Genetic diversity in local Tunisian pears (Pyrus communis L.) studied with SSR markers

Available online at www.sciencedirect.com

Scientia Horticulturae 115 (2008) 337–341 www.elsevier.com/locate/scihorti

Genetic diversity in local Tunisian pears (Pyrus communis L.) studied with SSR markers W. Brini a, M. Mars a,*, J.I. Hormaza b a

U.R. Agrobiodiversite´, Institut Supe´rieur Agronomique, 4042 Chott-Mariem, Sousse, Tunisia b Estacio´n Experimental la Mayora, 29750 Algarrobo-Costa, Ma´laga, Spain

Received 11 April 2007; received in revised form 10 October 2007; accepted 12 October 2007

Abstract Few records are available about local Tunisian pear cultivars characterized by low chilling requirements and adaptation to dry conditions. In this work, seven SSRs derived from apple were successfully transferred to 25 local Tunisian pear genotypes and 6 common varieties of Pyrus communis cultivated in Europe. The 7 SSRs used amplified a total of 36 fragments. All the microsatellites except one seem to amplify more than one locus in some of the genotypes studied. Only 12 different fingerprinting patterns could be distinguished among the 25 Tunisian cultivars studied indicating a high number of synonymies. The mean expected and observed heterozygosities in the 25 Tunisian cultivars analyzed averaged 0.71 indicating a high level of genetic diversity among the local Tunisian pear germplasm. These markers will be useful to optimize the conservation of this highly threatened germplasm. # 2007 Elsevier B.V. All rights reserved. Keywords: Pyrus; Pear; Genetic diversity; SSR markers; Tunisia

1. Introduction Pear species belong to the genus Pyrus in the subfamily Maloideae of the Rosaceae. Commercial pear production is mainly represented by two species P. communis L. and P. pyrifolia (Burm.). P. communis (European pear) is the most commonly cultivated pear species in Europe, North America, Northern Africa and temperate regions of the Southern hemisphere, while P. pyrifolia (Burm. f.) Nakai is the main cultivated pear species in Asia (Bell et al., 1996). World pear production reached 19.5 million metric tons in 2006 (FAOSTAT, 2007) ranking second, after apples, among global production of deciduous fruit tree species. Current world pear production relies on a few numbers of main cultivars selected in the 19th or late 18th centuries or derived from those and, consequently, there is a need to widen the genetic base of current pear cultivars. Tunisian pear production was estimated about 60,000 metric tons in 2006 (FAOSTAT, 2007). The center-east region (Sahel: Sousse, Monastir and Mahdia) produced about 1.4% of national

* Corresponding author. Tel.: +216 73 327 544; fax: +216 73 327 591. E-mail address: [email protected] (M. Mars). 0304-4238/$ – see front matter # 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.scienta.2007.10.012

production represented mainly by local pears (MARH, 2005). Mars et al. (1994) noticed that pear cultivation has shifted to the interior of the country with and increased introduction of European and American varieties resulting in an alarming decrease in the use of local cultivars some of which have disappeared before characterization or genetic studies had been performed. In fact, few records about local Tunisian pear cultivars are available. A first prospective work has been achieved in the Sahel of Tunisia, particularly in the region of Monastir, distinguishing two main pear groups: ‘Meski’ and ‘Arbi’ (Carraut, 1986). A preliminary classification has been done according to ripening date and some fruit characters. Local pear cultivars differ mainly by leaf and fruit parameters that are strongly affected by the environment. Thus, those parameters are not efficient as a first approach to characterize the genetic diversity among local Tunisian pears. Consequently, molecular markers could be appropriate to study and preserve the diversity present in this interesting material due to its adaptation to dry conditions and low chilling requirements. Several works have been carried out in different countries to study genetic variability in pear. Morphological traits (Shen, 1980; Westwood, 1982; Paganova´, 2003), polyphenols (Challice and Westwood, 1973, Kajiura et al., 1985) and isozyme analysis (Santamour and Demuth, 1980; Menendez and Daley,

338

W. Brini et al. / Scientia Horticulturae 115 (2008) 337–341 Table 1 Denomination and geographic origin of the analyzed pear cultivars No.

Fig. 1. Geographical distribution of local pear cultivars in the region of Sahel, Tunisia.

1986; Chevreau and Morisot, 1986; Cerezo and Socias i Company, 1989; Chevreau et al., 1997) were used for the identification of different Pyrus genotypes. More recently, cpDNA RFLPs (Iketani et al., 1998; Katayama and Uematsu, 2003) as well as nuclear AFLP (Dolatowski et al., 2004), RAPD (Oliveira et al., 1999; Schiliro et al., 2001; Teng et al., 2001) and SSR (Yamamoto et al., 2001, 2002a,b; Kimura et al., 2002; Ghosh et al., 2006; Volk et al., 2006) markers have also been used to study genetic diversity and taxonomic relationships of pear species. The present study aims to determine the genetic diversity of local pear cultivars in Tunisia using SSR markers derived from apple in order to optimize the conservation and use of this highly threatened germplasm characterized mainly by low chilling requirement and early fruit ripening (Brini and Mars, 2008).

Codes a

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 a

MBG1 AMB1a NHLa AMB2a MRT1a ARB1a MBG2a MLTa CHM1a FYNa RDSa KTN1a KTN2a MHRa ARB2a MBG3a CHM2a FYLa MBG4a MSKa MAK1a TRKa MAK2a MRT2a MRT3a PSC CNF BLQ WLM LIM DCO

Denomination

Origin

Meski Bou Guedma Ambri Nahli Ambri Meski Artab Arbi Meski Bou Guedma Malti Chemi Fayouni Radsi Kettana24 Kettana25 Meski Ahrach Arbi Meski Bou Guedma Chemi Fayali Meski Bou Guedma Meski Makkaoui Turki Makkaoui Meski Artab Meski Artab Passe Crassane Conference Blanquilla Williams Dr. Jules Guyot (Limonera) D. Comice

Manzel Farsi Monastir Hiboun Mahdia Knaı¨s Sousse Knaı¨s Sousse Knaı¨s Sousse Kalaa Se´ghira Sousse Bouficha Sousse ‘‘ISA’’ Chott Mariem Moknine Monastir Hiboun Mahdia ‘‘ISA’’ Chott Mariem ‘‘ISA’’ Chott Mariem ‘‘ISA’’ Chott Mariem Sidi Bou Ali Sousse Moknine Monastir Sidi Bou Ali Sousse Manzel Farsi Monastir ‘‘ISA’’ Chott Mariem Sidi Bou Ali Sousse Hiboun Mahdia Moknine Monastir Knaı¨s Sousse Manzel Farsi Monastir Sidi Bou Ali Sousse Sidi Bou Ali Sousse France, 1855 England, 1894 Spain, 1747 UK, 18th. Century France, 1871 France, 1849

Local Tunisian cultivars.

2.2. Genomic DNA extraction and SSR analysis Genomic DNA from all the pear genotypes included in Table 1 was extracted from fresh leaves according to the protocol described by Hormaza (2002). Seven primers derived Table 2 Apple SSR primer sequences used in this study Locus

Sequence (50 to 30 )

02b1

F: CCGTGATGACAAAGTGCATGA R: ATGAGTTTGATGCCCTTGGA

2. Material and methods

05g8

F: CGGCCATCGATTATCTTACTCTT R: GGATCAATGCACTGAAATAAACG

2.1. Plant material

28f4

F: TGCCTCCCTTATATAGCTAC R: TGAGGACGGTGAGATTTG

CH01F02

F: ACCACATTAGAGCAGTTGAGG R: CTGGTTTGTTTTCCTCCAGC

CH01H01

F: GAAAGACTTGCAGTGGGAGC R: GGAGTGGGTTTGAGAAGGTT

CH01H10

F: TGCAAAGATAGGTAGATATATGCCA R: AGGAGGGATTGTTTGTGCAC

CH02D11

F: AGCGTCCAGAGCAACAGC R: AACAAAAGCAGATCCGTTGC

Twenty five local Tunisian pear genotypes [20 collected from different areas of the center-east of the country (Fig. 1) and 5 maintained at the ISA Chott Mariem] were used for this study (Table 1). Moreover, six cultivars of P. communis maintained at the experimental orchard of the ‘‘CITA de Aragon’’ in Zaragoza (Spain) chosen to represent a wide pear genetic pool (Wu¨nsch and Hormaza, 2007) were analyzed to compare the data obtained with the local Tunisian cultivars.

W. Brini et al. / Scientia Horticulturae 115 (2008) 337–341

339

Table 3 Locus name, range size of the amplified fragments, number of alleles (A), observed (Ho) and expected (He) heterozygosities and probability of identity calculated for 7 SSRs markers in 25 Tunisian pear genotypes SSR

Allele size range

A

Ho

He

PI

02b1 05g8 28f4 CH01F02 CH01H01 CH01H10 CH02D11

255/257/259/266 102/104/106/108/110/112/114/116/122 95/99/101/103/105/107 155/159/161/163/167/169/174/176/180 105/107/121/123 103/105/107/109/113/117/119/129 99/105/108/112/115/118/120/122/124/130

4 9 6 9 4 8 10

0.70 0.85 0.30 0.50 0.70 0.95 1.00

0.64 0.77 0.70 0.84 0.57 0.70 0.78

0.34 0.21 0.32 0.23 0.62 0.24 0.16

7

0.71

0.71

0.30

Mean

from apple (Table 2), i.e. 02b1, 05g8, 28f4 (Guilford et al., 1997), CH01F02, CH01H01, CH01H10, CH02D11 (Gianfranceschi et al., 1998) and previously shown to be transferable to P. communis by Yamamoto et al. (2001, 2002c), were used for PCR amplification in 15 ml volumes containing 16 mM (NH4)2SO4, 67 mM Tris–HCl pH 8.8, 0.01% Tween-20, 2 mM MgCl2, 0.1 mM of each dNTP, 0.4 mM of each primer, 25 ng genomic DNA and 0.5 units of BioTaq DNA polymerase (Bioline, London). Reactions were carried out in an I-cycler thermocycler (Bio-Rad Laboratories, Hercules, CA, USA) using the following temperature profile: an initial step of 1 min at 94 8C followed by 35 cycles of 30 s at 94 8C, 30 s at 50 8C and 1 min at 72 8C, and a final step of 5 min at 72 8C. The selected SSRs were analyzed using a CEQTM 8000 capillary DNA analysis system (Beckman Coulter, Fullerton, CA, USA). Reverse primers of each primer pair were labeled with WellRED fluorescent dyes D2, D3 and D4 (Proligo, Paris, France) on the 50 end. The analyses were repeated at least twice to assure the reproducibility of the results. 2.3. Data analysis Presence and absence of alleles corresponding to SSR markers were scored as 1 and 0, respectively. Genetic relationships among the genotypes were calculated using UPGMA cluster analysis of the similarity matrix obtained from the proportion of shared fragments (Nei and Li, 1979) using the program NTSYSpc 2.11 (Exeter Software, Stauket, NY, USA). The robustness of the nodes of the dendrogram was assessed with bootstrap analysis using 2000 iterations with the WinBoot software (Yap and Nelson, 1996). The genetic information was assessed using the following parameters: number of alleles per locus (A), observed heterozygosity (Ho, direct count), expected heterozygosity (He ¼ 1  Sp2i where pi is the frequency of the ith allele (Nei, 1973)) and the probability of identity (PI) [PI ¼ 1  Sp4i þ SSð2pi pJ Þ2 where pi and pJ are the frequency of the ith and jth alleles, respectively], that measures the probability that two randomly drown diploid genotypes will be identical, assuming observed allele frequencies and random assortment (Paetkau et al., 1995). The computations were performed with the programs IDENTITY 1.0 (Wagner and Sefc, 1999) and GENEPOP 3.4 (Raymond and Rousset, 1995).

3. Results and discussion All the 7 primers used were successfully transferred to pear and amplified a total number of 36 alleles in the 31 pear genotypes analyzed. Only in one SSR (02b1), one or two bands were amplified in each genotype suggesting the amplification of a single locus. In five other SSRs (CH1H1, CH1f2, CH1H10, 28f4 and 05g8), several genotypes showed the presence of three alleles and in CH2D11 four alleles were distinguished, indicating the amplification of at least two different loci. The range of the fragments obtained with the seven SSRs studied is similar to those previously reported in pear for the same SSR loci (Yamamoto et al., 2001). The presence of several amplification fragments in most of the loci studied can be due to the allopolyploid origin of the Maloideae subfamily from two primitive forms of Rosaceae (Layne and Qamme, 1975). Thus, the Maloideae have a basic chromosome number of 17 whereas other subfamilies of the Rosaceae have basic chromosome numbers of 7, 8 or 9. In fact, recent DNA sequence analyses confirm a polyploid origin of the Maloideae, via aneuploidy from x = 18, from an ancestor with a chromosome number of 9 (Evans and Campbell, 2002). Genetic diversity parameters were calculated for the local Tunisian cultivars studied. The number of alleles detected per locus ranged from 4 to 10, with an average of 7. Allele frequencies ranged from 0.025 to 0.6 (mean of 0.19). The observed heterozygosity ranged from 0.30 to 1 (mean of 0.71). The expected heterozygosity ranged from 0.57 to 0.78 (mean of 0.71) (Table 3). The maximum value of the probability of identity (0.62) was detected in CH01H01 and the minimum (0.16) in CH02D11 with a total of probability of identity of 1.24 104. The European cultivars studied were selected to reflect the overall diversity in European pear germplasm. However, when compared with Tunisian cultivars, there is not a clear differentiation indicating the high genetic diversity present in the Tunisian cultivars analyzed. This is further stressed by the high heterozygosity values and number of alleles obtained with the local Tunisian pear cultivars analyzed in this work compared to the values generally obtained for European pear germplasm collections (Wu¨nsch and Hormaza, 2007). Data analysis of 50 alleles resulting from the amplification of seven SSR loci distinguished 18 different amplification patterns from the 31 cultivars analyzed. Only 12 different

340

W. Brini et al. / Scientia Horticulturae 115 (2008) 337–341

stem among all the Tunisian cultivars studied. ‘Blanquilla’ fruits are also juicy and characterized with a white internal color like ‘Ambri’ fruits but differ from these by fruit external color since ‘Blanquilla’ fruits are usually green with sometimes a reddish side while ‘Ambri’ fruits are yellow with a typical red side. ‘Blanquilla’ is originated from Southern Spain and movement of plant material among Southern Spain and Northern African countries was common during the Arab presence in Southern Spain. This study confirms the usefulness of SSR markers to study pear genetic diversity as it was shown in previous works (Yamamoto et al., 2001; Kimura et al., 2002; Ghosh et al., 2006; Volk et al., 2006) providing the first report of genetic diversity at the molecular level in local Tunisian pear cultivars. These local cultivars may be of global interest as they have very low chilling requirements (lower than 200 h) that could allow to extend pear production even in geographical regions where common cultivars are not capable to flower or where pear production can be at risk in the future due to global warming. Further work should be carried out to study pear genetic diversity in Tunisia and other Northern African countries in order to preserve this valuable germplasm for future generations. Acknowledgements Fig. 2. Dendrogram of the 31 pear varieties and cultivars based on UPGMA analysis using the similarity matrix generated by the Nei and Li coefficient after amplification with 7 pairs of SSR primers.

fingerprinting patterns could be distinguished among the 25 Tunisian cultivars studied indicating a high number of synonymies in the local germplasm studied. Some were expected since they correspond to cultivars that receive very similar or identical denominations such as ‘MBG1’, ‘MBG2’ and ‘MBG4’, ‘AMB1’ and ‘AMB2’ and ‘ARB1’ and ‘ARB2’. However, other synonymies correspond to cultivars that have different names and different geographical origin such as the groups (‘CHM1’, ‘CHM2’, ‘MRT2’ and ‘MRT3’), (‘MLT’ and ‘KTN2’) and (‘FYL’, ‘TRK’ and ‘MAK2’) probably indicating the movement of selected plant genotypes through grafting. On the other hand, different homonymies have also been found: ‘MBG3’ is different from ‘MBG1’, ‘MBG2’ and ‘MBG4’; ‘KTN1’ differs from ‘KTN2’; ‘MRT1’ differs from ‘MRT2’ and ‘MRT3’; ‘MAK1’ differs from ‘MAK2’. UPGMA cluster analysis allowed the construction of a dendrogram with four main clusters (Fig. 2). The cophenetic correlation coefficient estimated to test the goodness of fit of the clustering analysis between the cophenetic matrix and the similarity matrix is high (r = 0.91). Consequently, the tree branching can be considered a good representation of the genetic similarity among the studied genotypes although bootstrap analysis did not reveal significant groups (with values higher than 50%) in the dendrogram. Interestingly, the Spanish cultivar ‘Blanquilla’ clusters together with the Tunisian cultivars ‘AMB1’ and ‘AMB2’ with a similarity value of 0.64. Both ‘Ambri’ cultivars are juicy and have the shortest

This study was made in the framework of the TunisianSpanish joint research project (3/04/P) co-financed by AECI (Spain) and MRSTDC—Tunisia (UR03AGR04). Authors thank H. Boussetta, M. Herrero and A. Hedhly for their valuable help during the development of the project and A. Wu¨nsch for critical reading of the manuscript and for providing some of the genotypes analyzed in this study. References Bell, R.L., Quamme, H.A., Layne, R.E.C., Skirvin, R.M., 1996. Pears. In: Janick, J., Moore, J.N. (Eds.), Fruit Breeding, Volume I: Tree and Tropical Fruits. John Wiley and Sons, Inc., NY, USA, pp. 441–514. Brini, W., Mars, M., 2008. Prospection du poirier local (Pyrus communis L.) au Sahel Tunisien. Plant Genet. Res. Newsletter, in press. Carraut, A., 1986. Les porte-greffes du poirier: Perspectives nouvelles pour la Tunisie. Agronomie et Horticulture 1, 7–14. Cerezo, Mesa M., Socias i Company, R., 1989. Isoenzymatic variability in pear pollen. Acta Horticulturae 256, 111–118. Challice, J.S., Westwood, M.N., 1973. Numerical taxonomic studies of the genus Pyrus using both chemical and botanical characters. Bot. J. Linn. Soc. 67, 121–148. Chevreau, E., Leuliette, S., Gallet, M., 1997. Inheritance and linkage of isozyme loci in pear (Pyrus communis L.). Theor. Appl. Genet. 94, 498–506. Chevreau, E., Morisot, D.,1986. Variabilite´ ge´ne´tique d’une collection d’espe`ces des genres Malus et Pyrus, analyse botanique et enzymatique. Colloque ‘Distances Ge´ne´tiques’, Me´ribel – Mars, pp. 132–143. Dolatowski, J., Nowosielski, J., Podyma, W., Szymanka, M., Zych, M., 2004. Molecular studies on the variability of Polish semi-wild pears (Pyrus) using AFLP. J. Fruit Ornamental Plant Res. 12, 331–337. Evans, R.C., Campbell, C.S., 2002. The origin of apple subfamily (Maloideae; Rosaceae) is clarified by DNA sequence data from duplicated GBSSI genes. Am. J. Bot. 89, 1478–1484. FAOSTAT (2007) FAO statistics data base on the World Wide Web. http:// faostat.fao.org. Last accessed August 2007.

W. Brini et al. / Scientia Horticulturae 115 (2008) 337–341 Gianfranceschi, L., Seglias, N., Tarchini, R., Komjanc, M., Gessler, C., 1998. Simple sequence repeats for the genetic analysis of apple. Theor. Appl. Genet. 96, 1069–1076. Ghosh, A.K., Lukens, L.N., Hunter, D.M., Strommer, J.N., 2006. European and Asian pears: simple sequence repeat-polyacrilamide gel electrophoresisbased analysis of commercially important North American cultivars. HortScience 41, 304–309. Guilford, P., Parakash, S., Zhu, J.M., Rikkerink, E., Gardiner, S., Bassett, H., Forster, R., 1997. Microsatellites in Malus x domestica (apple): abundance, polymorphism and cultivar identification. Theor. Appl. Genet. 94, 249–254. Hormaza, J.I., 2002. Molecular characterization and similarity relationships among apricot (Prunus armeniaca L.) genotypes using simple sequence repeats. Theor. Appl. Genet. 104, 321–328. Iketani, H., Manabe, T., Matsuta, N., Hayashi, T., 1998. Incongruence between RFLPs of chloroplast DNA and morphological classification in East Asian pear (Pyrus spp.). Genet. Resources Crop Evolution 45, 533– 539. Kajiura, I., Nakajima, M., Sakai, Y., Kotani, H., Oogaki, C., 1985. Identification of Japanese pear cultivars (Pyrus serotina Redh Var culta) by phenolic compounds in leaves. Bull. Fruit Tree Res. Stn. A (Yatabe) 12, 1–27. Katayama, H., Uematsu, C., 2003. Comparative analysis of chloroplast DNA in Pyrus species: physical map and gene localization. Theor. Appl. Genet. 106, 303–310. Kimura, T., Shi, Y.Z., Shoda, M., Kotobuki, K., Matsuda, N., Hayashi, T., Ban, Y., Yoshiyuki, B., Yamamoto, T., 2002. Identification of Asian pear varieties by SSR analysis. Breeding Sci. 52, 115–121. Layne, R.E.C., Qamme, H.A., 1975. Pears. In: Janick, J., Moore, J.N. (Eds.), Advances in Fruit Breeding. Purdue University Press, West Lafayette, Indiana, USA, pp. 38–70. MARH (Ministe`re de l’Agriculture et des Ressources Hydrauliques), 2005. Budget e´conomique 2006, Agriculture et peˆche. Mars, M., Carraut, A., Marrakchi, M., Gouiaa, M., Gaaliche, F., 1994. Ressources ge´ne´tiques fruitie`res en Tunisie (poirier, oranger, figuier, grenadier). Plant Genet. Resources Newslett. 100, 14–17. Menendez, R.A., Daley, L.S., 1986. Characterization of Pyrus species and cultivars using gradient polyacrylamide gel electrophoresis. J. Environ. Hort. 4, 56–60. Nei, M., 1973. Analysis of gene diversity in subdivided populations. In: Proceedings of the National Academy of Sciences of the United States of America, vol. 70. pp. 3321–3323. Nei, M., Li, W.H., 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. In: Proceedings of the National Academy of Sciences of the United States of America, vol. 76. pp. 5269– 5273.

341

Oliveira, C.M., Mota, M., Monte-Corvo, L., Goulao, L., Silva, D.M., 1999. Molecular typing of Pyrus based on RAPD markers. Scientia Horticulturae 79, 163–174. Paetkau, D., Calvert, W., Stirling, L., Strobeck, C., 1995. Microsatellite analysis of population structure in Canadian polar bears. Mol. Ecol. 4, 347–354. Paganova´, V., 2003. Taxonomic reliability of leaf and fruit morphological characteristics of the Pyrus L. taxa in Slovakia. Hort. Sci. 30, 98–107. Raymond, M., Rousset, F., 1995. GENEPOP (version 1.2): population genetics software for exact test and ecumenicism. J. Hered. 86, 248–249, http:// wbiomed.curtin.edu.au/genepop/. Santamour, F.S., Demuth, P., 1980. Identification of Callery pear cultivars by peroxidase isozyme patterns. J. Hered. 71, 447–449. Schiliro, E., Predieri, S., Bertaccini, A., 2001. Use of random polymorphic DNA analysis to detect genetic variation in Pyrus species. Plant Biol. Rep. 19, 271a–1271a. Shen, T., 1980. Pears in China. HortScience 15, 13–17. Teng, Y., Tanabe, K., Tamura, F., Itai, A., 2001. Genetic relationships of pear cultivars in Xinjiang, China, as measured by RAPD markers. J. Horticultural Sci. Biotechnol. 76, 771–779. Volk, G.M., Richards, C.M., Henk, A.D., Reilley, A.A., Bassil, N.V., Postman, J.D., 2006. Diversity of wild Pyrus communis based on microsatellite analyses. J. Am. Soc. Horticultural Sci. 131, 408–417. Wagner, H.W., Sefc, K.M., 1999. IDENTITY 1.0. Centre for Applied genetics. University of Agricultural Sciences, Vienna, Austria. Westwood, M.N., 1982. Pear germplasm of the new national clonal repository: its evolution and use. Acta Hort. 124, 57–65. Wu¨nsch, A., Hormaza, J.I., 2007. Characterization, variability and genetic similarity of European pear with SSRs. Sci. Horticult. 113, 37–43. Yamamoto, T., Kimura, T., Sawamura, Y., Kotobuki, K., Ban, Y., Hayashi, T., Matsuta, N., 2001. SSRs isolated from apple can identify polymorphism and genetic diversity in pear. Theor. Appl. Genet. 102, 865–870. Yamamoto, T., Kimura, T., Shoda, M., Band, Y., Hayashi, T., Matsuta, N., 2002a. Development of microsatellite markers in Japanese pear (Pyrus pyrifolia Nakai). Mol. Ecol. Notes 2, 4–16. Yamamoto, T., Kimura, T., Sawamura, Y., Manabe, T., Kotobuki, K., Hayashi, T., Ban, Y., Matsuta, N., 2002b. Simple sequence repeats for the genetic analysis in pear. Euphytica 124, 129–137. Yamamoto, T., Kimura, T., Shoda, M., Imai, T., Saito, T., Sawamura, Y., Kotobuki, K., Hayashi, T., Matsuta, N., 2002c. Genetic linkage maps constructed using an interspecific cross between Japanese and European pears. Theor. Appl. Genet. 106, 9–18. Yap, V., Nelson, R.J., 1996. WinBoot: A Program for Performing Bootstrap Analysis of Binary Data to Determine the Confidence Limits of UPGMA-based Dendrograms. International Rice Research Institute, Manila, Philippines.