Genetic Diversity and Molecular Detection of Three Toxic Dinoflagellate Genera (Alexandrium, Dinophysis, and Karenia) from French Coasts

Protist, Vol. 153, 223–238, September 2002 © Urban & Fischer Verlag http://www.urbanfischer.de/journals/protist Published online 13 September 2002

Protist

ORIGINAL PAPER

Genetic Diversity and Molecular Detection of Three Toxic Dinoflagellate Genera (Alexandrium, Dinophysis, and Karenia) from French Coasts Laure Guilloua,1,2, Elisabeth Nézanb, Valérie Cueffa, Evelyne Erard-Le Dennc, Marie-Anne Cambon-Bonavitaa, Patrick Gentiend, and Georges Barbiera a

IFREMER, Centre de Brest, DRV/VP/CMM, B. P. 70, 29280 Plouzané, France IFREMER DEL/CC Station de Concarneau, 13 rue de Kérose, 29187 Concarneau Cedex, France c IFREMER DEL/EC/PP Centre de Brest, B. P. 70, 29280 Plouzané, France d IFREMER CREMA de L’HOUMEAU, Place du séminaire, B. P. 5, 17137 L’Houmeau, France b

Submitted September 27, 2001; Accepted June 5, 2002 Monitoring Editor: Donald M. Anderson

The objectives of this study were 1) to study the genetic diversity of the Alexandrium, Dinophysis and Karenia genera along the French coasts in order to design probes targeting specific DNA regions, and 2) to apply PCR-based detection to detect these three toxic dinoflagellate genera in natural samples. Genetic diversity of these toxic taxa was first studied from either cultures or cells isolated from Lugol-fixed field samples. By this way, partial sequences of the large ribosomal subunit (LSU rDNA) including the variable domains D1 and D2 of A. minutum, Alexandrium species inside the tamarensis complex, the D. acuminata complex and K. mikimotoi were obtained. Next, specific primers were designed for a selection of toxic algae and used during semi-nested PCR detection. This method was tested over a 3-month period on water samples from the Bay of Concarneau (Brittany, France) and on sediment from the Antifer harbor (The English Channel, France). Specificity and sensitivity of this molecular detection were evaluated using the occurrence of target taxa reported by the IFREMER (Institut Français de Recherche pour l’Exploitation de la Mer) monitoring network based on conventional microscopic examination. This work presents the first results obtained on the biogeographical distribution of genotypes of these three toxic genera along the French coasts.

Introduction The occurrence of toxic or harmful microalgae in marine waters represents a significant and expanding threat to human health and fishery resources. In 1

Corresponding author; fax 34 932 30 95 55, e-mail: [email protected] 2 Present address; Institut de Ciències del Mar, CISC, Passeig Maritim de la Barceloneta 37–45, 08003 Barcelona, Spain

1984, the French national phytoplankton monitoring network, the REPHY, was created by IFREMER (Institut Français de Recherche pour l’Exploitation de la Mer) as a consequence of several shellfish human poisonings. The responsible organism belongs to the Dinophysis acuminata complex, which embraces different morphotypes and is a diarrheic shellfish poisoning (DSP) toxin producer. This dinoflagellate regularly affects a large part of the French coast, preventing exploitation of shellfish for 1434-4610/02/153/03-223 $ 15.00/0

224

L. Guillou et al.

several months per year. Another toxic dinoflagellate, Alexandrium minutum, was first detected on the French coast in 1985. This species produces potent neurotoxins responsible for paralytic shellfish poisoning (PSP) that may cause muscular paralysis, neurological symptoms and in extreme cases human death. This species recurrently formed toxic blooms in the Northern part of the French Brittany coast until 1988 (Le Doux et al. 1990). Alexandrium catenella and Alexandrium tamarense, two other PSP toxin producers, were previously considered to be rare in the Mediterranean Sea (Margalef and Estrada 1987). However, large toxic blooms were observed in 1998 in the Thau Lagoon (France) associated with a mixed population of A. catenella and A. tamarense, and along 100 km of the Catalan coasts associated with A. catenella (Masselin et al. 2001; Vila et al. 2001). A. catenella is regularly detected along the French and Catalan coasts (Vila et al. 2001). Animal mortalities or growth inhibition of marine fauna due to the presence of the dinoflagellate Karenia mikimotoi (= Gymnodinium nagasakiense and Gymnodinium mikimotoi), which produces hemolytic cytotoxins and mucilage (Erard-Le-Denn et al. 1990) were also regularly detected during the period 1976–2000. In 1995, this species produced a bloom, with several millions of cells per liter, affecting all the French Atlantic coasts. Several hypotheses may explain these increasing occurrences of toxic blooms, such as the eutrophication of the coastal waters which may support the growth of toxic endemic species, and the introduction, via human factors, of foreign competitive taxa (Hallegraeff 1993). Genetic markers have been proved to be very useful to assess biogeographical dispersion of these organisms. As an example, several Alexandrium strains were found to correlate better with the geographic origin of the strains than with their morphotype. Consequently, Alexandrium tamarense, Alexandrium catenella, Alexandrium cohorticula, and Alexandrium fundyense are now grouped to form the tamarensis complex which is subdivided according to the geographical origin of the strains i.e. North American, Western European, Temperate Asian, Tasmanian and Tropical Asian (Scholin et al. 1994; 1995). When genetic diversity is better known, molecular tools may also help to detect the spatial repartition of an organism, both in sea water and in the sediment. Because of their rapidity, PCR-based methods are more and more used. They have been successfully employed to detect various toxic dinoflagellates in natural samples (Bowers et al. 2000; Coyne et al. 2001; Godhe et al. 2001; Oldach et al. 2000; Penna and Magnani 1999; Rollo et al. 1995).

In this study, we first studied the genetic diversity of different species of Alexandrium, Dinophysis and Karenia genera from the French coasts and second, tested a PCR-based method to detect these toxic taxa in natural samples. Genetic diversity was assessed from strains in culture and cells isolated from Lugol-fixed field samples, by comparing a part of the large subunit of the ribosome (LSU rDNA). This region encompasses the hypervariable regions D1 and D2 and a large set of sequences from many dinoflagellate species available in Genbank. Based on the sequences obtained, several specific primers were designed and used in a semi-nested PCR assay, first on cultures and then on field samples. Specificity of the DNA amplifications obtained on natural samples was verified by direct sequencing of the PCR products. This method was tested on sea water from a temporal series of 3 months collected in spring from the Brittany coast (Bay of Concarneau). Because it is now widely recognized that the cyclic development of dinoflagellate blooms forming toxic red tides is often dependent on the presence of in situ seed beds of hypnozygotic resting cysts (Anderson and Keafer 1987), this PCR detection was also tested on sediment. Ecological implications on the geographical distributions of Alexandrium, Dinophysis and Karenia along the French coast based upon their genetic analyses both in culture or from isolated cells as well as from the first sequences retrieved after nested PCR are discussed.

Results Genetic Diversity of Alexandrium, Dinophysis and Karenia spp. along the French Coasts Assessed from Cultures and Cells Isolated from Field Samples Alexandrium spp.: Sequences of A. minutum, A. affine, and A. margalefi obtained from cultures or field samples (Table 1) were closely related with sequences of the corresponding species available in GenBank (Fig. 1). A. insuetum, not previously sequenced, was related to A. ostenfeldii. The sequences of A. catenella obtained from isolates from the Mediterranean Sea coast were closely related to those belonging to the Temperate Asian clade within the tamarensis complex (Fig. 1). There was high similarity between sequences obtained from samples separated by time or space. For example, the two cultures of A. minutum isolated from almost the same area, but 10 years apart (strains AM89BM and AM99PZ), were almost identical except for 2 nucleotide substitutions. In contrast, gene heterogeneities from the same amplification were revealed

PCR-Based Detection of Three Toxic Dinoflagellate Genera

225

Table 1. List of sequences obtained from cultures or field samples (based upon cell isolation from Lugol-fixed samples or nested-PCR amplification). The table lists the sample location, dates and accession numbers. F. = France, M. = Mediterranean Sea, C. = The English Channel, A. = Atlantic Ocean. Species

Origin

Sample location

Date of sampling

Accession number (gene length in bp)

F., Thau Lagoon (M.) F., Thau Lagoon (M.) F., Thau Lagoon (M.) F., Thau Lagoon (M.) F., Bay of Concarneau (A.)

1998 1998 11/09/98 11/09/98 04/26/00

AF318219 (709) AF318220 (709) AF318227 (622) AF318228 (709) AF318265 (269)

F., Bay of Concarneau (A.)

04/26/00

AF318266 (382)

F., Antifer harbor (C.)

03/21/00

AF318267 (400)

F., Morlaix (C.) F., Penzé (C.) F., Bay of Toulon (M.) F., The Rance Estuary (C.) F., Antifer harbor (C.)

1989 1999 12/15/99 07/06/98 03/21/00

AF318221 (717) AF318222 (716) AF318231 (716) AF318232 (716) AF318262 (637)

A. minutum (Amin2) A. minutum (Amin2) A. affine A. margalefi A. insuetum A. insuetum

Culture Culture Lugol sample Lugol sample Nested PCR from water Nested PCR from water Nested PCR from sediment Culture Culture Lugol sample Lugol sample Nested PCR from sediment Nested PCR from water Nested PCR from water Lugol sample Lugol sample Lugol sample Lugol sample

F., Bay of Concarneau (A.) F., Bay of Concarneau (A.) F., Bay of Concarneau (A.) F., Bay of Concarneau (A.) F., Urbino Lagoon (M.) F., Urbino Lagoon (M.)

03/09/00 04/26/00 10/29/99 06/08/98 04/07/99 04/07/99

AF318263 (622) AF318264 (636) AF318229 (711) AF318230 (712) AF318233 (717) AF318234 (720)

Dinophysis spp. D. rotundata D. fortii D. fortii D. tripos D. cf. dens D. caudata D. caudata D. sacculus D. acuminata D. acuminata D. acuminata D. acuminata D. acuminata (Dacu1) D. acuminata (Dacu1)

Lugol sample Lugol sample Lugol sample Lugol sample Lugol sample Lugol sample Lugol sample Lugol sample Lugol sample Lugol sample Lugol sample Lugol sample Nested PCR from sediment Nested PCR from water

F., Bay of Concarneau (A.) F., Bay of Concarneau (A.) South Africa, False Bay F., Bay of Concarneau (A.) F., Bay of Concarneau (A.) F., Bay of Concarneau (A.) F., Urbino Lagoon (M.) F., Urbino Lagoon (M.) F., Bay of Concarneau (A.) F., Antifer harbor (C.) F., Bay of Vilaine (A.) South Africa, False Bay F., Antifer harbor (C.) F., Bay of Concarneau (A.)

10/29/99 10/29/99 06/08/99 10/29/99 10/29/99 10/29/99 Oct 1999 11/15/99 05/20/99 08/24/99 07/19/99 06/08/99 03/21/00 04/26/00

AF318235 (715) AF318236 (731) AF318237 (731) AF318238 (726) AF318239 (730) AF318240 (726) AF318241 (700) AF318242 (730) AF318243 (730) AF318244 (730) AF318245 (730) AF318246 (730) AF318268 (626) AF318269 (619)

F., Bay of Brest (A.) F., Bay of Brest (A.) F., Bay of Concarneau (A.) Tunisia, Bay of Gabes Chile, Canal Costa Italy, Adriatic Sea

1987 1995 04/26/00 1994 Mar 1999 1992

AF318223* (1371) AF318224* (1391) AF318270 (367) AF318225* (1383) AF318247* (1351) AF318226* (1267)

Alexandrium spp. A. catenella A. catenella A. catenella/tamarense A. catenella/tamarense A. catenella/tamarense Temperate Asian (Acat1) A. catenella/tamarense North American (Acat3) A. catenella/tamarense North American (Acat3) A. minutum A. minutum A. minutum A. minutum A. minutum (Amin2)

Karenia spp. and relatives K. mikimotoi Culture K. mikimotoi Culture K. mikimotoi (Kmiki1) Nested PCR from water Karenia sp. Culture Karenia sp. Lugol sample G. corii Culture

*These sequences encompass both the intergenic regions (ITS1, 5.8S and ITS2) and the 5′ portion of the LSU (D1 and D2 parts).

226

L. Guillou et al.

after cloning. For example, a second highly divergent clone of A. insuetum (AF318234) was obtained from the same PCR mixture. Despite its divergence the obtained sequence was still related to that of A. insuetum (Fig. 1). We also obtained three different sequences for A. catenella/tamarense. One sequence was identical in both field (AF318228) and culture samples (AF318219). A second sequence (AF318220) was obtained from a culture. The third

obtained from a field sample (AF318227) was the most divergent in having 98 nucleotide deletions. An identical deletion of 98 nucleotides was found in the sequence U64434 obtained from an Asian strain of A. catenella (sequence deposited in Genbank, unpublished). Therefore, the observed deletion was probably not the result of a PCR error and was also interpreted as the presence of gene heterogeneities found in this group.

Figure 1. Phylogenetic analyses using 43 different Alexandrium sequences (maximum likelihood analysis) derived from an alignment of the partial LSU rDNA (D1-D2 parts). Bootstrap values obtained using neighbor-joining and parsimony analyses, respectively, have been marked at the internal branches (500 replicates, values >70% displayed). Bold numbers correspond to identical bootstrap values in both analyses. Scale bar: 0.1%. The tree is rooted using Prorocentrum micans (X16108). Divergence Maximum Likelihood: mean length 457, ln(L) = –3555.257, Neighbor-Joining: mean length 642, and Maximum Parsimony: 631 steps required, 185 informative sites.

227

PCR-Based Detection of Three Toxic Dinoflagellate Genera

Dinophysis spp.: Based upon LSU rDNA sequences (Fig. 2), no genetic difference was found between typical cells of D. acuminata isolated from the Bay of Concarneau, the more southern Bay of Vilaine, or the English Channel (Antifer harbor), or even from South Africa (False Bay, near Cape Town). All these sequences fell into a clade which also enclosed neighbor species, such as D. sacculus (with identical sequence) and Dinophysis cf. dens (with only three different nucleotides). Dinophysis fortii isolated from France (Bay of Concarneau)

Figure 2. Analyses of 12 different Dinophysis sequences. Maximum Likelihood: mean length 672, ln(L) = –2105.160, neighbor-joining: mean length 718, and Maximum Parsimony: 305 steps required, 45 informative sites. See legend of Figure 1.

or South Africa (False Bay) had exactly the same LSU rDNA sequences. Dinophysis caudata from the Atlantic Ocean (Bay of Concarneau) and the Mediterranean Sea (Urbino lagoon) diverged by two nucleotides. The sequence of Dinophysis rotundata was the most divergent and was always placed outside the clade formed by the other Dinophysis species sequences in our phylogenetic analyses (Fig. 2). Karenia mikimotoi: The LSU rDNA sequence of K. mikimotoi from France (Fig. 3) is identical to those found in cells isolated from Denmark (AF200682), New Zealand (U92249), and Japan (U92247 or AF200681). It had only one nucleotide difference to strains from England (AF200678), Norway (AF200680), and Australia (AF200679). Two cultured strains of K. mikimotoi, isolated eight years apart from the same location, diverged by only two nucleotides in the intergenic regions and by one additional nucleotide in the partial LSU rDNA sequence. The two strains of Karenia sp. from Chile and Tunisia (AF318247 and AF318225 respectively) were closely related to K. cf. mikimotoi isolated from New Zealand (U92250, Fig. 3). Gymnodinium corii, sequenced in this study, is closely related to the non-toxic species (or with unknown toxicity) Gymnodinium simplex, Gymnodinium beii, Gymnodinium linuchae, and Gymnodinium varians. The genera Akashiwo and Karlodinium also formed welldefined clades, characterized by high bootstrap values in both neighbor joining and parsimony analyses.

Table 2. Primers used in this study. Primers situated after the published P. micans sequence (Lenaers et al. 1989). Target group

Standardized primer name or reference after Alm et al. (1996)

Short name Primer sequence (5′ – 3′)

G+C%

eukaryotes

L-K-Euk-25 (P. micans)-a-S-20 L-K-Euk-734 (P. micans)-a-A-20 S-K-Euk-1784 (P. globosa)- a-S-20* I-K-Euk-63 (P. micans)-a-A-20

D1R D2C EITS2 DIR EITS2 REV

ACCCGCTGAATTTAAGCATA CCTTGGTCCGTGTTTCAAGA GTAGGTGAACCTGCVGAAGA TGGGGATCCTGTTTAGTTTC

40 50 50–60 45

Alex1

ACCACCCACTTTGCATTCCA 50

Acat1 Acat3 Amin2 Kare1 Kmiki1 Dino1 Dacu1

GCACTACAATCTCACTGAGG AAGTGCAACACTCCCACCAA AGCACTGATGTGTAAGGGCT CAGTATCGCATCCAGATCAA TCATGCAGAGCAGAAGATCG TTGTGGCAGCAACCAATCCT AACCACAGCAAAGCTTGAGG

Alexandrium spp. L-G-Alex-302 (P.micans)-a-A-20 tamarensis complex Temperate Asian clade L-Ss-Acat-427 (P. micans)-a-A-20 North American clade L-Ss-Acat-448 (P. micans)-a-A-20 A. minutum L-S-Amin-690 (P. micans)-a-A-20 Karenia spp. L-S-Km/b-471 (P. micans)-a-A-20 K. mikimotoi L-S-Kmiki-659 (P. micans)-a-A-20 Dinophysis spp. L-G-Dino-480 (P. micans)-a-A-20 D. acuminata complex L-S-Dacu-668 (P. micans)-a-A-20 *see Guillou et al. 1999

50 50 50 45 50 50 50

228

L. Guillou et al.

Semi-Nested PCR Detection Groups of dinoflagellates were selected for the design of species- and group-specific PCR primers on the basis of their toxicity and occurrence in French coastal waters (Table 2). The Acat1 probe is specific for the toxic Temperate Asian clade and the Acat3 probe for the North American clades within the tamarensis complex. The Dino1 primer targets all Dinophysis species, except D. rotundata. The primer Dacu1 is specific for D. acuminata, D. sacculus and D. cf. dens. Nevertheless, because D. sacculus is absent from the Atlantic and along the French part of the English Channel and because D. cf. dens is

considered as a species of minor importance, this primer mostly amplified the D. acuminata in the sample tested. The Kare1 primer targets the toxic cluster including K. brevis and K. mikimotoi, and the Kmiki1 primer specifically targets K. mikimotoi. All these specific primers had three or more mismatches with the closest relative taxa. Specificity of the probes was tested 1) on all sequences available in Genbank, 2) on strains in culture listed in Table 3, and 3) over 3 months, using natural samples and nested-PCR detection, on a complex assemblage of organisms, including gymnodinoid, peridinoid, prorocentroid and gonyaulacoid taxa (Tables 4, 5).

Figure 3. Analyses of 30 different unarmoured dinoflagellates sequences, including the genera Karenia, Karlodinium, Akashiwo, Gymnodinium and Prorocentrum. Maximum Likelihood: mean length 483, ln(L) = –2926.868, neighbor-joining: mean length 601, and Maximum Parsimony: 480 steps required, 172 informative sites. See legend of Figure 1.

PCR-Based Detection of Three Toxic Dinoflagellate Genera

DNA was readily amplified by semi-nested PCR using all these specific primers, both from the water column and from sediment samples (Fig. 4, Table 5). All sequences obtained using semi-nested PCR were clearly affiliated to the expected target species. The A. minutum sequences obtained from sediment (21 March) or sea water (9 March) were identical and a sequence obtained from sea water (26 April) differed from them by only two nucleotides. All these sequences originating from field samples were close to the sequence of A. minutum from cultures. The sequences obtained with the Acat3 primer from sediment and sea water (26 April) were identical to the A. tamarense sequence (AF200668) from the Faroe Islands (Hansen et al. 2000). The sequence obtained with the Kmiki1 primer from sea water was identical to the other sequences obtained in this study from K. mikimotoi strains. The sequence obtained with the Dacu1 primer from sea water was identical to that of D. acuminata clones from the Bay of Concarneau a few months earlier. The sequence recovered from sediment was clearly affiliated to the Dinophysis genus, but diverged from the sequence obtained from the Antifer harbor in 1999 (by ten nucleotides). A sequence obtained with the Acat1 primer (AF318265, Table 1) was clearly affiliated to the Temperate Asian clade, but multiple sequence appeared after the first

229

120 nucleotides. This multiple sequence could not be resolved even when the reverse primer (Acat1) was used in the sequencing step. A. minutum, K. mikimotoi and the complex D. acuminata were detected in the sea water from 9 March using semi-nested PCR (Table 5). Indeed, Alex1, Amin2, Kare1, Kmiki1, Dino1 and Dacu1 primers produced strong banding amplifications throughout the 9 March to 16 May period. Using the Acat3 specific primer (tamarensis complex, North American clade) and the Acat1 specific primer (tamarensis complex, Temperate Asian clade), amplifications were only obtained after 20 March and 3 April, respectively (Table 5). Then, we compared this semi-nested PCR detection with the direct counting obtained by the French monitoring network, which uses 10 ml sedimentation chambers for cell counts. D. acuminata was first detected on 20 March at 200 cells/l to reach 2,700 cells/l on 3 May (Table 4). Alexandrium spp. and K. brevis or K. mikimotoi were virtually absent or found in very low concentrations in field samples during the study period. Consequently, the presence of these species was checked again on 10 times more volume (100 ml) on the first three dates (9 and 20 March, 3 April 2000, Table 4). A. minutum, and D. acuminata were effectively observed at low concentrations starting from 9 March 2000 and K. mikimotoi from 20 March (Table 4).

Table 3. List of strains in culture or clones used to test the specificity of the semi-nested PCR detection. The cultures are clonal and non-axenic. nd = not determined, f/2 = medium based on Guillard and Ryther (1962), S = salinity. Taxon

Strain name

Alexandrium tamarense A. catenella A. fundyense A. tamarense A. catenella A. minutum A. minutum D. acuminata D. tripos Karenia mikimotoi K. mikimotoi Karenia sp. Gymnodinium corii Heterocapsa triquetra Scrippsiella trochoidea Heterosigma akashiwo Nitzschia sp. Thalassiosira weissflogii

MOG835 ACC08 Gony.7 PLY497A ATT98 AM89BM AM99PZ gene gene GA87TIN GA95TIN GM94GAB

Origin

Japan, Onagawa Bay* Chile, Canal Costa Fundy Bay U.K. Tamar estuary France, Thau lagoon France, Morlaix river France Penzé river France, Bay of Concarneau France, Bay of Concarneau France, Bay of Brest France Bay of Brest Tunisia, Bay of Gabès Italy, Adriatic sea HT99PZ France, Penzé river ST97PZ France, Penzé river HA94CAM France, Camaret nd nd

* kindly provided by Y. Oshima.

Isolated by

Culture conditions

Toxicity

Oshima Y., 1983 Séguel M., 1996 Martin J. Green J. Kulis D. Erard-Le Denn E., 1989 Erard-Le Denn E., 1999 Present study Present study Partensky F., 1987 Erard-Le Denn E., 1995 Erard-Le Denn E., 1994 Boni L. Erard-Le Denn E., 1999 Probert I.,1997 Erard-Le Denn E., 1994 Maestrini S. nd

f/2, 16 °C, S = 34 f/2, 16 °C, S = 34 f/2, 16 °C, S = 34 f/2, 16 °C, S = 34 f/2, 20 °C, S = 37 f/2, 16 °C, S = 34 f/2, 16 °C, S = 26 nd nd f/2, 20 °C, S = 34 f/2, 20 °C, S = 34 f/2, 20 °C, S = 34 f/2, 20 °C, S = 34 f/2, 20 °C, S = 34 f/2, 20 °C, S = 34 f/2, 20 °C, S = 34 f/2, 20 °C, S = 34 f/2, 16 °C, S = 34

yes yes yes no yes yes yes yes no yes yes yes no no no yes nd no

230

L. Guillou et al.

Table 4. Detection of selected dinoflagellates in sea water samples (Concarneau, Men Du) by the Utermöhl method (Utermöhl, 1958, concentrations in cells/l) using 10 ml (upper part of the Table, from 9 March to 16 May 2000) and 100 ml sedimentation chamber (lower part of the table, from 9 March to 3 April 2000). nd: not determined. The uncertainty of the count cells is indicated in parenthesis (95% confidence interval).

On 10 ml sedimentation chamber Alexandrium minutum A. ostenfeldii A. cf. tamarense Dinophysis acuminata complex D. rotundata Karenia brevis K. mikimotoi Ceratium furca C. fusus C. lineatum + C. minutum C. tripos Dissodinium sp. Gonyaulax sp. Gymnodiniaceae Gymnodinium sp. Gyrodinium sp. Heterocapsa triquetra Katodinium sp. Micracanthodinium sp. Prorocentrum gracile P. micans P. triestrium Protoperidinium bipes Protoperidinium sp. + Peridinium sp. Scrippsiella sp. + Ensiculifera sp. + Pentapharsodinium sp. On 100 ml sedimentation chamber Alexandrium minutum A. ostenfeldii A. cf. tamarense Dinophysis acuminata complex D. rotundata Karenia brevis K. mikimotoi

9 Mar 2000

20 Mar 2000

3 Apr 2000

26 Apr 2000

3 May 2000*

16 May 2000

0 0 0 0

0 100 (± 20%) 100 (± 20%) 200 (± 14%)

0 0 0 0

0 0 0 100 (± 20%)

300 (±11%) 0 0 2,700 (± 4%)

0 100 (± 20%) 0 400 (± 10%)

0 0 0 0 0 0 0 0 0 500 (± 9%) 300 (± 11%) 500 (± 9%) 100 (± 20%) 400 (± 10%) 0 100 (± 20%) 200 (± 14%) 0 100 (± 20%)

0 0 0 0 100 (± 20%) 100 (± 20%) 0 0 700 (± 7%) 3,200 (± 3%) 2,700 (± 4%) 3,500 (± 3%) 400 (± 10%) 3,500 (± 3%) 300 (± 11%) 0 200 (± 14%) 0 300 (± 11%)

0 0 0 0 0 0 0 0 0 200 (± 14%) 0 100 (± 20%) 0 1,500 (± 5%) 0 0 0 0 0

0 0 0 0 0 0 100 (± 20%) 0 0 400 (± 10%) 0 200 (± 14%) 0 1,300 (± 5%) 0 0 100 (± 20%) 0 0

0 0 0 100 (± 20%) 500(± 9%) 0 0 100 (± 20%) 0 0 0 100 (± 20%) 200 (± 14%) 200 (± 14%) 0 0 0 100 (± 20%) 100 (± 20%)

0 100 (± 20%) 0 0 1,600 (± 5%) 0 0 100 (± 20%) 0 0 900 (± 6%) 400 (± 10%) 0 2,900 (± 4%) 0 0 200 (± 14%) 0 0

100 (± 20%) 800 (± 7%) 11,000 (± 2%) 6,300 (± 2%)

0 0

1,300 (± 5%) 300 (± 11%) 0 0

100 (± 20%) 0

30 (± 36%) 10 (± 63%) 20 (± 45%) 30 (± 36%)

40 (± 32%) 20 (± 45%) 50 (± 28%) 250 (± 13%)

20 (± 45%) 0 0 40 (± 32%)

nd nd nd nd

nd nd nd nd

nd nd nd nd

0 0 0

10 (± 63%) 0 40 (± 32%)

0 0 20 (± 45%)

nd nd nd

nd nd nd

nd nd nd

* Bloom of Pseudo-nitzschia fraudulenta (55,000 cells/l) and Rhizosolenia setigera/R. pungens (63,000 cells/l).

Discussion Genetic Diversity of the Genus Alexandrium along the French Coasts The most common Alexandrium species along French waters have been sequenced (five different

species including additional sequences of the most toxic species A. minutum and A. catenella/tamarense), with the exception of an atypical species we named A. cf. tamarense. The morphology of A. cf. tamarense is different from the typical A. tamarense because of: (i) rounded instead of irregular pentago-

231

PCR-Based Detection of Three Toxic Dinoflagellate Genera

Table 5. Comparison between microscopy (in 10 or 100 ml, left) and PCR detection (right) of different toxic clades from water and sediment. + = positive detection, – = negative detection, * = PCR products which were confirmed by direct amplification and sequencing, nd = not done because the characterization is impossible or difficult based upon morphological considerations. Medium gray color indicate equivalent results and dark gray color indicate that PCR-based detection was more sensitive than morphological detection.

(detected on 100 mL)

20 Mar 2000

(detected on 100 mL)

3 Apr 2000

(detected on 100 mL)

26 Apr 2000

(detected on 10 mL)

3 May 2000

(detected on 10 mL)

16 May 2000

(detected on 10 mL)

21 Mar 2000

(detected on 10 mL)

Alexandrium spp. A. minutum A. tamarense (Temperate Asian) A. tamarense (North American) Dinophysis spp. D. acuminata complex Karenia spp. K. mikimotoi

Sediment (Antifer Harbor)

9 Mar 2000

Water samples (Bay of Concarneau)

+ +

+ +*

+ +

+ +

+ +

+ +

-

+ +*

+ +

+ +

+ -

+ +

nd nd

+ +*

nd

-

nd

-

nd

+

nd

+*

nd

+

nd

+

nd

+

nd +

+

nd +

+ +

nd +

+ +

nd +

+* +

nd +

+ +

nd +

+ +

nd nd

+* +

+ -

+ + +

+ + +

+ + +

+ + +

+ + +

+ -

+* + +*

+ -

+ + +

+ + -

+ + +

nd nd nd

+* +

nal shape of cells; (ii) the long and rather narrow apical pore plate with a long comma-shaped apical pore; (iii) the short, wider than long sulcal posterior plate with most often a connecting pore connected via a thin line to the sulcal right posterior plate rather than a groove connected to the fifth postcingular plate (5”’); and (iv) the small ventral pore indenting both the plates 1’ and 4’ but located above the midpoint of the suture 1’/4’. A similar cell morphology was observed from Limfjord by Moestrup and Hansen (1988) and reported as A. tamarense. Alexandrium is the unique genus analyzed in this study in which DNA heterogenetities have been found. Two levels of heterogenities were detected. The first one was represented by highly divergent sequences, as observed in A. insuetum. This type of gene, with a large number of mutations, including large insertions and deletions, has previously been observed in A. minutum and interpreted as a pseudogene (Zardoya et al. 1995). Another gene heterogeneity was found in a clonal culture and cells isolated from natural samples of A. catenella. These genes differed by few nucleotides or by a large dele-

tion. This type of variability has been repeatedly reported in the tamarensis complex in the North American and Temperate Asian clades, and proved to result from the co-occurrence of different type of ribosomes within the same strain (Scholin et al. 1994; Scholin and Anderson 1996; Uribe et al. 1999). The AF318227 sequence obtained in this study is one of these heterogeneous genes found within the Temperate Asian clade, with a very large deletion of 98 nucleotides. This sort of gene heterogeneity is probably responsible for the double sequence obtained in our study after semi-nested PCR amplification using the Temperate Asian specific (Acat1) probe. Indeed, multiple sequences became visible when this deletion occurs. The presence of the Temperate Asian clade in the Mediterranean Sea suggests that the recent occurrence of toxic bloom events of A. catenella/tamarense is the result of an introduction of this species from Temperate Asian populations. The presence of this clade was also detected by semi-nested PCR on the Atlantic coast and in the Southern English Channel, demonstrating for the first time in France,

232

L. Guillou et al.

that this genotype is not restricted to the Mediterranean Sea. Similarly, the presence of species belonging to the North American clade was also detected both on the Brittany coast and in the Antifer harbor by semi-nested PCR. This confirms previous work (Higman et al. 2001; Medlin et al. 1998) which provided evidence, based on rRNA sequences, that some toxic strains isolated from the North of Scotland and UK waters, respectively, revealed close genetic relationship with sequences belonging to the North American clade. This clade distribution may be explained by 1) a recent introduction of these organisms, or 2) by the presence of a large and continuous East-West population in the Atlantic Ocean. The French coasts appear to have heterogeneous genetic stocks of toxic Alexandrium. This genetic complexity was also described by Scholin et al. (1994), who observed that A. tamarense and A. catenella cultures isolated from Japan displayed sequences associated with Australian, North American and Western European clades, and provided a similar example of how one particular region may have diverse, heterogeneous toxic populations. This diversity was interpreted as an introduction to Japan

from genetically divergent sources caused by transoceanic shipping or aquaculture. There are multiple vectors to import toxic species. For example, engulfed A. tamarense may survive passage through the gut of oysters (Laabir and Gentien 1999) or mussels (Scarratt and Scarratt 1993). In France, the Japanese oyster (Crassostrea gigas) was introduced on a large scale from 1971 to 1975 to replace the cultivation of the Portuguese oyster (C. angulata), which was affected by a viral disease (Grizel and Héral 1991). Other species were also introduced during the same period, such as the annelid Hydroides enzoensi, the cnidarian Aiptasia pulchella, the mollusc Anomia chinensis, the cirripedes Balanus amphitrite and B. albicostatus, and the algae Laminaria japonica, Undaria pinnatifida and Sargassum muticum (Grizel and Héral 1991). In this context, we can suppose that several microscopic species such as the toxic A. catenella may have been introduced the same way from Asia to the Mediterranean Sea or French Atlantic coasts. Another hypothesis is suggested by the work of Fenchel et al. (1997) and Lee and Patterson (1998). They recorded that ciliates and heterotrophic flagel-

Figure 4. Semi-nested PCR results obtained for sea water sampled in the Bay of Concarneau on 26 April 2000. First and last lanes: ladder 100 bp (Eurogentec, Belgium). Control 1, without DNA template and the D1R + Alex1 primers. Control 2, with DNA template but without specific primer (with only the D1R primer). The other lanes correspond to the different specific primers used in combination with the eukaryotic primer D1R specific to the taxonomic group written vertically. Alex1: Alexandrium spp., Acat1: Temperate Asian clade inside the tamarensis complex, Acat3: North America clade inside the tamarensis complex, Amin2: A. minutum, Kare1: Karenia spp., Kmiki1: K. mikimotoi, Dino1: Dinophysis spp., Dacu1: D. acuminata complex. Number close to the bands indicated the exact size of the expected specific DNA amplication. Asterisks signal the PCR products which were confirmed by direct amplification and sequencing.

PCR-Based Detection of Three Toxic Dinoflagellate Genera

lates, respectively, have a cosmopolitan distribution, but a low global species richness. The geographical groups defined for the A. tamarensis complex by Scholin et al. (1994) and Adachi et al. (1996) are based on genetic analyses of strains in culture, which were mostly obtained after blooms. These clades may be the result of environmental pressure and could represent the possibility for one strain to bloom in one particular region, while the stock of Alexandrium strains could be almost identical in all coastal waters. Pushing the reasoning one step further, we can hypothesize that all or at least many (toxic) species could be present in all suitable environments and may produce toxic blooms when the environmental conditions become favorable.

Genetic Diversity of the Genus Dinophysis along the French Coasts In contrast to Alexandrium spp., the LSU rDNA gene is highly conserved for the genus Dinophysis. Identical sequences were found for all D. acuminata in spite of their very different geographical origins (French Atlantic coastal waters, the English Channel and South Africa), except for the sequence recovered from direct amplification from the Antifer harbor sediment (which differ by ten nucleotides). In situ observations confirmed the presence of D. acuminata in this harbor, and more genetic and morphological characterization of this strain are necessary. The two nucleotide difference between the two D. caudata sequenced in this study demonstrate that populations from the Atlantic Ocean and Mediterranean Sea are divergent. By contrast, no genetic difference was found between the two species D. acuminata and D. sacculus. The only morphological character distinguishing D. sacculus and D. acuminata is the shape of the large hypothecal plates. Finally, the most suitable discrimination of these two species is geographical since D. sacculus is probably restricted to the Mediterranean Sea while D. acuminata is more characteristic of colder waters (Zingone et al. 1998). This geographical discrimination is not supported in our analysis. More variable parts, such as the internal transcribed spacers of the ribosomal operon, are probably needed to better discriminate between these two species. The most divergent sequence is Dinophysis rotundata. This species most likely belongs to the genus Phalacroma Stein, now considered as a synonym of the genus Dinophysis, due to overlapping morphologies and identical plate tabulations (Abé 1967; Balech 1967). Nevertheless, some authors still consider these two genera as separate based upon morphological and ecological considerations (Hallegraeff

233

and Lucas 1988; Steidinger and Tangen 1996). Our results favor this separation, but other species must be sequenced before a firm conclusion can be reached.

Genetic Diversity of Karenia mikimotoi along the French Coasts Like a previous study by Hansen et al. (2000), we found that all Karenia mikimotoi sequences from France were almost identical in their LSU rDNA regions from organisms with very different geographical origins. Our analyses confirmed the validity of the genera Karenia and Karlodinium erected by Daugbjerg et al. (2000), both of them erected by high bootstrap values. Nevertheless, the K. brevis clade seems to include several other strains, which have been named K. brevis, K. cf. mikimotoi or Karenia sp., that must be described based upon morphological data. Also, more variable regions are needed to separate this genus at the species level.

Semi-Nested PCR-Based Methods PCR-based detection provided equivalent results or was more sensitive than morphological detection in all cases (Table 5). In particular, the PCR-based method allowed specific detection of clades within the A. tamarense/catenella complex, whereas morphological characters failed to distinguish between these two species. In this context, it is difficult to compare PCR-based method and morphological detection results. For example, we do not know if A. cf. tamarense, detected on 9 and 20 March 2000 in the water sample from the Bay of Concarneau, targets the A. tamarensis complex probes designed in this study. Until now, this organism was always present at very low concentration along the French coast and never correlated to shellfish toxicity. The nested-PCR method applied in this study allows the detection of toxic dinoflagellates in the water column at very low concentration. In our case, when we applied the semi-nested PCR method to 500 ml of sample, the detection limit was below 15 cells/l for the complex D. acuminata and A. minutum, and below 10 cells/l for K. mikimotoi after our counting calibration. These species were detected even during the diatom bloom in May, although their relative abundance was low. PCR-based methods are very sensitive, and do not require the use of cloning and incubating steps. Consequently, they can be used advantageously to study the biogeography of a particular species at large geographical scales in both sea water and sediment or monitor cryptic species which are very difficult to observe by classical meth-

234

L. Guillou et al.

ods. These PCR-based methods can be efficiently coupled with DNA fingerprinting methods, such as Restriction Fragment Length Polymorphism (RFLP, Godhe et al. 2001), Heteroduplex Mobility Assay (HMA, Oldach et al. 2000), Single Strand Conformation Polymorphism (SSCP, Oldach et al. 2000) or Denaturing Gradient Gel Electrophoresis (DGGE, Coyne et al. 2001). SSCP and DGGE techniques are particularly advantageous because they allow the separation of DNA with identical size but different nucleotide composition. As an example, these techniques may allow the separation of different ribosomal gene types when intra-specific variabilities occur, as is the case for the genus Alexandrium. These techniques may also help in the rapid characterization of the different species amplified using genus-specific primers, without the need for more species-specific primers. However, PCR-based methods are not useful to discriminate between reproductive, resistant or vegetative cells. Alexandrium spp. are well-known for producing cysts (Anderson 1998). However, formation of resistant cells in Dinophysis is suspected, but has not been clearly demonstrated yet (Subba-Rao 1995); especially because this genus cannot be maintained in culture for long time. Nevertheless, in our case, we are unable to assert that positive amplification from the sediment came only from whole cells, and consequently resistant cysts or free DNA. Other molecular techniques, such as fluorescent in situ hybridization which conserve the whole cells, must be employed in this case. Probes designed in this study may possibly also be used for this purpose.

Methods Microalgal cells: Alexandrium and different strains of unarmoured gymnodinoid species came from either unialgal cultures or Lugol-fixed field samples. Dinophysis spp. were obtained from Lugol-fixed field samples as it is non cultivable to date (Tables 1, 2). Throughout this text the term “clone” refers to a recombinant plasmid. Cultures were routinely maintained in f/2-enriched medium (Guillard and Ryther 1962) under controlled conditions (18 °C ± 1 with artificial light at 90 µmol of photons m–2 s–1, 12/12 h light/dark). Field samples were recovered over at least 18 months by the IFREMER monitoring network laboratories. Samples were collected with a Hydrobios bottle from the surface layer, and fixed with a 0.1% final concentration of Lugol (Lugol stock solution: 100 g of KI in 1 l of distilled water, 50 g of crystalline iodine, and 100 ml of glacial acetic

acid). Two field samples from Chile and South Africa were kindly provided by Miriam Seguel (IFOP Balmacceda, Puerto Montt, Chile) and Grant Pitcher (SFRI, Cape Town, South Africa) respectively. Clones from field samples and cultures are available on request (G. Barbier and E. Erard-Le Denn, respectively). PCR amplification on entire fixed cells: The PCR amplifications done directly with whole cells followed a protocol modified after Galgani et al. (1994). Culture samples were fixed with Lugol during the exponential phase. Cell suspensions (5 µl) were rinsed twice in distilled water by centrifugation and then directly mixed with the PCR solution consisting of Taq buffer including 1.5 mM MgCl2, 100 µM of each deoxynucleotide triphosphate and 1 U of Taq polymerase (Quantum Appligene, France) in a 25 µl final volume. Cells (1 to 30 cells) from field Lugolfixed samples were isolated with a capillary under a light microscope, rinsed three times in sterile distilled water under a binocular microscope and directly placed into the 200 µl PCR tube. Water was then removed by centrifugation and the cells were rinsed in PCR buffer overnight. The cells were pelleted again and mixed with the PCR solution. In the case of Dinophysis spp., the cell wall was crushed before being mixed with PCR solution using a pellet pestle adapted for PCR tubes (Kontes, Vineland, New Jersey) after freezing of the cells in liquid nitrogen. PCR reactions were performed in a RoboCycler® Gradient 96 Temperature cycler (Stratagene, CA). A first set of primers (primers D1R and D2C, Table 3) allowed the amplification of the D1-D2 part of the LSU rDNA. A second set of primers (EITS2DIR-D2C) was used in order to extend this amplification to the intergenic regions, encompassing the ITS1, the 5.8S and the ITS2 for some strains. All primers used in this study were synthesized by Eurogentec (Seraing, Belgium) and used at 12.5 pmol each per reaction. For an optimal amplification, the denaturation step was increased to 12 min, followed by 30 cycles (denaturation: 94 °C for 1 min, annealing: 54 °C for 2 min, elongation: 72 °C for 3 min) and a final elongation at 72 °C for 10 min. Cloning and sequencing: PCR products were cloned (TOPO TA cloning kit, Invitrogen, Groningen, The Netherlands) according to the recommendations of the manufacturer, except for the AF318241 and AF318237 sequences, which were directly reamplified after DNA purification and sequenced in both directions. At least three positive clones were sequenced in both directions. For Alexandrium spp., the cloning step was followed by restriction profile

PCR-Based Detection of Three Toxic Dinoflagellate Genera

analysis (Scholin and Anderson 1996) of 20 clones. Inserts were amplified from clones and 10 µl of the resulting PCR was used in combination with the enzyme buffer diluted in sterile Milli-Q water (up to 20 µl final volume) and 4 units of either the Nsp I or the Tru 9I (isoschizomer of Mse I) enzymes (BiolabsOzyme, Saint Quentin-en-Yvelines, France; Eurogentec, Seraing, Belgium, respectively). Digestions proceeded overnight at 37 °C and at 65 °C, respectively. After purification of PCR product, DNA sequencing was carried out by Genome Express S.A., Grenoble, France. The clones with different profile patterns were sequenced using the primers D1R and D2C, and additionally EITS2REV and EITS2DIR to include intergenic regions (Table 3). Alignment and phylogenetic analyses: The sequences obtained were aligned in three separate datasets (one for each group) with other related sequences published in GenBank (the Prorocentrum micans sequence, X16108, was in all cases used as an alignment reference). Alignments were done by visual inspection using the SEAVIEW software (Galtier et al. 1996) with reference to the secondary structure of P. micans (Lenaers et al. 1989) and are available upon request. Neighbor-joining (NJ), maximum parsimony (MP) and maximum likelihood (ML) analyses were conducted on each data base using the PHYLO_WIN software (Galtier et al. 1996). For the neighbor-joining method, the options “Pairwise gap removal” and the Jukes and Cantor corrections were used to compute evolutionary distances. Bootstrap analyses (500 replicates) were conducted in both the neighbor-joining and parsimony analyses. Bootstrap values from NJ and MP have been reported on the tree obtained using the ML. Primer design: Specific primers were deduced from the alignments (Table 3) and tested both on NCBI using BLAST 2.0 search (http://www.ncbi.nlm. nih.gov/BLAST/) and on RDP using probe match (http://www.cme.msu.edu/RDP/html/index.html). When it was possible, they were chosen with a 20mer length and a GC% content equal to 50 to achieve more uniform annealing temperatures during the PCR. Monitoring of the Bay of Concarneau (France) sampling station: Surface sea water samples (2 l) were collected from the Bay of Concarneau (Men Du site, Atlantic Ocean) and fixed with Lugol (1 ml/l) every 2 weeks for 3 months (March to May 2000). For the same dates, enumeration of target toxic dinoflagellates were performed by the French monitoring network (the REPHY).

235

Sediments from Antifer harbor: To obtain sediment potentially rich in cysts, we decided to use a sample from the Antifer harbor, English channel, which is considered to favor the accumulation of toxic species, particularly the genus Dinophysis (the proliferation of D. acuminata occurs every year). The sediment was collected in March 2000, during a period when Alexandrium spp. were absent in the overlaying sea water from September 1999, and Dinophysis spp. or Karenia spp. from October 1999. The upper 15 cm of sediment was collected on 21 March 2000 and stored at 4 °C until analysis. The sediment was composed of fine organic and inorganic particles. DNA extraction from field samples: Fixed sea water samples (500 ml) were pre-filtered by gravity on 100 µm net and then collected onto 10 µm filters, which were then washed twice with sterile sea water, without allowing them to dry. DNA was extracted using a 3% CTAB (cetyltrimethylammonium bromide) extraction procedure (Doyle and Doyle 1987). Pelleted DNA was resuspended in 100 µl sterile Milli-Q water and then stored at –20 °C until required. Crude sediment was processed directly by the 3% CTAB procedure using 5 g of sediment. Initial attempts to amplify DNA were unsuccessful. A further purification step was performed using cesium chloride (CsCl) density gradient centrifugation. DNA was mixed in 3 ml of TE buffer (100 mM Tris, 50 mM EDTA pH 8.0) containing 1.075 g/ml CsCl and transferred to bell-top Quick-Seal centrifuge tubes (Beckman, Palo Alto, California). The sample was supplemented with 200 µg of purified Escherichia coli DNA (strain B, Sigma, Saint-Louis, Missouri) and 30 µl of 10 mg/ml ethidium bromide (EtBr) in order to assure DNA visibility after the centrifugation (Juniper et al. 2001). Tubes were centrifuged at 400,000 × g for 12 h at 15 °C. The CsCl gradient was then viewed under UV illumination and the rose-colored DNA layer was removed by piercing the side of the tube with a 2 ml syringe. EtBr was removed by 6 sequential washes by centrifugation after addition of an equivalent volume of isopropanol saturated with CsCl. The sample was purified by dialysis overnight using Cellu·Sep H1 tubular membranes (Poly Labo, Strasbourg, France) in 2 l of TE (10 mM Tris-HCl pH 7.4, 2 mM EDTA pH 8.0) at room temperature. Very low concentrations of DNA were obtained from sediment and sea water samples using the CTAB extraction technique (less than 0.4 µg of DNA after extraction of 0.5 l of water or 5 g of sediment). Semi-nested PCR: Because the amount of DNA to be tested was very low, semi-nested PCR was

236

L. Guillou et al.

necessary. A first round of PCR using general eukaryotic primers was used to amplify the target gene (the D1 and D2 parts of the LSU rDNA). This PCR produced enough DNA for testing the array of specific primers designed in this study. The second amplification used purified PCR product obtained from the first amplification, the species-specific primer (reverse) and the eukaryotic primer D1R to specifically detect the presence of the target species. The method was simplified to make it more practical and reproducible at large scales, i.e. i) a single PCR mixed containing the Taq buffer, the MgCl2, the deoxynucleotide triphosphate, the eukaryotic primer and the Taq polymerase was prepared in all cases, and consequently ii) the specificity of the PCR detection was optimized by altering the annealing temperature. Semi-nested PCR was first tested on target and non-target cultures or clones (Table 3). The D1-D2 part of the LSU rDNA gene was amplified using general eukaryotic primers, from extracted genomic DNA, using an initial denaturation of 5 min at 94 °C, 34 cycles (denaturation: 1 min at 94 °C, annealing: 2 min at 54 °C, elongation: 3 min at 72 °C) and a final elongation of 10 min at 72 °C. PCR products were purified using the QIAquick PCR purification Kit (Qiagen, Courtaboeuf, France) following the manufacturer’s protocol. DNA concentrations were measured with a GeneQuant spectrophotometer and adjusted to 10 ng/µl, and then stored at –20 °C until required. For the second amplification, the specific primer (the reverse side) was used in combination with the eukaryotic primer D1R (direct side). Parameters were as follows: initial denaturation step (5 min at 94 °C), 30 cycles (denaturation: 30 s at 94 °C, annealing: 1 min at 65 °C, elongation: 1.30 min at 72 °C), final elongation (10 min at 72 °C), reaction volume of 25 µl. PCR products were visualized by electrophoresis on EtBr-stained 2% agarose gels (Sigma) in 1× TAE buffer (0.04M Tris acetate, 0.001 M EDTA pH 8.0) followed by examination under UV radiation provided by a Fluor-S MultiImager (BioRad, Ivry sur Seine, France). Annealing temperatures were optimized along a temperature gradient from 54 °C to 66 °C using 10 ng of purified DNA from the first PCR. The optimal annealing temperature for each primer was determined from tests on the cultures and clones listed in Table 3. The total amount of DNA amplified from target species decreased significantly if the annealing temperature was above 66 °C. At 65 °C, all primers amplified specifically, i.e. non-target species did not yield any product and the amplified DNA fragments were of the expected sizes. The semi-nested PCR detection was then performed using this temperature on all natural

samples (Fig. 4). For field samples (sea water and sediment), the first round consisted of 5 independent PCR amplifications and the total amount of DNA was pooled for the purification step using the QIAquick PCR purification Kit. The second round of PCR was done in duplicates, using two different PCR mixes. Two different controls were used, i.e. i) without DNA template but with the eukaryotic and the Alex1 primers and ii) with DNA template but without specific primer (with only the D1R primer). To ensure that the species was specifically amplified, some of the PCR results obtained from sea water and sediment were directly re-amplified (without prior purification of the band) using 1 µl of the DNA product and directly sequenced using the D1R primer (Table 1). Some of the PCR products were confirmed by the PCR reamplification and direct sequencing.

Acknowledgements We thank Marie-Pierre Crassous for culture assistance, the IFREMER coastal laboratories for collecting field samples, Liliane Fiant for collecting sediment, Edmond Lascaris for English correction, and Carlos Pedrós-Alió, Patrick Lassus and Daniel Vaulot for critically reading this manuscript.

References Abé TH (1967) The armoured Dinoflagellata. II. Prorocentridae and Dinophysidae. Publ Seto Mar Biol Lab 14: 369–389 Adachi M, Sako Y, Ishida Y (1996) Analysis of Alexandrium (Dinophyceae) species using sequences of the 5.8S ribosomal DNA and internal transcribed spacer regions. J Phycol 32: 424–432 Alm EW, Oerther DB, Larsen N, Stahl DA, Raskin L (1996) The oligonucleotide probe database. Appl Environ Microbiol 62: 3557–3559 Anderson DM (1998) Physiology and Bloom Dynamics of Toxic Alexandrium Species, with Emphasis on Life Cycle Transitions. In Anderson DM, Cembella AD, Hallegraeff GM (eds) Physiological Ecology of Harmful Algal Blooms. Springer-Verlag, Berlin, Heidelberg, pp 29–48 Anderson DM, Keafer BA (1987) An endogenous annual clock in the toxic marine dinoflagellate Gonyaulax tamarensis. Nature 325: 616–617 Balech E (1967) Dinoflagellados nuevos o interesantes del Golfo de México y Caribe. Rev Mus Argent Cienc Nat B Rivadavia Inst Nac Invest Cienc Nat Hidrobiologia 2: 77–126

PCR-Based Detection of Three Toxic Dinoflagellate Genera

Bowers HA, Tengs T, Glasgow HB, Burkholder JM, Rublee PA, Oldach DW (2000) Development of realtime PCR assays for rapid detection of Pfiesteria piscicida and related dinoflagellates. Appl Environ Microbiol 66: 4641–4648 Coyne KJ, Hutchins DA, Hare CE, Cary SC (2001) Assessing temporal and spatial variability in Pfiesteria piscicida distributions using molecular probing techniques. Aqua Microb Ecol 24: 275–285 Daugbjerg N, Hansen G, Larsen J, Moestrup Ø (2000) Phylogeny of some of the major genera of dinoflagellates based on ultrastructure and partial LSU rDNA sequence data, including the erection of three new genera of unarmoured dinoflagellates. Phycologia 39: 302–317 Doyle JJ, Doyle JL (1987) A rapid DNA isolation for small quantities of fresh leaf tissue. Phytochem Bull 19: 11–15

237

synthetic, neritic and non-photosynthetic, oceanic species. Phycologia 27: 25–42 Hansen G, Daugbjerg N, Henriksen P (2000) Comparative study of Gymnodinium mikimotoi and Gymnodinium aureolum, comb. nov. (=Gyrodinium aureolum) based on morphology, pigment composition, and molecular data. J Phycol 36: 394–410 Higman WA, Stone DM, Lewis JM (2001) Sequence comparisons of toxic and non-toxic Alexandrium tamarense (Dinophyceae) isolates from UK waters. Phycologia 40: 256–262 Juniper SK, Cambon MA, Lesongeur F, Barbier G (2001) Extraction and purification of DNA from organic rich subsurface sediments (ODP Leg 169S). Mar Geol 174: 241–247 Laabir M, Gentien P (1999) Survival of toxic dinoflagellates after gut passage in the Pacific Oyster Crassostrea gigas Thunburg. J Shellfish Res 18: 217–222

Erard-Le-Denn E, Morlaix M, Dao JC (1990) Effects of Gyrodinium cf. aureolum on Pecten maximus (Post Larvae, Juveniles and Adults). In Graneli E, Sundstrom B, Edler L, Anderson DM (eds) Toxic Marine Phytoplankton. Elsevier Science Publishing, pp 132–136

Le Doux M, Frémy JM, Nézan E, Erard E (1990) Recent occurrences of paralytic shellfish poisoning (PSP) toxins from the northwestern coasts of France. J Shellfish Res 8: 486

Fenchel T, Esteban GF, Finlay BJ (1997) Local versus global diversity of microorganisms: cryptic diversity of ciliated protozoa. Oikos 80: 220–225

Lee WJ, Patterson DJ (1998) Diversity and geographic distribution of free-living heterotrophic flagellates – Analysis by PRIMER. Protist 149: 229–244

Galgani F, Vincent F, Minier C (1994) Direct polymerase chain reaction from live algae. J Mar Biotechnol 2: 1–5

Lenaers G, Maroteaux L, Michot B, Herzog M (1989) Dinoflagellates in evolution. A molecular phylogenetic analysis of large subunit ribosomal RNA. J Mol Evol 29: 40–51

Galtier N, Gouy M, Gautier C (1996) SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput Appl Biosci 12: 543–548 Godhe A, Otta SK, Rehnstam-Holm A-S, Karunasagar I, Karunasagar I (2001) Polymerase chain reaction in detection of Gymnodinium mikimotoi and Alexandrium minutum in field samples from Southwest India. Mar Biotechnol 3: 152–162 Grizel H, Héral M (1991) Introduction into France of the Japanense oyster (Crassostrea gigas). J Cons Int Explor Mer 47: 399–403

Margalef R, Estrada M (1987) Synoptic distribution of summer microplankton (Algae and Protozoa) across the principal front in the Western Mediterranean. Invest Pesq 51: 121–140 Masselin P, Amzil Z, Abadie E, Nézan E, Le Bec C, Carreras A, Chiantella C, Truquet P (2001) Paralytic shellfish poisoning on the French Mediterranean coast in the autumn 1998: Alexandrium tamarense complex (Dinophyceae) as causative agent. Proceedings of the Ninth International Conference on Harmful Algal Blooms, Hobart, Australia, IOC of UNESCO: 26–29

Guillard RRL, Ryther JH (1962) Studies on of marine planktonic diatoms. 1 Cyclotella nana Hustedt and Detonula confervacea (Cleve) Gram. Can J Microbiol 8: 229–239

Medlin LK, Lange M, Wellbrock U, Donner G, Elbrächter M, Hummert C, Luckas B (1998) Sequence comparisons link toxic European isolates of A. tamarense from the Orkney Islands to toxic North American stocks. Europ J Protistol 34: 329–335

Guillou L, Moon-Van-Der-Staay S-Y, Claustre H, Partensky F, Vaulot D (1999) Diversity and abundance of Bolidophyceae (Heterokonta) in two oceanic regions. Appl Environ Microbiol 65: 4528–4536

Moestrup Ø, Hansen PJ (1988) On the occurrence of the potentially toxic dinoflagellates Alexandrium tamarense (= Gonyaulax excavata) and A. ostenfeldii in Danish and Faroese waters. Ophelia 28: 195–213

Hallegraeff GM (1993) A review of harmful algal blooms and their apparent global increase. Phycologia 32: 79–99

Oldach DW, Delwiche CF, Jakobsen KS, Tengs T, Brown EG, Kempton JW, Schaefer EF, Bowers HA, Howard B, Glasgow J, Burkholder JM, Steidinger KA, Rublee PA (2000) Heteroduplex mobility assayguided sequence discovery: elucidation of the small

Hallegraeff GM, Lucas IAN (1988) The marine dinoflagellate genus Dinophysis (Dinophyceae): photo-

238

L. Guillou et al.

subunit (18S) rDNA sequences of Pfiesteria piscicida and related dinoflagellates from complex algal culture and environmental sample DNA pools. Proc Natl Acad Sci USA 97: 4303–4308 Penna A, Magnani M (1999) Identification of Alexandrium (Dinophyceae) species using PCR and rDNA-targeted probes. J Phycol 35: 615–621 Rollo F, Sassaroli S, Boni L, Marota I (1995) Molecular typing of the red-tide dinoflagellate Gonyaulax polyedra in phytoplankton suspensions. Aquat Microb Ecol 9: 55–61 Scarratt AM, Scarratt DJ (1993) Survival of live Alexandrium tamarense cells in mussel and scallop spat under simulated transfer conditions. J Shellfish Res 12: 383–388

Steidinger KA, Tangen K (1996) Dinoflagellates. In Tomas CR (ed) Identifying Marine Diatoms and Dinoflagellates. Academic Press, San Diego, pp 387–598 Subba-Rao DV (1995) Life cycle and reproduction of the dinoflagellate Dinophysis norvegica. Aquat Microb Ecol 9: 199–201 Uribe P, Suàrez-Isla BA, Espejo RT (1999) Ribosomal RNA heterogeneity and identification of toxic dinoflagellate cultures by heteroduplex mobility assay. J Phycol 35: 884–888 Utermöhl H (1958) Zur Vervollkommnung der quantitativen Phytoplankton-Methodik Mitt Int Ver Limnol 9: 1–38

Scholin CA, Anderson DM (1996) LSU rDNA-based RFLP assays for discriminating species and strains of Alexandrium (Dinophyceae). J Phycol 32: 1022–1035

Vila M, Garcés E, Maso M, Camp J (2001) Is the distribution of the toxic dinoflagellate Alexandrium catenella expanding along the NW Mediterranean coast? Mar Ecol Prog Ser 222: 73–83

Scholin CA, Hallegraeff GM, Anderson DM (1995) Molecular evolution of the Alexandrium tamarense ‘species complex’ (Dinophyceae): dispersal in the North American and West Pacific regions. Phycologia 34: 472–485

Zardoya R, Costas E, lopez-Rodas V, GarridoPertierra A, Bautista JM (1995) Revised dinoflagellate phylogeny inferred from molecular analysis of largesubunit ribosomal RNA gene sequences. J Mol Evol 41: 637–645

Scholin CA, Herzog M, Sogin M, Anderson DM (1994) Identification of group- and strain-specific genetic markers for globally distributed Alexandrium (Dinophyceae). II. Sequence analysis of a fragment of the LSU rRNA gene. J Phycol 30: 999–1011

Zingone A, Montresor M, Marino D (1998) Morphological variability of the potentially toxic dinoflagellate Dinophysis sacculus (Dinophyceae) and its taxonomic relationships with D. pavillardii and D. acuminata. Eur J Phycol 33: 259–273