detection of three major STs contributing to the high prevalence of carbapenem-resistant MDR-Ab in Portugal: ST92 (OXA-23-producer, mostly associated with TEM expression); and ST98 (OXA-24-producer); and ST118 (OXA-23- or OXA-24-producer, associated with CTX-M-15 in one isolate). ST98
400
V. Manageiro et al. / International Journal of Antimicrobial Agents 40 (2012) 398–403
Fig. 1. Pulsed-field gel electrophoresis (PFGE) dendrogram and genetic relatedness of 72 Acinetobacter baumannii isolates. Strain code, hospital code, region, ward, biological product, year of isolation, antibiotic susceptibility [by minimum inhibitory concentration (MIC)], detected -lactamases, genetic association between insertion sequence ISAba1 and carbapenem-hydrolysing class D -lactamase (CHDL)-encoding genes, multilocus sequence typing (MLST) and PFGE profile types (from 0001 to 0005 were defined as forming clusters I–V, respectively) are also shown. TEM, CTX-M, CHDLs and the presence of ISAba1 are indicated by black circles; a double black circle indicates the presence of two copies of ISAba1. Hospital ward: CA, community-acquired; ICU, Intensive Care Unit; IM, internal medicine; OP, ophthalmology; OT, orthopaedy; PN, pneumology; SUR, surgery; SURV, surgery vascular; Unk, unknown. Biological product: ba, bronchial aspirate; bl, blood; bs, bronchial secretion; ct, catheter; pe, purulent exudate; sp, sputum; ta, tracheal aspirate; ur, urine; w, wound. Antibiotics: I, imipenem; M, meropenem; T, tigecycline; C, colistin.
V. Manageiro et al. / International Journal of Antimicrobial Agents 40 (2012) 398–403
401
Table 1 Primers used for PCR amplification and sequencing of bla genes and the insertion sequence ISAba1 genetic region. Gene
Primer sequences
blaOXA-51-like blaOXA-23-like blaOXA-24-like blaOXA-58-like blaOXA-51-like blaOXA-23 blaOXA-24 blaIMP blaVIM blaNDM ISAba1b a b
Tannealing (◦ C)
PCR product (bp)/methoda
56 56 56 56 52 52 52 56 55 58 50
671/M-PCR 220/M-PCR 645/M-PCR 591/M-PCR 874/Seq. 847/Seq. 873/Seq. 133/PCR + Seq. 556/PCR + Seq. 359/PCR + Seq. variable/PCR + Seq.
Forward (5 → 3 )
Reverse (5 → 3 )
TTTATTTCAGCCTGCTCAC GATCGGATTGGAGAACCAG GATGAAGCTCAAACACAGG AAACCCACATACCAACCC CTCAAGTTACATTAATTAGC TTATTTTCTATTGATCTGGTG AATATTATACTCTAAGCCCC TCGTTTGAAGAAGTTAACGG GTTTGGTCGCATATCGCAAC GTTTGATCGTCAGGGATGGC CACGAATGCAGAAGTTG
TGAACAACCCATCCAGTTAACC CTGCTGTCCAATTTCAG ACGAATAGAACCAGACATTCC CGATCAGAATGTTCAAGC CTATAAAATACCTAATTGTTC AAATAATATTCAGCTGTTTTAATG TAAATGATTCCAAGATTTTCTAG CCACAAACCAAGTGACTAACT GGAATGACGAACTGTGCTTC AACGGTGATATTGTCACTGGT GTGTCATAGTATTCGTCG
Method used for screening and/or identification of genes: M-PCR, multiplex PCR; Seq., sequencing; PCR + Seq., PCR and sequencing. Primers from reference [7].
and ST92 are both single-locus variants of ST118, and all three belong to the same clonal complex, sharing a common ancestor [20–22]. Indeed, multiplex PCR for identification of clonal lineages revealed that all isolates belonged to international clone (IC) II, one of the three international clones of A. baumannii (IC I, II and III, previously designated European clones I, II and III, respectively) associated with multidrug resistance [23]. Although ST98 (described so far as endemic in Portugal) and ST92 were already present in the country before 2009 [17], epidemic ST118 was here detected at a national level for the first time, suggesting replacement of the pre-existing clones. This switch might be due to two independent phenomena: (i) importation of ST118 from other European countries [21,24] and subsequent acquisition of different resistance genes (blaOXA-24 or blaOXA-23 ); or (ii) evolution from the related OXA23-producing ST92 or OXA-24-producing ST98 (belonging to the same clonal complex), both cases followed by posterior spread. The geographic distance between continental and Autonomous Portuguese regions may be an explanation for both evolutionary processes.
In this study, ST118 and ST92 OXA-23 producers, already described in different continents [21,24,25], were the most successfully disseminated among healthcare facilities, suggesting clonal expansion of both lineages: ST118 was identified in all but one hospital and ST92 in all but two. Worryingly, Portugal may have features that favour the rapid adaptation of both STs in hospital settings. We were also able to identify two different epidemic local clones in hospitals G and E that constitute examples of such adaptation: OXA-24-producing ST118 (cluster IV) and OXA-23-producing ST118 (cluster V), respectively. The blaOXA-104 gene, a blaOXA-51-like gene, identified in a ST188 MDR-Ab that also harboured blaOXA-24 gene, carried 182 synonymous mutations compared with the first blaOXA-104 gene ever described [26]; molecular evolution of the blaOXA-104 gene suggests an adaptation of MDR-Ab to the selective pressure imposed by the clinical use of carbapenems. Interestingly, as shown in Figs. 1 and 2, we were able to find different genetic structures within the main single clone lineages of the study (ST92 and ST118). Briefly, ISAba1 was found in 58/72 MDR-Ab isolates (80.6%). Among these, ISAba1 was found upstream
Table 2 Antibiotic susceptibility as assessed by disk diffusion tests of 116 Acinetobacter baumannii isolates collected in Portuguese hospitals. Antimicrobial agent
Amoxicillin/clavulanic acid Ticarcillinb Piperacillinb Piperacillin/tazobactamb Cefoxitin Cefpodoxime Ceftazidimeb Cefotaxime Ceftriaxone Cefixime Aztreonam Cefepime Imipenemb Meropenem Ciprofloxacinb Norfloxacin Pefloxacin Kanamycin Gentamicinb Amikacinb Trimethoprim/sulfamethoxazoleb
Breakpoints (mm)a
Susceptibility of isolates (n = 116) No. (%) R
No. (%) IR
S
R
116 (100) 116 (100) 115 (99.1) 115 (99.1) 116 (100) 116 (100) 115 (99.1) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 115 (99.1) 116 (100) 116 (100) 116 (100) 66 (56.9) 69 (59.5) 50 (43.1) 116 (100)
116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 116 (100) 66 (56.9) 69 (59.5) 57 (49.1) 116 (100)
≥23 ≥22 ≥18 ≥19 ≥22 ≥24 ≥21 ≥26 ≥26 ≥25 ≥23 ≥21 ≥24 ≥22 ≥22 ≥25 ≥22 ≥17 ≥16 ≥17 ≥16
<16 <18 <12 <14 <15 <21 <19 <23 <23 <22 <21 <19 <17 <15 <22 <22 <16 <15 <16 <15 <13
R, resistant; IR, non-susceptible; S, sensitive. a Susceptibility scored according to the Antibiogram Committee of the French Society for Microbiology (CA-SFM) 2010 guidelines. b Antibiotics used in the therapy of multidrug-resistant A. baumannii infections [10], according to clinical indications and prevalence of acquired resistance. All other antibiotics constitute a supplementary list used for epidemiological surveillance of resistance or assistance in interpreting the results of susceptibility testing.
402
V. Manageiro et al. / International Journal of Antimicrobial Agents 40 (2012) 398–403
blaOXA-24
blaOXA-66
13
blaOXA-24
blaOXA-104
1
ISAba1
blaOXA-66
2
ISAba1
blaOXA-66
7
blaOXA-66
4
ISAba1
blaOXA-66
44
ISAba1
blaOXA-66
1
blaOXA-24 Tn2006-like ISAba1
blaOXA-23
ISAba1
Tn2008-like ISAba1
blaOXA-23 Tn2008-like
ISAba1
blaOXA-23 Tn2008-like
blaOXA-24
ISAba1
blaOXA-23
Fig. 2. Schematic representation of carbapenem-hydrolysing class D -lactamase (CHDL)-encoding genes (blaOXA-23 , blaOXA-24 , blaOXA-66 and blaOXA-104 ) in 72 multidrugresistant Acinetobacter baumannii (MDR-Ab) isolates, and their genetic association with insertion sequence ISAba1 among 58 isolates. The numbers of isolates of each structure are shown on the right. The blaOXA-23 gene can be associated with ISAba1 in two different genetic arrangements: flanked by two copies of ISAba1, in opposite orientations; and with one copy of ISAba1 upstream of the blaOXA-23 gene. Transposons Tn2006- and Tn2008-like, respectively, are represented by dashed lines.
of blaOXA-51-like in 54 isolates. All but two of these also carried the ISAba1–blaOXA-23 association, highlighting the coexistence of ISAba1–blaOXA-51-like and ISAba1–blaOXA-23 genetic platforms, in contrast to previous suggestions [7]. The remaining 18 isolates, mainly OXA-24-producers, showed no association between ISAba1 and blaOXA-51-like . The blaOXA-24 genes are usually associated with XerC/XerD-like recombination sites that mediate dissemination among different plasmids and the chromosome [27]. Among all OXA-23-producing isolates, 49/56 had one copy of ISAba1 in the surroundings (upstream) of the respective encoding gene; the remaining 7 isolates showed the presence of blaOXA-23 flanked by two copies of ISAba1, located in opposite orientations (Fig. 2), as previously described [24]. These two genetic structures are certainly embedded in transposon Tn2008 and Tn2006 platforms, respectively, since they are always described in association. Tn2006-like and Tn2008-like, found within ST92 and ST118 (Fig. 1), may reflect either multiple genetic structures in the origin of blaOXA-23 acquisition or interclonal complex evolution. This evidence agrees with previous findings regarding the functionality of Tn2006, which states that it can perform transposition [28]. These results indicate that there may exist different genetic origins for carbapenem resistance among MDR-Ab isolates. Indeed, previous studies (Manageiro V, unpublished data) revealed the existence of carbapenem-susceptible MDR-Ab ST98 isolates (collected between 2005 and 2006), which showed the absence of ISAba1 and CHDLs other than OXA-66. These susceptible isolates were indistinguishable (100% similarity) by PFGE, suggesting that they existed in Portugal before acquisition of the blaOXA-24 gene. In conclusion, this study provides new data regarding the molecular evolution and CHDL-mediated resistance of MDR-Ab in Portugal. Here we report the first appearance of the epidemic
ST118 OXA-23-producer, both in the community and in healthcare facilities, as well as one ST92 isolate co-producing OXA-23 and OXA-24. Overall, these results emphasise the need for concerted action to manage carbapenem use as well as to control the worldwide clonal expansion of MDR-Ab, where the mobile genetic element, ISAba1, has an important role.
Acknowledgments The authors thank the following laboratories participating in the Antibiotic Resistance Surveillance Program in Portugal (ARSIP) for sending A. baumannii isolates and laboratory records to the National Reference Laboratory of Antimicrobial Resistances at the National Institute of Health (Lisbon): North region—C.H. de Vila Real/Peso da Régua E.P.E. (A.P. Castro), C.H. de Vila Nova de Gaia/Espinho E.P.E. (L. Felício) and C.H. Póvoa de Varzim e Vila do Conde E.P.E. (F. Fonseca); Centre region—H. São Teotónio, Viseu (J. Ribeiro); Lisbon and Tagus Valley region—C.H. Cascais Condes de Castro Guimarães (A. Fonseca), H.G. Orta E.P.E. (J. Diogo), H. Reynaldo dos Santos (M. Rodrigues) and H. Militar de Belém (J. Lago); and Madeira Island—C.H. Funchal (T. Afonso). This publication made use of the A. baumannii MLST website (http://pubmlst.org/abaumannii/) developed by Keith Jolley [29], funded by the Wellcome Trust and sited at the University of Oxford (UK). Part of these results was presented previously at the European Scientific Conference on Applied Infectious Disease Epidemiology (ESCAIDE), 11–13 November 2010, Lisbon, Portugal. Funding: VM has received research funding from grant SFRH/BD/32578/2006 from the Fundac¸ão para a Ciência e a Tecnologia (Lisbon, Portugal). DJ-D has received research funding from
V. Manageiro et al. / International Journal of Antimicrobial Agents 40 (2012) 398–403
grant BRJ/02/DG/2009 from the National Institute of Health Dr Ricardo Jorge (Lisbon, Portugal). Competing interests: None declared. Ethical approval: Not required. References [1] Munoz-Price LS, Weinstein RA. Acinetobacter infection. N Engl J Med 2008;358:1271–81. [2] Centers for Disease Control and Prevention (CDC). Acinetobacter baumannii infections among patients at military medical facilities treating injured U.S. service members, 2002–2004. MMWR Morb Mortal Wkly Rep 2004;53:1063–6. [3] Leclercq R, Canton R, Brown DF, Giske CG, Heisig P, Macgowan AP, et al. EUCAST expert rules in antimicrobial susceptibility testing. Clin Microbiol Infect 2011, http://dx.doi.org/10.1111/j.1469-0691.2011.03703.x Epub ahead of print. [4] Perez F, Hujer AM, Hujer KM, Decker BK, Rather PN, Bonomo RA. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob Agents Chemother 2007;51:3471–84. [5] Poirel L, Naas T, Nordmann P. Diversity, epidemiology, and genetics of class D -lactamases. Antimicrob Agents Chemother 2010;54:24–38. [6] Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev 2008;21:538–82. [7] Turton JF, Ward ME, Woodford N, Kaufmann ME, Pike R, Livermore DM, et al. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol Lett 2006;258:72–7. [8] Figueiredo S, Poirel L, Croize J, Recule C, Nordmann P. In vivo selection of reduced susceptibility to carbapenems in Acinetobacter baumannii related to ISAba1-mediated overexpression of the natural blaOXA-66 oxacillinase gene. Antimicrob Agents Chemother 2009;53:2657–9. [9] Chen TL, Lee YT, Kuo SC, Hsueh PR, Chang FY, Siu LK, et al. Emergence and distribution of plasmids bearing the blaOXA-51-like gene with an upstream ISAba1 in carbapenem-resistant Acinetobacter baumannii isolates in Taiwan. Antimicrob Agents Chemother 2010;54:4575–81. [10] Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 2012;18:268–81. [11] Turton JF, Woodford N, Glover J, Yarde S, Kaufmann ME, Pitt TL. Identification of Acinetobacter baumannii by detection of the blaOXA-51-like carbapenemase gene intrinsic to this species. J Clin Microbiol 2006;44:2974–6. [12] Mendonc¸a N, Leitão J, Manageiro V, Ferreira E, Canic¸a M. Spread of extendedspectrum -lactamase CTX-M-producing Escherichia coli clinical isolates in community and nosocomial environments in Portugal. Antimicrob Agents Chemother 2007;51:1946–55. [13] Seifert H, Dolzani L, Bressan R, van der Reijden T, van Strijen B, Stefanik D, et al. Standardization and interlaboratory reproducibility assessment of pulsed-field gel electrophoresis-generated fingerprints of Acinetobacter baumannii. J Clin Microbiol 2005;43:4328–35.
403
[14] Bartual SG, Seifert H, Hippler C, Luzon MA, Wisplinghoff H, Rodríguez-Valera F. Development of a multilocus sequence typing scheme for characterization of clinical isolates of Acinetobacter baumannii. J Clin Microbiol 2005;43: 4382–90. [15] Turton JF, Gabriel SN, Valderrey C, Kaufmann ME, Pitt TL. Use of sequencebased typing and multiplex PCR to identify clonal lineages of outbreak strains of Acinetobacter baumannii. Clin Microbiol Infect 2007;13:807–15. [16] Garner JS, Jarvis WR, Emori TG, Horan TC, Hughes JM. CDC definitions for nosocomial infections, 1988. Am J Infect Control 1988;16:128–40. [17] Grosso F, Quinteira S, Peixe L. Understanding the dynamics of imipenemresistant Acinetobacter baumannii lineages within Portugal. Clin Microbiol Infect 2011;17:1275–9. [18] Navon-Venezia S, Leavitt A, Carmeli Y. High tigecycline resistance in multidrugresistant Acinetobacter baumannii. J Antimicrob Chemother 2007;59:772–4. [19] Park YK, Jung SI, Park KH, Cheong HS, Peck KR, Song JH, et al. Independent emergence of colistin-resistant Acinetobacter spp. isolates from Korea. Diagn Microbiol Infect Dis 2009;64:43–51. [20] Fu Y, Zhou J, Zhou H, Yang Q, Wei Z, Yu Y, et al. Wide dissemination of OXA-23producing carbapenem-resistant Acinetobacter baumannii clonal complex 22 in multiple cities of China. J Antimicrob Chemother 2010;65:644–50. [21] Hamouda A, Evans BA, Towner KJ, Amyes SG. Characterization of epidemiologically unrelated Acinetobacter baumannii isolates from four continents by use of multilocus sequence typing, pulsed-field gel electrophoresis, and sequence-based typing of blaOXA-51-like genes. J Clin Microbiol 2010;48: 2476–83. [22] Runnegar N, Sidjabat H, Goh HM, Nimmo GR, Schembri MA, Paterson DL. Molecular epidemiology of multidrug-resistant Acinetobacter baumannii in a single institution over a 10-year period. J Clin Microbiol 2010;48:4051–6. [23] Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenemresistant Acinetobacter baumannii. J Antimicrob Chemother 2010;65: 233–8. [24] Mugnier PD, Poirel L, Naas T, Nordmann P. Worldwide dissemination of the blaOXA-23 carbapenemase gene of Acinetobacter baumannii. Emerg Infect Dis 2010;16:35–40. [25] Park YK, Lee GH, Baek JY, Chung DR, Peck KR, Song JH, et al. A single clone of Acinetobacter baumannii, ST22, is responsible for high antimicrobial resistance rates of Acinetobacter spp. isolates that cause bacteremia and urinary tract infections in Korea. Microb Drug Resist 2010;16:143–9. [26] Evans BA, Hamouda A, Towner KJ, Amyes SG. OXA-51-like -lactamases and their association with particular epidemic lineages of Acinetobacter baumannii. Clin Microbiol Infect 2008;14:268–75. [27] Merino M, Acosta J, Poza M, Sanz F, Beceiro A, Chaves F, et al. OXA-24 carbapenemase gene flanked by XerC/XerD-like recombination sites in different plasmids from different Acinetobacter species isolated during a nosocomial outbreak. Antimicrob Agents Chemother 2010;54:2724–7. [28] Mugnier PD, Poirel L, Nordmann P. Functional analysis of insertion sequence ISAba1, responsible for genomic plasticity of Acinetobacter baumannii. J Bacteriol 2009;191:2414–18. [29] Jolley KA, Chan MS, Maiden MC. mlstdbNet—distributed multi-locus sequence typing (MLST) databases. BMC Bioinformatics 2004;5:86.