Genetic diversity and cryptic speciation of the deep sea chaetognath Caecosagitta macrocephala (Fowler, 1904)

Deep-Sea Research II 57 (2010) 2211–2219

Contents lists available at ScienceDirect

Deep-Sea Research II journal homepage: www.elsevier.com/locate/dsr2

Genetic diversity and cryptic speciation of the deep sea chaetognath Caecosagitta macrocephala (Fowler, 1904) Hiroomi Miyamoto n,1, Ryuji J. Machida 2, Shuhei Nishida 1 Ocean Research Institute, University of Tokyo, 1-15-1 Minamidai, Nakano, Tokyo 164-8639, Japan

a r t i c l e in fo

abstract

Article history: Received 18 September 2010 Accepted 18 September 2010 Available online 21 September 2010

We investigated genetic diversity and structure of the deep sea chaetognath Caecosagitta macrocephala collected in the western North Pacific (Sagami Bay) and eastern Central to South Atlantic. All of the 52 specimens analyzed had unique haplotypes in their mitochondrial cytochrome c oxidase subunit I (mtCOI) gene sequences. Four distinct lineages of the mtCOI gene sequences (mtA, mtB, mtC, and mtD) were revealed by phylogenetic analysis with robust statistical support. The specimens collected from the Atlantic Ocean comprised three of the lineages (mtA, mtB, and mtD). All specimens of the remaining lineage (mtC) were obtained from Sagami Bay. The outgroup node was placed between the mtA lineage and lineages mtB, mtC, and mtD. Two specimens from each of the four lineages were randomly selected and the nuclear ribosomal internal transcribed spacer 1 (nITS1) region sequenced, resulting in ten forms, two of which were shared by all eight individuals. Phylogenetic relationships estimated from these sequences further supported the independence and reproductive isolation of the mtA individuals from the other lineages, while no phylogenetic structure was found in the mtB, mtC, and mtD lineages. These results indicate the presence of at least two cryptic species in C. macrocephala. Interestingly, these cryptic species were collected primarily from different depth layers (meso- and bathypelagic), suggesting speciation of the bathypelagic species from a mesopelagic precursor. & 2010 Elsevier Ltd. All rights reserved.

Keywords: Arrow worm Population genetics Cryptic species Phylogeography

1. Introduction Genetic homogeneity in plankton communities has been assumed based on their wide distributional ranges and high dispersal capabilities caused by ocean currents and mixing (Palumbi, 1992; Pierrot-Bults, 1997). In contrast to this supposition, recent studies have demonstrated the presence of genetically structured populations in different water masses (Bucklin et al., 1996, 2000, 2002; Goetze, 2005). However, all of these studies targeted epipelagic animals and little attention has been paid to the zooplankton that inhabits meso- and bathypelagic environments. Variations in environmental factors, such as temperature and salinity, of meso- and bathypelagic zones are low compared to those in the epipelagic zone, while species diversity of oceanic mesozooplankton peaks in the meso- and/or bathypelagic zone for many animal groups (Angel, 1993; Pierrot-Bults, 1997; Kuriyama and Nishida, 2006). A population genetic study of the benthopelagic amphipod Eurythenes gryllus indicated genetic

n

Corresponding author. Tel.: + 81 4 7136 6165; fax: + 81 4 7136 6164. E-mail address: [email protected] (H. Miyamoto). 1 Present address: Atmosphere and Ocean Research Institute, University of Tokyo, 5-1-5 Kashiwanoha, Kashiwashi, Chiba 277-8564, Japan. 2 Present address: Smithsonian National Museum of Natural History, Washington, DC 20560, USA. 0967-0645/$ - see front matter & 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.dsr2.2010.09.023

homogeneity among sites within the same depth zone at the scale of ocean basins; however, genetically divergent, cryptic taxa were distributed at different depths (France and Kocher, 1996), suggesting that ecological and physical conditions are important factors that may lead to speciation. However, little information is available regarding truly pelagic zooplankton from meso- and bathypelagic environments. Caecosagitta macrocephala (Fowler, 1904) is a pelagic chaetognath distributed in meso- and bathypelagic layers (Pierrot-Bults and Nair, 1991). The horizontal distribution of this species is very wide, ranging from the Subantarctic to the Subarctic Ocean. The species name ‘‘macro-cephala’’ implies a relatively large head. Photoreceptive regions of their eyes are developed to catch weak light at bathypelagic depths (Goto et al., 1989). They show orange oil droplets in their intestine (Terazaki et al., 1977) and luminous organs on top of the anterior fin, which gleam due to a luciferinluciferase reaction (Haddock and Case, 1994). They often dominate the chaetognath fauna in meso- and bathypelagic layers (Fagetti, 1972; Pierrot-Bults, 1982). Caecosagitta is a monotypic genus and C. macrocephala is easily distinguished from the other species of Sagittidae by its unique morphological characters, such as the comparatively large head and the orange gut pigmentation, although this color is lost in preserved specimens. There are few disagreements among taxonomists regarding the identity of this species, although much remains to be clarified

2212

H. Miyamoto et al. / Deep-Sea Research II 57 (2010) 2211–2219

with respect to body structure (Bieri, 1991). As for their infraspecific variability, Casanova (1992) reported marked morphological differences between a specimen of C. macrocephala collected from near or on the bottom of the Santa Catalina Basin and those obtained from pelagic waters in the Atlantic, and suggested the presence of a particular near-bottom form. Kasatkina (2003) designated five new species of Caecosagitta without examining the variability and taxonomic value of the characters used for species designation, and as a consequence none of these are recognized as valid. Overall, there appears to be a lack of widely accepted or published proposals for the morphological subdivision of C. macrocephala into several populations. In the present study, we investigated the genetic diversity and structure of C. macrocephala. DNA sequences of the mitochondrial cytochrome c oxidase subunit I gene (mtCOI) and the nuclear ribosomal internal transcribed spacer 1 (nITS1) region were determined from specimens collected from the eastern Atlantic and western North Pacific. Based on these sequences, the possibility of a population subdivision and speciation mechanism in C. macrocephala was analyzed and discussed.

2. Materials and methods 2.1. Sample collection and DNA extraction Caecosagitta macrocephala specimens were collected from Sagami Bay in the western North Pacific during two expeditions with T/S Seiyo-Maru (June 2007, SEII0706) and R/V Tansei Maru (August 2007, KT-07–18) as well as in the South Atlantic with R/V Polarstern (November 2007, ANT-XXIV/1) using one of the

following four types of plankton net: IONESS (Kitamura et al., 2001), ORI-VMPS (Terazaki and Tomatsu, 1997), IKMT (Issacs and Kidd, 1953), and MOCNESS (Wiebe et al., 1985) (Fig. 1). The chaetognaths were sorted out on board from the original plankton samples while they were alive and C. macrocephala were identified under a microscope following Kitou (1967) and fixed in 95–99% ethanol. Genomic DNA was extracted using either the AquaPure Genomic DNA Tissue Kit (Bio-Rad) or the Gentra Puregene Cell or Tissue Kit (Qiagen). Of these 58 specimens 52 could be used for analyses.

2.2. Polymerase chain reactions and sequencing Nucleotide sequences of mtCOI were used as genetic markers. While analyzing the mtCOI sequences, four distinct lineages within the C. macrocephala populations became evident. We further analyzed the nITS1 region to determine if these lineages represented reproductively isolated populations. Two individuals were randomly chosen from each of the four mtCOI lineages and used in the nITS analysis. All polymerase chain reactions (PCRs) were done in a model 9700 thermal cycler (Applied Biosystems, Inc.). PCR-amplified products were electrophoresed on a 2% L 03 agarose gel (TaKaRa), stained with ethidium bromide for band characterization using ultraviolet transillumination, and purified by ExoSapIT (USB Corp.). PCR products were subsequently used for direct cycle sequencing with dye-labeled terminators (Applied Biosystems, Inc.). Primers used for sequencing reactions were the same as those used for the initial PCRs. Labeled fragments were analyzed on a Model 3130 DNA sequencer (Applied Biosystems, Inc.).

Fig. 1. Locations of sampling stations.

H. Miyamoto et al. / Deep-Sea Research II 57 (2010) 2211–2219

2.3. Amplification of mtCOI region Amplifications of the mtCOI gene sequence region were performed using universal primers LCO 1490 and HCO 2198 (Folmer et al., 1994) in 15-ml-volume reactions of 7.62 ml sterile, distilled H2O, 1.5 ml 10  buffer, 1.2 ml 2.5 mM dNTPs (2.5 mM each), 1.8 ml each primer (5 mM), 0.08 ml Z-taq (TaKaRa), and 1.0 ml template. The thermal cycle profile consisted of 35 cycles of denaturation at 94 1C for 5 s, annealing at 50 1C for 5 s, and extension at 72 1C for 30 s.

2.4. Amplification of the nITS1 region Analysis of the nITS1 sequence region consisted of a seminested PCR that included amplifying the region between the 18S and 28S ribosomal DNA (rDNA) genes and using this as a template to amplify the region between the 18S and 5.8S rDNA genes. The first step of the semi-nested PCR was performed using primers 199-57-28S [50 GGCAGGTGAGTTGTTACACACTCC 30 ] and 1368-18S [50 GTCCCTGCCCTTTGTACACACCG 30 ]. These primers were newly designed in this study with reference to aligned sequences deposited in DDBJ/EMBL/GenBank for 199-57-28S, Chaetognatha (accession number AF342799), Platyhelminthes (AF342800), Brachiopoda (AF342802), Sipuncula (AF342795); 1368-18S, Arthropoda (EF532821), Chordata (U13369), and Nematoda (X03680). Reactions were performed in a 25.0-ml volume containing 10.75 ml sterile, distilled H2O, 2.5 ml 10  buffer, 4.0 ml dNTP (2.5 mM each), 2.5 ml MgCl2 (2 mM), 2.0 ml each primer (5 mM), 0.25 ml LA Taq (TaKaRa), and 1.0 ml template. The thermal cycle profile was that of a Shuttle and Touchdown PCR consisting of denaturation at 94 1C for 1 min, and annealing and extension combined at the same temperature for 5 min. The temperature for the annealing and extension periods was progressively decreased with advancing cycles (  0.5 1C per cycle) from 68–60 1C during the first 16 cycles and remained at 60 1C during the subsequent 24 cycles (Machida et al., 2004). The PCR products were purified using an ExoSap-IT (USB Corp.) and used as templates for the second step of the semi-nested PCR after dilution with distilled H2O. The second step of the PCR was performed using primers 1368-18S and 34-5.8S [50 CAGTTGGCTGCGCTCTTCATCGA 30 ]. The primer 34–5.8S was newly designed in this study with reference to the aligned sequences from Arthropoda (accession number EF532821), Chordata (U13369), and Nematoda (X03680) deposited in DDBJ/EMBL/GenBank. The reaction was performed in a 15.0-ml volume containing the same mixture as in the mtCOI PCR. A Shuttle and Touchdown PCR was performed with a denaturation at 94 1C for 5 s, and annealing and extension combined at the same temperature for 20 s. The temperature for the annealing and extension was the same as in the first step of the semi-nested PCR. These PCR products were cloned into DH5a cells using the TOPO TA Cloning Kit for Sequencing (Invitrogen) following the manufacturer’s instructions. Individual bacterial colonies were selected using sterilized toothpicks and resuspended in PCR reaction mixtures containing the primers included in the cloning kit. The reaction volumes for these PCRs were scaled down to 10 ml.

2.5. Sequence analysis Two nucleotide sequences determined from both ends of the DNA fragments were assembled using AutoAssembler version 2.1 (Applied Biosystems). The suitability of the assembled sequences as the aimed DNA fragments was verified with DDBJ BLAST version 2.2.1 (http://blast.ddbj.nig.ac.jp). mtCOI and nITS1 se-

2213

quence alignments were performed using ClustalX version 1.83 with default settings (Thompson et al., 1997). Uncorrected pairwise sequence divergences (p) of mtCOI were computed using MEGA4 (Tamura et al., 2007). Genetic maximum likelihood (ML) distances were calculated by General Time Reversible (Rodriguez et al., 1990)+ I+ G with the proportion of invariable sites I¼ 0.2627 and the gamma shape parameter G ¼0.5171 for the construction of a phylogenetic tree. This model was assessed using Akaike’s information criterion (Akaike, 1974) as implemented by MrModeltest 2.3 (Nylander, 2004). From the ML distance, the neighbor-joining method (NJ method) was used to construct a phylogenetic tree. The maximum parsimony method (MP method) was applied with 1000 bootstrap replicates using PAUP* (Swofford, 2002). Support for individual nodes was assessed using 1000 bootstrap replications. A Bayesian approach to phylogeny reconstruction was applied using MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001). The Markov Chain Monte Carlo (MCMC) analysis was performed for 1,500,000 generations with trees sampled every 100 generations. The first 3750 trees sampled were discarded as the burn-in phase. The average standard deviation of split frequencies between two runs of MCMC was less than 0.1% for each analysis, which indicated convergence. Maximum likelihood (ML) methods were conducted with 100 bootstrap replicates using Garli version 0.951 (Zwickl, 2006). Support for internal branches within the ML tree was assessed using 100 bootstrap replicates. Trees were rooted with two chaetognaths, Paraspadella gotoi (AY619710) and Zonosagitta nagae (AB505684). The uncorrected p-distance of nITS1, of which the insertdeletion (indel) sites were treated as informative data, was calculated by MEGA4 (Tamura et al., 2007). From these distances, a phylogenetic tree was constructed using the NJ method and assessed for clade supports by bootstrap analysis with 1000 replicates using NJ, Minimum-Evolution (ME), and MP methods. Nucleotide diversity (p) and average uncorrected p-distance were calculated using MEGA4 (Tamura et al., 2007). 2.6. DNA amplification using population-specific primers Two primers were newly designed based on the 8 individuals with the Form 1 sequences. The first primer [50 TCCAAACGGCGGATCGACCAGAA 30 ] was designed specifically for the nE1 individuals (mtA individuals), while the second primer [50 GAAGAATATTCAGGCGGGACGC 30 ] was designed as a common primer for use with all the individuals. The partial nITS1 sequence was amplified by PCR using the two new primers and 1368-18S.

3. Results 3.1. mtDNA Partial mtCOI sequences were successfully determined in 52 out of 58 specimens (88.1%) (Table 1). A total of 464 bp of the partial mtCOI region were compiled without ambiguous alignment. All 52 individuals had unique haplotypes in their mtCOI gene sequences. Predicted amino acid sequences had no stop codons within the open reading frame using the invertebrate mitochondrial code. Four distinct lineages with robustly supported nodes were evident from the phylogenetic analysis (Fig. 2). Three of these lineages (mtA, mtB, and mtD) were found in specimens collected in the eastern Atlantic basin. The specimens collected in Sagami Bay (western North Pacific) formed an independent lineage (mtC). Nucleotide diversities in the mtA and mtB populations were

2214

H. Miyamoto et al. / Deep-Sea Research II 57 (2010) 2211–2219

Table 1 Sampling information. Station

Date

Latitude

Sampling layer

Analyzed numbera

Accession number

Sampling gear

1400–0 m

1

AB505632

IONESS

o

800–600 m

1

AB505633

ORI-VMPS

o

0–1000 mb

3

AB505634–AB505636

IKMT

o

2000–1000 m 3000–2000 m 1957–998 m 2993–1957 m 3999–2993 m 1985–998 m 3886–1987 m 2062–984 m 2990–2062 m

3 5 6 4 2 2 6 8 11

AB505637–AB505639 AB505640–AB505644 AB505651–AB505656 AB505645–AB505648 AB505649–AB505650 AB505657–AB505658 AB505659–AB505664 AB505665–AB505672 AB505673–AB505683

MOCNESS

Longitude

Sagami Bay T/S Seiyo-Maru, SEII0706 S3 14 Jun 07

139 % 200 N

R/V Tansei-Maru, KT-07-18 S3 30 Jul 07

139 % 200 N

35 % 000 E

M2

o 139 % 310 N

34 % 570 E

1 Aug 07

o

o

Atlantic Ocean R/V Polarstern, ANT-XXXIV/1 2 8 Nov 07

11 % 410 N

3

11 Nov 07

3 % 300 N

4

17 Nov 07

13 % 090 S

5

21 Nov 07

25 % 040 S

a b

o

o

o

o

o

35 % 000 E

20 % 250 W o

15 % 000 W

o

00 % 180 E o

09 % 350 E

The number of sequenced individuals for the cytochrome c oxidase subunit I fragment. Estimated from the wire out.

Fig. 2. Neighbor-joining tree of 52 specimens of Caecosagitta macrocephala based on mtCOI (464 bp) sequences (GenBank accession nos. AB505632–AB505683), obtained using the GTR + I+ G model. Numbers beside major internal branches indicate bootstrap values after 100 replications from MP and ML methods, and Bayesian posterior probability.

higher than those of mtC and mtD (Table 2). Genetic distances (uncorrected p-distance) between each group ranged from 0.17 to 0.34. Of these distances, the values between mtA and the other

lineages were larger than those between mtB, mtC, and mtD. The smallest distance was between the mtB and mtC lineages. Thus, the outgroup was placed between mtA and the other lineages.

H. Miyamoto et al. / Deep-Sea Research II 57 (2010) 2211–2219

3.2. nITS1 From each of the four mtCOI lineages, two specimens were randomly selected (a1, a2, b1, b2, c1, c2, d1, and d2) (Fig. 2) and used for nITS1 analysis. Each specimen had multiple forms of nITS1 and a total of 106 sequences (GenBank accession numbers AB505685–AB505790) were determined from these individuals by cloning experiments (Fig. 3). The length of the determined sequences varied from 165 to 562 bp. A variety of nITS1 sequences was found within each specimen, since the different nITS1s within a specimen had different arrangements of deletion and/or insertion regions, resulting in the observed difference in the length of aligned sequences. These sequences were separated into 10 forms at a genetic distance (p) of 0.25 with the exception of a putative chimera sequence (Fig. 3). All nodes were supported by high bootstrap values. Of the 10 forms, Forms 1 and 10 were shared by all 8 specimens.

2215

Using the sequences belonging to Forms 1 and 10, phylogenetic relationships were estimated after realignment (Fig. 4). Two lineages were separated by long branches with high bootstrap values in both forms; however, one sequence, nG2, was not included in any lineages of Form 10 (Fig. 4). We named these lineages nE1 and nF1 in Form 1, and nE2 and nF2 in Form 10. All sequences in nE1 and nE2 were from the a1 and a2 individuals of the mtA lineage. On the other hand, nF1 and nF2 were composed of sequences determined from mtB, mtC, and mtD individuals. Although the nodes of nE1, nE2, nF1, and nF2 were supported by a 100% bootstrap value, no discernible phylogenetic structure was observed within the lineages.

3.3. DNA amplification using population-specific primers Analysis of the nITS1 region revealed the existence of two clades within C. macrocephala populations. However, the presence

Table 2 Number of specimens, nucleotide diversity, and genetic distance (uncorrected p - distance) of mtCOI lineages. Number of specimens

mtA mtB mtC mtD

27 6 5 14

Genetic diversity (p)

0.054 0.054 0.029 0.022

Uncorrected p – distance

Collection area

mtB

mtC

mtD

0.314 70.021

0.312 7 0.021 0.188 7 0.018

0.306 7 0.021 0.230 7 0.018 0.217 7 0.019

Atlantic Ocean Atlantic Ocean Sagami Bay Atlantic Ocean

7 indicates standard deviation.

Fig. 3. Unrooted neighbor-joining tree of 8 specimens selected from each mtCOI lineage based on nITS1 sequences obtained using uncorrected p – distances (GenBank accession numbers AB505685–AB505790). Numbers beside major internal branches indicate bootstrap values after 1000 replications from NJ, ME, and MP methods. Triangles indicate each form of nITS1.

2216

H. Miyamoto et al. / Deep-Sea Research II 57 (2010) 2211–2219

Fig. 4. Unrooted neighbor-joining tree of 8 specimens based on Form 1 (above) and Form 10 (below) of nITS1 sequences obtained using uncorrected p – distances. Symbols located at the end of each clade correspond to each individual. Numbers beside major internal branches indicate bootstrap values after 1000 replications from NJ, ME, and MP.

of the nF sequence in nE individuals and vice versa cannot be denied because of the limited number of cloned sequences. To fill this gap, a PCR amplification using population-specific primers was performed to demonstrate the absence of the nE1 sequence in nF1 individuals. An agarose gel image of the PCR products is presented in Fig. 5. Approximately 500-bp DNA fragments were amplified from most individuals using the common primer (no amplification was observed from individual 3, which may be due to primer mismatch in the single individual). On the other hand, DNA fragments were amplified only from individuals belonging to the mtA lineage using the population-specific primer (Fig. 5).

4. Discussion

distinct, reproductively-isolated populations hereafter referred to as ‘‘cryptic species’’ or nE- and nF-clades. It was also revealed that the nF-clade further comprised three distinct lineages (mtB–D) with respect to mtCOI sequences with p-distance values of 0.17–0.23, which are comparable to those observed between species of metazoans (Hebert et al., 2003); however, no appreciable structure was noted in the nITS1 region, suggesting the presence of other cryptic species, incipient species, or hybrids after incomplete genetic isolation (discussed in the last section). In the present study of live specimens, we were unable to find morphological differences in major taxonomic characters among the specimens examined. For a formal taxonomic designation and morphological identification of these cryptic species, further study is necessary to characterize their morphological differences.

4.1. Genetic differentiation between populations 4.2. Spatial distribution of C. macrocephala populations Reproductive isolation of populations cannot be verified solely by mitochondrial gene markers, which are inherited maternally (Avise, 2000; Funk and Omland, 2003). The examination of nuclear genetic markers is required to support the genetic discordance of these populations (Palumbi et al., 2001; Chen and Hare, 2008). In the present study, we analyzed both mtCOI and nITS1 sequences of several specimens of C. macrocephala, and the genetic differentiation between individuals belonging to the mtA (nE) clade and the others (nF) was confirmed. In addition, the independent nE1 lineage was further supported by PCR using population-specific and common primers. These results indicate that C. macrocephala, as currently defined, includes at least two

Of the two cryptic species (nE/mtA and nF/mtB+ D) detected among the specimens from the Atlantic, those of the nE-clade (25 of 27 specimens) were collected mostly from deeper ( 4ca. 2000 m) layers while those of the nF-clade (17 of 20 specimens) were from shallower ( o ca. 2000 m) layers (Table 3), depths corresponding to the North Atlantic Deep Water (NADW) and Antarctic Intermediate Water (AIW), respectively (Fig. 6; see also ¨ Wust, 1935; Suga and Talley, 1995; Johnson, 2008). These observations indicate that the two cryptic species have different vertical ranges or inhabit, for the most part, different water masses. Since the mesopelagic zone (500–1000 m) of Sagami Bay,

H. Miyamoto et al. / Deep-Sea Research II 57 (2010) 2211–2219

2217

Table 3 Number of occurrences in each depth layer of each mitochondrial lineage. Station

Lineage

Number of specimens

mtA mtB mtD

1000–2000 m 0 0 3

2000–3000 m 2 1 2

mtA mtB mtD

998–1957 m 0 1 5

1957–2993 m 4 0 0

mtA mtB mtD

998–1985 m 1 0 1

1987–3886 m 6 0 0

mtA mtB mtD

984–2062 m 1 4 3

2990–3992 m 11 0 0

2

3

4

5

Fig. 5. Agarose gel electrophoresis of DNA from 52 specimens amplified by common and specific primers. Numbers above the gel photographs correspond to the individual’s number in Fig. 2.

where we collected our Pacific samples, is occupied by the North Pacific Intermediate Water (Iwata, 1987), the absence of individuals of the nE-clade in Sagami Bay may be either due to the absence of inhabitants from the Pacific Deep Water in our collection or the low number of specimens examined. This necessitates research into the geographic range of the deeper cryptic species (nE-clade) based on stratified samples from both meso- and bathypelagic depths covering the whole distributional range of C. macrocephala. Paleoceanographic evidence and the present distribution of zooplankton suggest that the colonization of bathypelagic waters was among the most recent events within the evolutionary history of macrozooplankton, including chaetognaths, and occurred when the deep sea circulation reached the recent pattern in the Miocene, while their precursors (‘‘mesoplankton’’ in Pierrot-Bults and van der Spoel, 1979) developed with the start

2993–3999 m 2 0 0

of water circulation and cooling in the beginning of the Cenozoic (Pierrot-Bults and van der Spoel, 1979; Pierrot-Bults and Nair, 1991). Assuming this scenario, the present deeper cryptic species is hypothesized to have deviated from a mesopelagic species (precursor or nE- and nF clades) with the establishment of the deep water. The possible mechanisms for this speciation may include an allopatric mode enhanced by advanced oxygen minimum layers or anoxic events in the Eocene and Miocene (White, 1987) and a parapatric/sympatric mode (‘depth parapatry’ or ‘isolation-by-depth’ in Norris, 2000; see also Pierrot-Bults and van der Spoel, 1979) by which speciation occurred without a distinct barrier and was enhanced through selection for two divergent characteristics (e.g., differential adaptations to mesoand bathypelagic environments, e.g., differences in temperature, foods, and predators) that exacts a penalty for intermediate morphotypes (Dieckmann and Doebeli, 1999; Kondrashov and Kondrashov, 1999; Tregenza and Butlin, 1999; Norris, 2000). In contrast to the vertical segregation of the two clades (nE and nF), the individuals assigned as mtB and mtD within the nF-clades were collected from AIW. It is probable that all the individuals from Sagami Bay (mtC) were from the North Pacific Intermediate Water, suggesting that after formation of the nF-clade, further subdivisions took place within the intermediate water, resulting in the two clades, mtD and the precursor of mtB +mtC. It is not known whether the mtC clade represents a distinct ocean-scale population of the Pacific, a local population restricted to Sagami Bay and its vicinities, or an apparent clade due to the geographic gap between Sagami Bay and the Atlantic. Thus, further analysis with a broader geographic coverage is required.

4.3. Discordance between nuclear and mitochondrial markers In the present study, discordance of the nuclear and mitochondrial genetic markers was observed in C. macrocephala populations. Based on the mtCOI gene sequences, four lineages were clearly observed (mtA, mtB, mtC, and mtD). In contrast, such genetic distances were not observed among the populations of mtB, mtC, and mtD based on the nITS1 sequences. Although the evolutionary rate of the mitochondrial genome may vary among different animal groups, the genetic distances observed between the populations of mtB, mtC, and mtD based on the mtCOI gene

2218

H. Miyamoto et al. / Deep-Sea Research II 57 (2010) 2211–2219

Fig. 6. Vertical profiles of temperature (1C) and salinity at Stations 3 and 4.

sequences were much larger ( 40.17) than the species distances generally observed in animals (ca. 0.08, Hebert et al., 2003). Several possible mechanisms have been proposed to explain the discordance between the mitochondrial and nuclear genetic markers including: (1) mitochondrial DNA (mtDNA) introgression, (2) ancient reproductive isolation followed by interbreeding of populations, (3) higher dispersal ability of males than females, and (4) the difference in effective population size between mitochondrial and nuclear genomes. Funk and Omland (2003) pointed out the possibility of the occurrence of deep phylogenetic lineages within a species by mtDNA introgression due to crossings with other species, which can be further maintained by balancing selection (Avise, 2000). In general, such deep phylogenetic lineages produced by cross hybridization in single populations are converged in a single lineage by sorting. Therefore, it is difficult to explain the occurrence of sympatric populations with deep phylogenetic lineages (mtB and mtD) in our study. An exceptional scenario for the above phenomenon can be achieved by balancing selection, which could facilitate multiple haplotype lineages by favoring long-term evolutionary survival. However, we have also analyzed mtCOI gene sequences from various chaetognath species (data not shown), but no identical or similar sequences of mtB, mtC, and mtD from other species have been found. In addition, there seems to be no candidate deep-water species allowing a possible introgression with C. macrocephala. Based on this result, mtDNA introgression is not considered a likely explanation for the present results. A second possibility is ancient reproductive isolation followed by interbreeding of populations. While this scenario is similar to that of mtDNA introgression, this mechanism can be achieved within species to the sub-species level. Interbreeding of once-isolated populations can be achieved if the genetic differentiations among the populations did not reach a level of complete reproductive isolation. Multiple haplotypes would be further maintained in the single population by balancing selection (James and Ballard, 2000; Funk and Omland, 2003). The possibility of a higher dispersal ability of males compared to females cannot be applicable to chaetognaths since they are hermaphrodites. The last possibility is differences in the effective population size between the mitochondrial and nuclear genomes. The effective population size of the mitochondrial genome is a quarter of that of the nuclear genome (Palumbi et al., 2001), indicating

that polymorphisms within the mitochondrial genome will be homogenized much more rapidly than those in the nuclear genome by lineage sorting. Genetic distances were clearly observed between the individuals belonging to the mtB, mtC, and mtD clades based on mitochondrial gene sequences. However, no genetic structure was observed for those individuals based on the nuclear genomic sequences. If differences in effective population size are applicable to our results, the discordance between the mitochondrial and nuclear sequences can be considered as an incipient speciation in the Atlantic and between the Atlantic and Pacific (Sagami Bay) populations. Two mechanisms, ancient reproductive isolation followed by interbreeding of populations and different effective population sizes between the nuclear and mitochondrial genomes, best explained our results. Analysis of highly sensitive nuclear genetic markers, such as amplified fragment length polymorphisms (AFLP) and microsatellite loci, is a practical approach to showing genetic structure that could further support the differences in effective population size between the nuclear and mitochondrial genomes as the leading mechanism in our study. A recent study on pelagic chaetognaths (Peijnenburg et al., 2006) demonstrated the presence of deep mitochondrial lineages, but was not supported by nuclear markers. Thus, this phenomenon may be common among chaetognaths. Furthermore, recent genetic studies on chaetognaths have demonstrated their uniqueness by nuclear genome allopolyploidy (Barthe´le´my et al., 2006, 2007a, b), the occurrence of somatic mutations (Marle´taz et al., 2008), and the strange structure of their mitochondrial genome (Helfenbein et al., 2004; Papillon et al., 2004; Faure and Casanova, 2006; Miyamoto et al., 2010). Further genetic studies on chaetognaths may present a unique mechanism that produces and maintains multiple lineages of genomic information in single populations.

Acknowledgments We would like to thank the captains and crewmembers of the R/V Tansei Maru, F/S Polarstern, and T/S Seiyou Maru, and the researchers who embarked with us for their cooperation at sea. We gratefully acknowledge the support of the Alfred P. Sloan Foundation. Additional support for this project was provided to R. J. M. by the Grant-in-Aid for Scientific Research No. 20241003 from the Japanese Ministry of Education, Culture, Sports, Science,

H. Miyamoto et al. / Deep-Sea Research II 57 (2010) 2211–2219

and Technology (MEXT). The Data Integration and Analysis System from the Japanese MEXT also provided funding to R. J. M. and S. N. This study is a contribution from the Census of Marine Zooplankton (CMarZ), an Ocean realm field project of the Census of Marine Life. References Akaike, H., 1974. New look at statistical model identification. IEEE Transactions on Automatic Control 19 (6), 716–723. Angel, M.V., 1993. Biodiversity of the pelagic ocean. Conservation Biology 7 (4), 760–772. Avise, J.C., 2000. Phylogeography: The History and Formation of Species. Harvard University Press, Cambridge, Massachusetts. Barthe´le´my, R.M., Pe´te´nian, F., Vannier, J., Casanova, J.P., Faure, E., 2006. Evolutionary history of the chaetognaths inferred from actin and 18S–28S rRNA paralogous genes. International Journal of Zoological Research 2 (4), 284–300. Barthe´le´my, R.M., Chenuil, A., Blanquart, S., Casanova, J.P., Faure, E., 2007a. Translational machinery of the chaetognath Spadella cephaloptera: a transcriptomic approach to the analysis of cytosolic ribosomal protein genes and their expression. BMC Evolutionary Biology 7, 16. Barthe´le´my, R.M., Grino, M., Pontarotti, P., Casanova, J.P., Faure, E., 2007b. The differential expression of ribosomal 18S RNA paralog genes from the chaetognath Spadella cephaloptera. Cellular and Molecular Biology Letters 12 (4), 573–583. Bieri, R., 1991. Systematic of the chaetognatha. In: Bone, Q., Kapp, H., Pierrot-Bults, A.C. (Eds.), The Biology of Chaetognaths. Oxford University Press, Oxford, pp. 122–136. Bucklin, A., Astthorsson, O.S., Gislason, A., Allen, L.D., Smolenack, S.B., Wiebe, P.H., 2000. Population genetic variation of Calanus finmarchicus in Icelandic waters: preliminary evidence of genetic differences between Atlantic and Arctic populations. ICES Journal of Marine Science 57 (6), 1592–1604. Bucklin, A., Sundt, R.C., Dahle, G., 1996. The population genetics of Calanus finmarchicus in the North Atlantic. Ophelia 44 (1–3), 29–45. Bucklin, A., Wiebe, P.H., Smolenack, S.B., Copley, N.J., Clarke, M.E., 2002. Integrated biochemical, molecular genetic, and bioacoustical analysis of mesoscale variability of the euphausiid Nematoscelis difficilis in the California Current. Deep-Sea Research I 49 (3), 437–462. Casanova, J.P., 1992. Chaetognaths from Alvin dives in the Santa Catalina basin (California), with description of 2 new Heterokrohnia species. Journal of Natural History 26 (3), 663–674. Chen, G., Hare, M.P., 2008. Cryptic ecological diversification of a planktonic estuarine copepod, Acartia tonsa. Molecular Ecology 17 (6), 1451–1468. Dieckmann, U., Doebeli, M., 1999. On the origin of species by sympatric speciation. Nature 400 (6742), 354–357. Fagetti, E., 1972. Bathymetric distribution of chaetognaths in the South Eastern Pacific Ocean. Marine Biology 17 (1), 7–29. Faure, E., Casanova, J.P., 2006. Comparison of chaetognath mitochondrial genomes and phylogenetical implications. Mitochondrion 6 (5), 258–262. Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3 (5), 294–299. France, S.C., Kocher, T.D., 1996. Geographic and bathymetric patterns of mitochondrial 16S rRNA sequence divergence among deep sea amphipods, Eurythenes gryllus. Marine Biology 126 (4), 633–643. Funk, D.J., Omland, K.E., 2003. Species-level paraphyly and polyphyly: frequency, causes, and consequences, with insights from animal mitochondrial DNA. Annual Review of Ecology Evolution and Systematics 34, 397–423. Goetze, E., 2005. Global population genetic structure and biogeography of the oceanic copepods Eucalanus hyalinus and E. spinifer. Evolution 59 (11), 2378–2398. Goto, T., Terazaki, M., Yoshida, M., 1989. Comparative morphology of the eyes of Sagitta (chaetognatha) in relation to depth of habitat. Experimental Biology 48 (2), 95–105. Haddock, S.H.D., Case, J.F., 1994. A bioluminescent chaetognath. Nature 367 (6460), 225–226. Hebert, P.D.N., Ratnasingham, S., de Waard, J.R, 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London Series B: Biological Sciences 270, S96–S99. Helfenbein, K.G., Fourcade, H.M., Vanjani, R.G., Boore, J.L., 2004. The mitochondrial genome of Paraspadella gotoi is highly reduced and reveals that chaetognaths are a sister group to protostomes. Proceedings of the National Academy of Sciences 101 (29), 10639–10643. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17 (8), 754–755. Issacs, J.E., Kidd, L.W., 1953. Isaacs-Kidd Midwater Trawl. University of California, Scripps Institute of Oceanography, Final Report 1, SIO Ref. 53-3, 18 pp. Iwata, S., 1987. Studies on the short-term variations of oceanic conditions in Sagami Bay. Special Report of Kanagawa Prefectural Fishery Experimental Station 2, 1–66 (in Japanese). James, A.C., Ballard, W.O., 2000. Expression of cytoplasmic incompatibility in Drosophila simulans and its impact on infection frequencies and distribution of Wolbachia pipientis. Evolution 57 (5), 1661–1672.

2219

Johnson, G.C., 2008. Quantifying Antarctic Bottom Water and North Atlantic Deep Water volumes. Journal of Geophysical Research 113, C05027. doi:10.1029/ 2007JC004477. Kasatkina, A.P., 2003. The finding of a new species of Caecosagitta in the Southwestern Bering Sea and a revision of Sagitta macrocephala s. lato (Chaetognatha). Biologiya Morya (Vladivostok) 29 (4), 249–255. Kitamura, M., Tanaka, Y., Ishimaru, T., Mine, Y., Noda, A., Hamada, H., 2001. Sagami Bay Research Report: improvement of multiple opening/closing net, IONESS (Intelligent Operative Net Sampling System). Cruise Reports 10, 149–158 (in Japanese). Kitou, T., 1967. Chaetognatha. In: Motoda, S. (Ed.), Illustration Book of Japanese Marine Plankton: V. Oufu-sha, Tokyo, pp. 40–51 (in Japanese). Kondrashov, A.S., Kondrashov, F.A., 1999. Interactions among quantitative traits in the course of sympatric speciation. Nature 400 (6742), 351–354. Kuriyama, M., Nishida, S., 2006. Species diversity and niche-partitioning in the pelagic copepods of the family Scolecitrichidae (Calanoida). Crustaceana 79 (3), 293–317. Machida, R.J., Miya, M.U., Nishida, M., Nishida, S., 2004. Large-scale gene rearrangements in the mitochondrial genomes of two calanoid copepods Eucalanus bungii and Neocalanus cristatus (Crustacea), with notes on new versatile primers for the srRNA and COI genes. Gene 332, 71–78. Marle´taz, F., Gilles, A., Caubit, X., Perez, Y., Dossat, C., Samain, S., Gyapay, G., Wincker, P., Le Parco, Y., 2008. Chaetognath transcriptome reveals ancestral and unique features among bilaterians. Genome Biology 9 (6). Miyamoto, H., Machida, R.J., Nishida, S., 2010. Complete mitochondrial genome sequences of the three pelagic chaetognaths Sagitta nagae, Sagitta decipiens and Sagitta enflata. Comparative Biochemistry and Physiology, Part D 5(1), 65–72. Norris, R.D., 2000. Pelagic species diversity, biogeography, and evolution. Paleobiology 26(sp4), 236–258. Nylander, J.A.A., 2004. MrModeltest v2. Program distributed by the author. Uppsala University, Evolutionary Biology Centre. Palumbi, S.R., 1992. Marine speciation on a small planet. Trends in Ecology and Evolution 7 (4), 114–118. Palumbi, S.R., Cipriano, F., Hare, M.P., 2001. Predicting nuclear gene coalescence from mitochondrial data: the three-times rule. Evolution 55 (5), 859–868. Papillon, D., Perez, Y., Caubit, X., Le Parco, Y., 2004. Identification of chaetognaths as protostomes is supported by the analysis of their mitochondrial genome. Molecular Biology and Evolution 21 (11), 2122–2129. Peijnenburg, K., Fauvelot, C., Breeuwer, A.J., Menken, S.B.J., 2006. Spatial and temporal genetic structure of the planktonic Sagitta setosa (Chaetognatha) in European seas as revealed by mitochondrial and nuclear DNA markers. Molecular Ecology 15 (11), 3319–3338. Pierrot-Bults, A.C., 1982. Vertical distribution of Chaetognatha in the central Northwest Atlantic near Bermuda. Biological Oceanography 2 (1), 31–61. Pierrot-Bults, A.C., 1997. Biological diversity in oceanic macrozooplankton: more than counting species. In: Ormond, R.F.G., Gage, J.D., Angel, M.V. (Eds.), Marine Biodiversity: Patterns and Processes. Cambridge University Press, New York, pp. 69–93. Pierrot-Bults, A.C., Nair, V.R., 1991. Distribution patterns in Chaetognatha. In: Bone, Q., Kapp, H., Pierrot-Bults, A.C. (Eds.), The Biology of Chaetognaths. Oxford University Press, Oxford, pp. 86–116. Pierrot-Bults, A.C., van der Spoel, S., 1979. Speciation in macrozooplankton. In: van der Spoel, S., Pierrot-Bults, A.C. (Eds.), Zoogeography and Diversity in Plankton. Bunge Scientific Publishers, Utrecht, pp. 114–167. Rodriguez, F., Oliver, J.L., Marin, A., Medina, J.R., 1990. The general stochastic model of nucleotide substitution. Journal of Theoretical Biology 142 (4), 485–501. Suga, T., Talley, L.D., 1995. Antarctic intermediate water circulation in the tropical and subtropical South Atlantic. Journal of Geophysical Research-Oceans 100 (C7), 13441–13453. Swofford, D.L., 2002. PAUP*. Phylogenetic analysis using parsimony (*and other methods),version 4. Sinauer Associates, Massachusetts. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24 (8), 1596–1599. Terazaki, M., Marumo, R., Fujita, Y., 1977. Pigments of mesopelagic and bathypelagic chaetognaths. Marine Biology 41 (2), 119–125. Terazaki, M., Tomatsu, C., 1997. A vertical multiple opening closing plankton sampler. Journal of Advanced Marine Science and Technology Society 3 (2), 127–132. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25 (24), 4876–4882. Tregenza, T., Butlin, R.K., 1999. Speciation without isolation. Nature 400 (6742), 311–312. White, B.N., 1987. Oceanic anoxic events and allopatric speciation in the deep sea. Biological Oceanography 5 (4), 243–260. Wiebe, P.H., Morton, A.W., Bradley, A.M., Backus, R.H., Craddock, J.E., Barber, V., Cowles, T.J., Flierl, G.R., 1985. New developments in the MOCNESS, an apparatus for sampling zooplankton and micronekton. Marine Biology 87 (3), 313–323. ¨ ¨ Wust, G., 1935. Die stratospare, Wissenschaftliche Ergebnisse der Deutschen Atlantischen Expedition auf dem Forschungs- und Vermessungsschiff ‘‘Meteor’’, 1925–1927, vol. 6(1/2), pp. 109–288. Zwickl, D.J., 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Ph.D. Thesis, University of Texas, Austin, TX.