Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne

G Model

ARTICLE IN PRESS

JARMAP-102; No. of Pages 10

Journal of Applied Research on Medicinal and Aromatic Plants xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Journal of Applied Research on Medicinal and Aromatic Plants journal homepage: www.elsevier.com/locate/jarmap

Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne Sajad Ahmad Lone a,1 , Manoj Kushwaha b , Abubakar Wani c , Ajay Kumar c , Ajai P. Gupta b,∗ , Qazi Parvaiz Hassan d,1 , Suresh Chandra e , Suphla Gupta a,∗,1 a

Plant Biotechnology Division, CSIR—Indian Institute of Integrative Medicine, Jammu 180001, India Quality Control & Quality Assurance, CSIR—Indian Institute of Integrative Medicine, Jammu 180001, India c Division of Cancer Pharmacology, CSIR—Indian Institute of Integrative Medicine, Jammu 180001, India d Biotechnology Division, CSIR—Indian Institute of Integrative Medicine, Srinagar 190005, India e Genetic Resources & Agro-technology Division, CSIR-Indian Institute of Integrative Medicine, Canal Road, Jammu 180001, India b

a r t i c l e

i n f o

Article history: Received 3 June 2016 Received in revised form 1 November 2016 Accepted 20 November 2016 Available online xxx Keywords: Epimedium elatum Fingerprinting Prenylated flavonoids Genetic diversity ISSR LCMS

a b s t r a c t Epimedium elatum Morr & Decne is a perennial herb, endemic to shady coniferous forests of north-western Himalayas, India. It owes its pharmaceutical importance to high concentration of flavonoid glycosides particularly epimedins and Icariin. A lot of medicinal properties are attributed to them like aphrodisiac (PDE-5 inhibition), anti-osteoporosis, anticancer, antioxidant, anti-fatigue and antiviral activities. In the present study, twenty accessions of E. elatum were investigated for their genetic diversity and chemo-profiling through molecular markers and fingerprinting, respectively. Further, their phyto-chemical variation and related antioxidant activities are also being reported. Molecular fingerprinting resulted in 277 total loci, out of which 254 were polymorphic, displaying an overall polymorphism of 91.1%. Moreover, fourteen unique bands were amplified, maximum (6) were amplified in GL accession from 3 primers (UBC900, UBC834 & UBC823). The dendrogram topology indicated moderate to high genetic diversity corroborating with diversity index (0.36). Chemo-profiling revealed epimedin B and epimedin C as the major prenylated flavonoids in leaves, while Icariin was found highest in underground parts. However, no correlation could be deduced between molecular and prenylated flavonoid profiling in the present study. Furthermore, ethanolic extracts of rhizomes exhibited stronger antioxidant ability. The study has great implications as the wild resource conservation, germplasm assessment, quality resource explorations have become critical for the sustainability of the species. Efforts are thus needed to conserve the elite accessions of E. elatum. © 2016 Elsevier GmbH. All rights reserved.

1. Introduction The genus Epimedium of Berberidaceace family is represented by about 60 species (Sheng et al., 2008; Quan et al., 2011). They are widely distributed in China and only five species of this genus are treated as the official source of Herba Epimedii in Chinese Pharmacopoeia, E. brevicornum Maxim, E. sagittatum (Sieb. et Zucc) Maxim, E. pubescens Maxim, E. wushanense T. S. Ying and E. koreanum Nakai (Pharmacopoeia Commission of PRC, 2010). They are known by English names like Rowdy Lamb Herb, Barrenwort, Bishop’s Hat,

∗ Corresponding authors. E-mail addresses: [email protected] (A.P. Gupta), [email protected] (S. Gupta). 1 Academy of Scientific and Innovative Research (AcSIR), Anusandhan Bhawan, New Delhi 110001, India.

Fairy Wings, and Horny Goat Weed (Ma et al., 2011). They have been used in folk medicine as a tonic, aphrodisiac and antirheumatic preparations in China, Japan, and Korea for more than 2000 years (Ma et al., 2011). More than 260 phytochemical compounds have been isolated from different species of Herba Epimedii (Ma et al., 2011). Among them, epimedin-A, epimedin-B, epimedin-C and Icariin are the major prenylated flavonoid glycosides (Wu et al., 2003; Pei et al., 2007; Wang et al., 2007, 2010), recommended as quality determining markers for Herba Epimedii (Ma et al., 2011). They have been reported to possess aphrodisiac activity (Shin et al., 2015; Kovac et al., 2015) and potential anti-osteoprortic role (Zhang et al., 2014a,b; Xie et al., 2015). Besides, recent studies have also reported Epimedium species with wide-reaching pharmacological actions like regulation of NO-cGMP pathway (Zhai et al., 2014; Jin et al., 2014) estrogenic activities (Kang et al., 2012; Ming et al., 2013), improving cardiovascular and cerebrovascular func-

http://dx.doi.org/10.1016/j.jarmap.2016.11.003 2214-7861/© 2016 Elsevier GmbH. All rights reserved.

Please cite this article in press as: Lone, S.A., et al., Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromat. Plants (2016), http://dx.doi.org/10.1016/j.jarmap.2016.11.003

G Model

ARTICLE IN PRESS

JARMAP-102; No. of Pages 10

S.A. Lone et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2016) xxx–xxx

2

tions (Ma et al., 2011; Ke et al., 2015), immunological modulation (Ma et al., 2011), anti-oxidant (Zhang et al., 2014a,b; Jang and Kim, 2015), anti-cancer (Zhao et al., 2015; Song et al., 2015; Li et al., 2015a,b; Wang et al., 2015; Zhou et al., 2015), anti-aging (Ma et al., 2011), anti-fatigue (Schluesener and Schluesener, 2014; Wang et al., 2014) and anti-viral actions (Cho et al., 2015; Xiong et al., 2015; Li et al., 2015a,b). E elatum is a perennial medicinal plant, endemic to high altitude shady forests of India and Pakistan in north-western Himalayas (Nasir and Ali, 2005; Perveen and Qaiser, 2010). Recent reports have indicated its possible ethnomedicinal use in bone related diseases (Arief et al., 2015) and potent PPAR-␥ ligand-binding activity (Tantry et al., 2012). In addition, few reports on isolation and simultaneous quantification of its prenylated flavonoids (Tantry et al., 2012; Sofi et al., 2014; Naseer et al., 2015; Arief et al., 2015) have also been published. Chemically, aerial and underground parts of the E. elatum have similar concentration of prenylated flavonoids (ABCI) as reported in Chinese pharmacopeia (Naseer et al., 2015). Chemotypic variation of four prenylated flavonoid glycosides, viz epimedin A, epimedin B, epimedin C and Icariin (ABCI) in wild accessions of E. elatum has not been broadly characterized. Research on its distributional and altitudinal aspects is also poorly documented. There are no reports on the genetic diversity assessment of this species. So, it was necessary to evaluate the genetic polymorphism of E. elatum for future conservation implications. The present study aimed to determine (i) the distribution of this species under natural habitats in Kashmir Himalayas, (ii) genetic diversity using ISSR fingerprinting. (iii) chemo-taxonomic marker variation in different plant parts with respect to four prenylated flavonoids through LCMS fingerprinting (iv) total phenolic (TPC), flavonoid (TFC) and antioxidant potential employing 2,2-diphenyl-1-picrylhydrazyl-hydrate free radical method (DPPH) and Ferric reducing antioxidant power (FRAP) model systems.

were also deposited at the respective places. The fresh leaves were collected in zip-lock bags for DNA extraction. For phytochemical analysis (LCMS, TPC, TFC, and antioxidant activity), the leaf, stem, rhizome and root were separated, shade dried and chemically extracted. 2.2. DNA isolation and ISSR PCR Leaf DNA was extracted following CTAB method with some modifications (Doyle and Doyle, 1987; Porebski et al., 1997). The quality and quantity of extracted DNA was estimated by electrophoresis and Nanodrop (ND-2000, Thermo Scientific, USA). The inter-simple sequence repeat (ISSR) primers were selected to study the genetic diversity of E. elatum. Forty published primer sequences of the related genus, Podophyllum (Xiao et al., 2006; Zong et al., 2008; Naik et al., 2010; Liu et al., 2014) were tried in the present study. PCR optimization showed that 20 ␮l reaction system was ideal for producing sharp reproducible bands in E. elatum. Each 20 ␮l PCR reaction consisted of 10x PCR buffer (supplied with 15 mM of MgCl2 ), 2 mM dNTP mix, 10 pmole primer, 50 ng of template DNA, and 1U of Taq DNA polymerase (Bangalore, Genei, India). The PCR was performed using a thermal profile of one cycle at 94 ◦ C for 5 min, followed by 35 cycles at 94 ◦ C for 45 s, specific primers annealed at 48–58 ◦ C for 45 s, and 2 min extension at 72 ◦ C, and a final extension at 72 ◦ C for 5 min. The amplifications were performed in ABI Geneamp 9700 thermal cycler (Thermo Scientific, USA). The amplification products were electrophoresed on 1.4% agarose gels buffered with 1X TAE for 2.5 h at 100 V, detected by ethidium bromide staining, and imaged in the Syngene Bio imaging System (Syngene, UK). Each primer was amplified twice to confirm reliability and reproducibility. 2.3. Genetic statistics and clustering PCR amplification with each primer was performed thrice and only reproducible and distinct bands were scored. Binary data matrix with presence (1) and absence (0) of bands was prepared for ISSR primers. Allele size was estimated visually by comparing with 100 bp plus ladder (Fermentas) on a gel. All the statistical calculation for resolving power (Rp) (Prevost and Wilkinson, 1999), polymorphic information contents (PIC) (Anderson et al., 1993) and marker indexes (MI) (Milbourne et al., 1997) were done as per the reported methods. Binary matrices were subjected to statistical

2. Materials and methods 2.1. Plant materials A total of twenty accessions of E. elatum were collected from different eco-geographical regions of Kashmir Himalayas (Table 1). They were identified by taxonomists from two herbarias viz; Centre of biodiversity and plant taxonomy, University of Kashmir and Janaki Amal herbarium, IIIM Jammu, India. Voucher specimens

Table 1 Sample information of E. elatum accessions including habitat characteristics in different regions of Kashmir Himalayas. Locations Gulmarg Babareshi Drang Dangarpora Boniyar Yusmarg Dodipathri Naranag Gagangir Dachigam Pahalgam Kokernag Verinag Khillanmarg Chaknala Sheikhpora Kanzalwan Badwan Hirpora Aharbal a

ACa GL BR DR DG BY YS DP NAR GG DGM PGM KNG VNG KMG CNG SPG KZG BDG HP AB

Accession 22304 22306 22305 22308 22307 22310 22309 22303 22314 22312 22319 22311 22320 22315 22316 22317 22318 22321 22322 22313

Altitude 2725 2694 2301 2592 2148 2383 2432 2272 2435 2912 2206 2343 1935 3133 2508 2646 2431 2521 1818 2425

Latitude ◦

34.02 34.03◦ 33.55◦ 34.05◦ 34.15◦ 33.49◦ 33.53◦ 34.21◦ 34.17◦ 34.08◦ 34.00◦ 33.34◦ 33.32◦ 34.02◦ 34.37◦ 34.35◦ 34.38◦ 33.39◦ 33.39◦ 33.38◦

Longitude ◦

74.22 74.23◦ 74.29◦ 74.32◦ 74.21◦ 74.40◦ 74.34◦ 74.58◦ 75.12◦ 75.02◦ 75.18◦ 75.17◦ 75.14◦ 74.21◦ 74.51◦ 74.59◦ 74.42◦ 74.46◦ 74.57◦ 74.74◦

Habitat characteristics Shade of thick bushes under pine trees. Grasses or bushes of shady slopes on hillside under the canopies of Pines. Partial shady slope or open with grasses or on roadside. Sunny slope under small bushes, grown in stone cavities or on roadside. Bushes of shady slope on hillside or roadside under canopies of pines. Small bushes in the partial shade of pine trees on hillside or on open slopes. Grasses or Bushes of deep shady slopes on hillside or roadside. Bushes of shady slope on streamside and hillside. Under partial shade of pine trees on stone cavities near streamside. Bushes of shady slopes on roadside or on stream side. Bushes of shady slope or under pine trees; facing anthropogenic threats. Bushes of hillside, under the partial shade in stone cavities. Bushes of shady slope on hillside or on stone cavities. Sunny slope on open bushes or on streamside in stone cliffs. Under partial shade of pine trees or on roadside or hillside. Grasses or bushes of shady slopes or on streamside in stone cavities. Bushes of shady slope under the canopy of Pinus forests. Bushes of shady slope on hillside or on stone cavities. Shady slopes on small stony hills or on roadside under the shade of forests. Bushes or Grasses or trees of shady slopes on roadside.

Accession codes.

Please cite this article in press as: Lone, S.A., et al., Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromat. Plants (2016), http://dx.doi.org/10.1016/j.jarmap.2016.11.003

G Model JARMAP-102; No. of Pages 10

ARTICLE IN PRESS S.A. Lone et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2016) xxx–xxx

3

Fig. 1. Structure of four prenylated flavonoids namely, epimedin A (m/z = 839; t1 = 9.6), epimedin B (m/z = 809; t2 = 11.6), epimedin C (m/z = 823; t3 = 12.5)and Icariin (m/z = 677; t4 = 14.2) which were identified and quantified by LCMS analysis.

analysis using NTSYS-pc (Numerical Taxonomy and Multivariate Analysis System version 2.1) software by Exeter (Rohlf, 1992). To compute pair wise genetic similarity, Jaccard’s similarity coefficient (Jaccard, 1908) was used. UPGMA based dendrogram were generated following Jaccard’s similarity matrix (JSI) for analyzing the molecular data and correlation coefficient similarity was employed for the chemical data analysis. 2.4. Sample preparation for chemical fingerprinting Each sample was separated into leaves (L), stems (S), rhizome (RZ) and root (RH), shade dried at room temperature and finely powdered. The powdered sample (500 mg) was subjected to sonication based extraction with 70% ethanol (10 ml) for 45 min at 45 ◦ C (thrice). Subsequently, the filtrate was pooled and concentrated under reduced pressure in rotavapor at 45 ◦ C. The hydroalocolic extract was dissolved in 1 ml methanol (LCMS grade) and then through 0.20 ␮m disposable membrane filter. 10 ␮l of sample solution were injected into the LC–MS/MS system for the analysis. The standards epimedin A, epimedin B,epimedin C and Icariin were purchased from Chromadex (USA). 2.5. LCMS analysis The analyses were performed using an Agilent 1260 Infinity (Agilent, USA) HPLC system equipped with 1260VL infinity quaternary pumps, autosampler, a thermostat compartment. The samples were separated on a Chromolith high resolution RP18e column (100 × 4.6 mm, Merck, Germany) guarded by a Chromolith RP18e 10 × 4.6 mm analytical guard column. The mobile phase consisted of MeCN and 0.1% (v/v) formic acid in water. The isocratic elution was used with 7.3% (0.1%) formic acid in water and 2.7% MeCN. The

flow rate was adjusted to 0.5 ml min−1 and column temperature ◦ was maintained at 30 C. Triple-quadrupole tandem mass spectrometry (MS/MS) was carried out on an Agilent 6410 tandem triple quadrupole mass spectrometer (TQD-MS) equipped with an ESI ion source operating in both positive ion mode and negative mode. ESI source was operated in positive ionization mode. Quantification was performed in MRM mode. The MS parameters optimized were: capillary, voltage 4.0 kV and gas temperature, 300 ◦ C. Nitrogen was used as desolvation gas at the rate of 15 l min−1 and nebulizer pressure was maintained at 50 psi. Nitrogen was also used as the collision gas. All the data was collected in the centroid mode and acquired and processed using Mass Hunter work station software (Agilent). The developed method showed retention time of epimedins A-C 9.6, 11.6, 12.5 min and for the icariin 14.2 min (Fig. 1). The method was validated for linearity, precision and accuracy following the International Conference on Harmonization guidelines (1996). Stock solutions of epimedins A-C and icariin were prepared individually in MS-grade mobile phase to produce final concentration 1.0 mg/ml. Stock solutions containing four reference compounds were diluted to appropriate concentrations for construction of calibration curves. The stocks and working ◦ solutions were stored at +4 C. The average peak area values for each analyte were plotted against corresponding concentrations of the analytes (expressed in ng/mL). 2.6. Total phenolic and flavonoid contents The total phenolic content (TPC) of aerial and underground parts of plant extracts of twenty accessions of E. elatum was determined according to the reported methods (Prior et al., 2005; Ainsworth and Gillespie, 2007). TPC was expressed as milligrams of gallic acid equivalents per gram of dry weight (mg GAE/g DW). The

Please cite this article in press as: Lone, S.A., et al., Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromat. Plants (2016), http://dx.doi.org/10.1016/j.jarmap.2016.11.003

G Model JARMAP-102; No. of Pages 10

ARTICLE IN PRESS S.A. Lone et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2016) xxx–xxx

4

gallic acid calibration curve with concentration ranging between 0.5 to 10 ␮g/ml (R2 = 0.9986) was constructed for the concentration determination in the extracts. All the samples were analyzed in triplicate. Total flavonoid content (TFC) of leaf and rhizome in each accession was determined according to the reported method (Dewanto et al., 2002) with slight modifications in reaction volume. TFC was expressed as milligrams of quercetin equivalents per gram of dry weight (mg QE/g DW). Calibration curve was constructed using quercetin in the concentration ranging between 10 and 100 ␮g/ml (R2 = 0.9989). All experiments were performed in triplicate. 2.7. Antioxidant potential DPPH assay was done as per a reported (Zhang et al., 2014a,b). 190 ␮l of each test samples (500 ␮g/ml) in methanol was placed into a 96 well plate. Reaction was initiated by adding 10 ␮l methanolic solution of DPPH (100 ␮M) to all the samples. After 30 min incubation in dark while shaking, absorbance was recorded at 517 nm. Ascorbic acid (50 ␮g/ml) was used as a standard. DPPH radical scavenging activity was calculated as percentage inhibition by using the formulae viz; Inhibition (%) = (A0 -A1 /A0 ) × 100, whereas A0 is the absorbance of control and A1 is the absorbance of test sample. DPPH scavenging activity of ascorbic acid was considered to be maximum and all the test samples were compared with it. 2.8. Ferric reducing antioxidant power (FRAP) FRAP assay was done in a 96 well plate as per reported method (Benzie and Strain, 1996). FRAP reagent was prepared by mixing 10 ml of 300 mM acetate buffer, 1 ml of 10 mM 2,4,6-tripyridyls-triazine (TPTZ), 40 mM of hydrochloric acid (HCl) and 1 ml of 20 mM FeCl3 .6H2 O. Freshly prepared FRAP reagent (195 ␮l) was added in a 96 wells plate having 5 ␮l of plant extracts, in methanol (500 ␮g/ml). Absorbance was read at 593 nm after 30 min incubation in the dark. Ascorbic acid was used as a positive control. 3. Results and discussion 3.1. Geographical distribution The plants representing different accessions of E. elatum were collected from twenty wild habitats of Kashmir Himalaya. The sample information on different parameters including habitat characteristics is presented in Table 1. The observation revealed that E. elatum accessions (GL, BR, NAR, DP & AB) growing in cool and shady environment, under natural protection, were comparatively taller and showed vigorous growth. They were found growing in association with other plant species, ranging from tall pine trees, shrubs to grasses. Further, it was observed during collection and survey that the plants growing in sub-alpine regions had better growth characteristics. Contrary to this, population growing under direct sunlight or subjected to anthropogenic disturbances like grazing were observed to be shorter in height. The survey of the habitat revealed that E. elatum has a very dwindling population status in Kashmir Himalayas. It is poorly distributed across most of the surveyed habitats due to habitat shrinkage. The Kashmir Himalaya, rich in medicinal wealth, has recently witnessed depletion of medicinal flora due to excessive harvesting and anthropogenic pressures (Tali et al., 2015). In this regard, screening of habitats to collect different accessions of E. elatum was done to record the diversity, both genetic and chemical, and identify elite genotypes or chemotypes for future medicinal use.

3.2. Genetic diversity/ISSR fingerprinting Among the twenty primers that produced reproducible distinct bands, six were random repeat sequences, twelve were repeat sequence motifs and two were inter-ISSR amplifications (Table 2). In all 277 loci were amplified employing twenty primers, out of which 254 were observed to be polymorphic, displaying an overall polymorphism of 91.1% in the 20 accessions collected. The minimum loci were amplified by primer P13 (4) while maximum (21) were observed in primer combination UBC857|866. Seven primers (P-22, P-23, P-24, UBC824, UBC848, UBC900 and ISSR03/P-25) produced only polymorphic loci thereby displaying the maximum (100%) polymorphism. The PIC values ranged between 0.27 (UBC900) to 0.44 (P-25), showing an overall diversity index (DI) of 0.36. The Resolving power and marker index varied between 1.8- 11.8 and 1.25–7.76, respectively. The overall average MI and Rp values were calculated to be 4.51 and 6.65 respectively. More than 50% (9 primers) displayed above average PIC value. Fourteen unique bands were amplified by 6 primers in 7 accessions (Fig. 2) between 500 bp and 1650 bp. Maximum unique loci (6) were amplified in GL accession from 3 primers (UBC900, UBC834 and UBC823) followed by AB accession (2) from 2 primers (UBC823 & UBC848). Out of the twenty primers utilized, the six random repeat sequence primers on an average amplified 14.33 loci, out of which 13.8 loci were found to be polymorphic, displaying an overall polymorphism of 97.6%. The average MI and Rp values of these six primers were found to be 4.8 and 7.3, respectively, which was slightly higher than the overall respective average values. Diversity index of random primer sequence was similar to overall diversity index (0.36). Compared to this, the repeat sequence motifs in 12 primers amplified 13.3 bands per primer with an average 11.41 polymorphic loci, displaying comparatively lower average polymorphism of 86.75%. The Rp & MI indices were 5.89 and 4.08, respectively. Diversity index of repeat sequence motifs (0.36) was however similar to overall average. Besides, inter-ISSR loci amplification was also tried in the study. Only 2 primer combinations ISSR-03/P-25 & UBC866/857 could produce reproducible, distinct bands (Table 2), showing an overall maximum distinguishing power. The genetic distinctiveness revealing parameters like average polymorphic bands (17), polymorphic percentage (97.61%), MI (6.13) and Rp (9.35) were found maximum in the inter ISSR primer combination profiling (Table 2). However, here it must be stated that only 2 inter-ISSR combinations, out of the 13 combinations tried, could produce amplification. Also it was observed that no unique bands could be seen in these two primer combination. The lesser number of inter-ISSR amplification could be due to more distance between two ISSRs and or the orientation of the aligned primers resulting in no amplification. Till date, no reports on genetic diversity assessment of Epimedium species employing ISSR primers have been published. Here, we have successfully utilized twenty ISSR primer sequences, out of the forty primers used in related genus Podophyllum (Xiao et al., 2006; Zong et al., 2008; Naik et al., 2010; Liu et al., 2014). This can be further exploited in molecular fingerprinting of other species of the genera. Further, analyzing the UPGMA based Jaccard coefficient matrix, the twenty collections could be classified into two broad clusters (I & II) at 27% similarity level with cluster I having only two accessions (BY & DG). Cluster II, with 18 accessions was subdivided, at 40% similarity value, into two sub clusters, sub cluster IIA with 17 accessions &IIB with only one (GL) (Fig. 3). The dendrogram topology indicated moderate to high genetic diversity corroborating with diversity index. The dendrogram based classification could be related to band profiling as accession DG & BY were clustered separately because of lesser number of amplified bands, while GL produced maximum number of unique bands, thereby distinguishing the accession distinctly. However, no correlation could

Please cite this article in press as: Lone, S.A., et al., Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromat. Plants (2016), http://dx.doi.org/10.1016/j.jarmap.2016.11.003

G Model

ARTICLE IN PRESS

JARMAP-102; No. of Pages 10

S.A. Lone et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2016) xxx–xxx

5

Table 2 ISSR primers, sequences and genetic diversity parameters studied in 20 accessions of E. elatum collected from north-western Himalayas. S.No

Primers

1 2 3 4 5 6

P-22 P-23 P-24 P-25 UBC895 UBC900

7 8 9 10 11 12

ISSR-03 P-13 UBC834 UBC848 UBC853 UBC857

13 14 15 16 17 18

UBC820 UBC823 UBC850 UBC824 UBC864 UBC866

19 20

8 9

PC 1 PC 2

Primer sequence 



5 TAGATCTGATATCTGAATTCCC3 5 AGAGTTGGTAGCTCTTGATC3 5 CATGGTGTTGGTCATTGTTCCA3 5 ACTTCCCCACAGGTTAACACA3 5 AGAGTTGGTAGCTCTTGATC3 5 ACTTCCCCACAGGTTAACACA3 Mean 5 (CA)8 RG 3 5 (CT)8 RA3 5 (AG)8 YT3 5 (CA)8 RG3 5 (TC)8 RT’3 5 (AC)8 YG 3 Mean 5 (GT)8 C3 5 ’(TC)8 C 3 5 (GT)8 C3 5 (TC)8 G3 5 (ATG)6 3 5 (CTC)6 3 Mean ISSR-03/P-25 UBC857/UBC866 Mean

TB1

PB2

PPB3

PIC4

MI5

Rp6

P7

06 17 17 14 17 15 14.3 10 04 20 16 15 15 13.8 12 16 09 10 15 14 12.6 14 21 17.5

06 17 17 13 17 13 13.8 09 03 18 16 13 11 11.6 10 14 08 10 12 13 11.1 14 20 17

100 100 100 92.8 100 92.8 97.6 90.0 75.0 90.0 100 86.7 73.3 85.8 83.3 87.5 88.9 100 80.0 86.6 87.7 100 95.2 97.6

0.32 0.32 0.42 0.44 0.29 0.27 0.34 0.35 0.42 0.33 0.27 0.4 0.41 0.36 0.43 0.34 0.43 0.28 0.31 0.39 0.36 0.32 0.38 0.35

1.95 5.55 7.13 5.70 5.02 3.55 4.81 3.19 1.25 6.09 4.42 5.20 4.57 4.1 4.33 4.84 3.47 2.80 3.80 5.07 4.05 4.50 7.76 6.13

2.8 7.9 11.3 9.4 7.4 4.8 7.2 4.6 1.8 8.8 5.7 8.2 6.5 5.9 6.4 6.9 5.4 3.9 4.7 7.8 5.85 6.9 11.8 9.3

96.5

87.5

87.5

97.1

1

Total bands; 2 Polymorphic bands; 3 Percentage of polymorphic bands; 4 Polymorphic information content; 5 Marker Index; 6 Resolving power; 7 Genetic polymorphism (%) of primers; 8 Primer combination 1; 9 Primer combination 2.

Fig. 2. Results of PCR amplification of unique bands (ISSR-03/UBC900/UBC895/UBC834) in E. elatum genotypes via ISSR fingerprinting. {M: DNA ladder 100 bp plus}. Red arrows show the unique bands. [Position of gel lanes (1–20) showing twenty accessions; 1-BY 2-KZG 3-DGM 4-YS 5-DR 6-PGM 7-GL 8-KNG 9-VNG 10-SPG 11-AB 12-HP 13-KMG 14-DP 15-GG 16-BDG 17-CNG 18- NAR 19-BR 20-DG]. (See Table 1 for accession codes). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

be deduced between genetic profiling & prenylated flavonoid profiling in the present study.

3.3. LCMS fingerprinting of prenylated flavonoids Major prenylated flavonoids extracted from different organs of the twenty wild geographical accessions were quantified by LCMS technique. The four prenylated flavonoids (ABCI) were identified by comparing the RT (retention time) with those of standard solutions under identical conditions. The selectivity of the method was deter-

mined by analysis of standard epimedins A-C, icariin and extracts. Precision was expressed as relative standard deviation (%RSD) of the measurements, whereas accuracy was performed by recovery studies, which were carried out by the standard addition method. The spike recovery values were within the range 97.73–101.32% at three different levels of epimedin A–C and icariin. This finding indicated that the accuracy of the analysis was good and the interference of the matrix with the recovery of epimedin A–C and icariin was low.The relative standard deviation (RSD) of retention time and area for the compounds (1–4) were within 0.08–0.34% and

Please cite this article in press as: Lone, S.A., et al., Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromat. Plants (2016), http://dx.doi.org/10.1016/j.jarmap.2016.11.003

G Model

ARTICLE IN PRESS

JARMAP-102; No. of Pages 10

S.A. Lone et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2016) xxx–xxx

6

Fig. 3. Phylogenetic tree based on ISSR data in twenty accessions of E. elatum using UPGMA analysis (See Table 1 for accession codes).

Table 3 Concentration of four prenylated flavonoids (ABCI) flavonoids in E. elatum accessions collected from 20 geographical locations in Kashmir Himalayas (India). Epimedium-A (mg/g)a

Epimedium-B (mg/g)a

Epimedium-C (mg/g)a

Icariin (mg/g)a

Total ABCIb

ACc

LF1

ST2

RZ3

RH4

LF1

ST2

RZ3

RH4

LF1

ST2

RZ3

RH4

LF1

ST2

RZ3

RH4

TFA

TFU

PGM DR KZG KNG VNG SPG YS HP AB BR BDG DG GL BY KMG DGM DP GG NAR CNG

2.19 3.33 1.94 1.83 1.85 1.11 1.57 1.66 5.51 10.0 4.99 8.20 1.36 2.07 1.69 1.99 2.80 0.89 6.63 1.15

0.02 0.48 0.07 0.33 0.24 0.02 0.21 0.09 0.06 1.34 0.37 0.10 0.10 0.18 0.22 0.17 0.57 0.30 0.24 0.12

0.89 0.12 0.06 0.10 0.12 0.08 0.04 0.03 1.77 0.14 0.07 0.07 0.07 0.07 0.04 0.09 0.04 0.13 0.39 0.04

0.07 0.03 0.06 0.07 0.06 0.12 0.05 0.05 0.04 0.05 0.03 0.10 0.09 0.04 0.04 0.08 0.02 0.16 0.13 0.04

4.03 2.16 3.92 3.38 3.32 4.29 4.53 4.64 19.1 20.5 6.53 18.3 3.94 3.56 3.83 18.3 5.61 0.95 1.12 4.49

0.22 1.26 0.35 1.04 0.76 0.44 1.82 0.77 0.76 2.31 0.90 0.56 0.00 0.35 0.46 0.56 1.55 0.23 0.03 0.67

2.17 2.92 2.17 1.62 2.48 2.94 3.44 2.91 2.71 3.28 3.98 3.66 2.31 2.01 1.56 3.66 1.69 0.29 0.52 2.87

1.28 1.20 1.15 1.33 0.94 1.66 2.01 1.49 3.92 1.43 2.69 1.92 1.29 1.11 0.90 1.92 0.46 0.66 0.23 1.27

4.21 5.64 4.03 3.43 3.39 4.39 4.63 4.75 19.3 20.7 3.90 17.8 4.00 3.67 3.70 2.66 5.77 0.95 10.9 10.0

0.23 1.27 0.35 1.02 0.74 0.44 1.84 0.75 0.76 2.26 0.64 0.56 0.00 0.34 0.44 0.15 1.56 0.23 0.31 0.65

2.22 2.95 2.18 1.57 2.40 2.86 3.34 2.80 7.68 3.17 2.63 3.57 2.16 1.95 1.51 1.85 1.69 0.28 5.10 2.69

1.32 1.20 1.15 1.29 0.91 1.63 1.94 1.45 3.83 1.40 0.88 1.86 1.23 1.08 0.87 0.76 0.44 0.63 2.25 0.87

2.65 3.27 0.67 0.22 0.18 1.98 1.38 1.48 5.27 3.39 1.00 3.81 1.41 0.59 1.43 0.50 1.74 0.14 0.95 1.98

0.33 0.94 0.18 0.77 0.55 0.28 1.14 0.73 0.38 0.85 0.34 0.31 0.00 0.24 0.40 0.13 0.13 0.27 0.02 0.53

3.01 3.73 1.99 1.50 2.35 1.77 2.73 2.08 4.02 3.79 2.99 4.48 3.53 2.82 2.17 2.91 1.45 0.35 3.93 2.25

1.73 1.02 0.96 1.73 1.29 1.74 1.61 0.38 2.80 1.83 2.87 2.90 1.88 1.68 1.28 1.39 0.71 1.26 4.11 1.29

13.9 18.4 11.5 12.0 11.0 13.0 17.1 14.9 51.1 61.4 18.7 49.6 10.8 11.0 12.2 24.5 19.7 4.0 20.2 19.6

12.7 13.2 9.7 9.2 10.6 12.8 15.2 11.2 26.8 15.1 16.1 18.6 12.6 10.8 8.4 12.7 6.5 3.8 16.7 11.3

a b c

Flavonoid weight (mg/g dry weight). Total flavonoids (ABCI) in aerial parts (TFA) & underground parts (TFU). Accession codes. 1 Leaf, 2 Stem, 3 Rhizome, 4 Root hairs.

0.96–2.32% for intra-day, and 0.11–0.32% and 1.02–1.31% for interday, respectively. The LCMS fingerprinting revealed significant variation among the four prenylated flavonoids in different plant parts in all the twenty accessions studied. The content of epimedin A ranged between 0.89 in GG to 10 mg/g in BR, while epimedin B & C contents ranged between 0.95 to 20.5 mg/g respectively in the same accessions. Icariin was found maximum (5.27 mg/g) in AB accession while minimum (0.14 mg/g) was observed in GG accession. It was observed that among the aerial parts, ABCI content in stem was appreciably less as compared to leaves. Among the

underground parts studied, rhizome had higher average content of icariin (2.69 mg/g) as compared to leaves (1.73 mg/g). The LCMS based analysis of different plant parts in all the twenty accessions studied revealed that aerial parts of E. elatum are rich in epimedin B & epimedin C, while underground parts have more Icariin contents. Similar to our finding, epimedin C was reported as major prenylated flavonoid glycoside in other species like E. sagittatum, E. pubescens, E. wushanense, E. acuminatum, and E. myrianthum (Pei et al., 2007; Guo et al., 1996; Xie et al., 2007; Xu et al., 2013). In the present study, the average concentration of four prenylated flavonoid gly-

Please cite this article in press as: Lone, S.A., et al., Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromat. Plants (2016), http://dx.doi.org/10.1016/j.jarmap.2016.11.003

G Model JARMAP-102; No. of Pages 10

ARTICLE IN PRESS S.A. Lone et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2016) xxx–xxx

7

Fig. 4. Dendrogram based on the chemical fingerprinting of four prenylated flavonoids in twenty accessions of E. elatum.

cosides in leaves varied widely, ranging from 6.9 mg/g in epimedin C, 6.82 mg/g in epimedin B, 3.13 mg/g in epimedin A and 1.7 mg/g in icariin. According to the Chinese Pharmacopoeia, a minimum quantity of 5 mg/g (0.5%) of icariin and 13 mg/g (1.3%) of total prenylated flavonoids (ABCI) are required for selecting the plant as elite germplasm in Herba Epimedii (Pei et al., 2007; Pharmacopoeia Commission of PRC, 2010). In the present study, one accession (AB) was qualified as elite germplasm based on icariin value. The overall concentration of total prenylated flavonoids (ABCI) was found to be higher than the recommended value of 13 mg/g in ten accessions of E. elatum. The higher values were found in BR (54.59 mg/g), AB (49.18 mg/g) and DG (48.11 mg/g) accessions (Table 3). Comparatively, total average flavonoids were present more in aerial parts (20.71 mg/g) than the underground parts (12.68 mg/g).The leaves of the one accession (GG) exhibited extremely low concentration (2.93 mg/g) of total prenylated flavonoids (ABCI). There may be wide range of factors that affect the content or constituents of different secondary metabolites. The chemical diversity of E. elatum could be a consequence of local adaptation. According to recent investigations in Herba Epimedii, population size and the diversity of micro-environment (moisture, sunlight, temperature, topography, and edaphic factors) could contribute for their significant differences (Xu et al., 2013). The UPGMA based correlation coefficient matrix based on the chemical quantification, resulted into a dendrogram (Fig. 4), classifying the twenty accessions into 2 sub clusters, with one accession GG in the cluster I. Cluster II with the remaining 19 accessions, showed congruence with ABCI content. At 80% chemical similarity, the clade (a) with 10 accessions had ABCI content of less than 5 mg/g; clade (b) with 4 accession had all the four prenylated flavonoids in higher amounts; clade (c) with 2 accessions had epimedin A & B together in higher amounts, while the three accessions in clade (d) either had epimedin B or epimedin C in higher amounts. The only accession GG, which formed distinct cluster (I), was found to have all the four prenylated flavonoids in minimum quantities. The dendrogram reflected that out of the twenty accessions, four accessions (AB, BR, DG & DP) can be exploited for medicinal purposes because of their higher content of medicinally

important prenylated flavonoids. The study revealed through dendrogram clustering and the Pearson’s correlation that (I) in leaf and stem, the four prenylated flavonoid (ABCI) were positively correlated; (II) epimedin B & C in rhizome and roots were correlated and (III) epimedin A in root was inversely correlated to the epimedin B & C in stem. No clear correlation could be found between Icariin in aerial and underground parts. This content varied more than five times from 13 to 61.4 mg/g. However, total flavonoids (ABCI), in both the aerial and the underground parts together, was found to be present more in 19 out of 20 accessions, ranging between 20.6 to 77.9 mg/g. Only one accession GG had 7.8 mg/g of total flavonoids (ABCI).

3.4. Total flavonoid and phenolic contents Studies have shown that many of the pharmacological properties are due to antioxidant activity. The present study also analyzed total flavonoid contents (TFC) and phenolics (TPC) in different plant parts (leaves and rhizomes) of twenty accessions of E. elatum (Table 4). The TFC in leaves varied from minimum of 8.36 ± 0.00 mg/g in DP to maximum of 17.23 ± 0.00 mg/g in VNG having an average of 13.37 ± 0.00. However in rhizomes, its value was found to be minimum (7.20 ±0.00 mg/g) in KNG to maximum (25.73 ± 0.0 mg/g) in BR accessions (Table 4). Out of the twenty accessions screened, twelve showed higher TFC in their leaves and the remaining 8 displayed more accumulation in the rhizomes (Table 4). The flavonoid content of three accessions of E. elatum (AB, BR, DG) were found to be at par with the published reports (Zhang et al., 2014a,b) but was lower than the contents reported in E. pinnatum (Mahboubi et al., 2013) and in some species of Herba Epimedii (Zhang et al., 2013). TPC values in leaf varied between a minimum of 1.19 mg/g (DGM) to maximum of 2.56 mg/g (SPG) while, in rhizomes it varied from 1.56 mg/g (KNG) to 3.67 mg/g (DGM), respectively (Table 4). The average TPC value of rhizomes was slightly higher (2.97 ± 0.03 mg/g) than leaves (1.65 ± 0.03 mg/g). No published reports on the contents of flavonoid and polyphenolics in underground parts of the Epimedium species were available to compare. It must be noted that the overall phenolic content in E.

Please cite this article in press as: Lone, S.A., et al., Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromat. Plants (2016), http://dx.doi.org/10.1016/j.jarmap.2016.11.003

G Model

ARTICLE IN PRESS

JARMAP-102; No. of Pages 10

S.A. Lone et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2016) xxx–xxx

8

Table 4 Antioxidant (FRAP & DPPH) and phytochemical analysis (TPC & TFC) in leaves and rhizomes of twenty accessions of E. elatum.

AAa PGM DR KZG KNG VNG SPG YS HP AB BR BDG DG GL BY KMG DGM DP GG NAR CNG a

FRAP assay

DPPH assay

Total phenolic content

Total flavonoid content

% Fe reducing power

% free radical activity

mg/GAE/g DW

mg/QE/g DW

Leaf

Rhizome

Leaf

Rhizome

Leaf

Rhizome

Leaf

Rhizome

100 59.11 ± 0.18 27.42 ± 2.63 70.43 ± 0.82 64.19 ± 1.61 65.95 ± 4.59 58.45 ± 2.01 48.72 ± 0.03 55.18 ± 4.91 42.99 ± 0.12 31.30 ± 0.57 62.67 ± 5.80 32.75 ± 0.68 58.51 ± 2.14 35.09 ± 3.70 33.31 ± 1.47 76.55 ± 3.52 17.18 ± 2.43 65.97 ± 2.80 63.06 ± 3.80 59.88 ± 1.87

100 109.73 ± 4.36 116.01 ± 3.28 110.66 ± 1.76 110.88 ± 0.36 110.88 ± 0.36 113.44 ± 0.38 98.16 ± 4.63 113.70 ± 2.73 108.82 ± 1.74 116.12 ± 6.72 108.72 ± 4.05 108.62 ± 4.13 111.11 ± 2.85 114.19 ± 1.18 113.45 ± 0.30 109.14 ± 2.21 113.40 ± 1.44 112.87 ± 1.87 92.26 ± 4.15 107.99 ± 1.85

100 62.28 ± 6.36 10.19 ± 2.74 82.85 ± 4.57 53.25 ± 5.47 50.53 ± 3.38 64.98 ± 5.32 30.01 ± 5.36 66.79 ± 3.75 24.57 ± 3.48 90.30 ± 4.89 83.39 ± 4.62 10.24 ± 2.80 21.52 ± 1.82 28.32 ± 1.06 44.73 ± 1.89 76.22 ± 1.91 5.93 ± 1.02 44.42 ± 4.03 60.69 ± 3.30 66.40 ± 1.24

100 93.86 ± 2.58 95.08 ± 3.27 88.94 ± 3.16 94.44 ± 2.47 97.71 ± 1.79 96.11 ± 1.10 48.21 ± 2.28 95.61 ± 0.91 95.43 ± 1.80 92.27 ± 3.74 94.46 ± 0.61 96.59 ± 0.48 95.73 ± 1.09 96.16 ± 2.83 97.15 ± 1.34 94.33 ± 1.90 96.17 ± 0.57 94.34 ± 2.53 77.14 ± 1.97 98.76 ± 1.03

– 1.49 ± 0.04 1.66 ± 0.01 2.07 ± 0.04 1.43 ± 0.02 1.54 ± 0.02 2.56 ± 0.05 1.82 ± 0.03 1.59 ± 0.03 1.65 ± 0.00 2.21 ± 0.01 1.21 ± 0.03 2.01 ± 0.02 1.88 ± 0.03 1.58 ± 0.02 1.24 ± 0.01 1.19 ± 0.05 1.52 ± 0.07 1.25 ± 0.00 1.26 ± 0.01 1.92± 0.03

– 3.04 ± 0.03 3.43 ± 0.01 2.55 ± 0.01 1.56 ± 0.02 2.88 ± 0.03 2.22 ± 0.02 2.50 ± 0.02 3.06 ± 0.06 3.37 ± 0.02 3.14 ± 0.07 3.41 ± 0.05 3.09 ± 0.03 3.26 ± 0.03 2.43 ± 0.03 2.98 ± 0.02 3.67 ± 0.03 3.42 ± 0.02 2.88 ± 0.04 3.40 ± 0.02 3.16 ± 0.05

– 13.98 ± 0.00 14.67 ± 0.02 14.62 ± 0.01 11.84 ± 0.0 17.23 ± 0.00 13.01 ± 0.00 13.93 ± 0.00 13.46 ± 0.00 14.37 ± 0.01 13.84 ± 0.01 9.02 ± 0.02 15.68 ± 0.01 12.89 ± 0.01 12.01 ± 0.02 16.84 ± 0.00 14.45 ± 0.01 8.36 ± 0.01 13.20 ± 0.01 9.49 ± 0.01 14.58 ± 0.01

– 16.57 ± 0.03 10.12 ± 0.01 11.78 ± 0.01 7.20 ± 0.02 14.24 ± 0.02 10.42 ± 0.03 11.46 ± 0.01 12.12 ± 0.01 11.51 ± 0.04 25.73 ± 0.01 18.89 ± 0.05 13.11 ± 0.03 16.47 ± 0.02 11.88 ± 0.01 10.12 ± 0.01 15.19 ± 0.02 12.97 ± 0.01 17.51 ± 0.02 17.00 ± 0.01 13.50 ± 0.02

Ascorbic acid (100%). Data are mean ± SD of three independent experiments.

elatum was much lower when compared with published reports in Herba Epimedii. Since all accessions were collected from different ecogeographical habitats of Kashmir Himalayas, the considerable differences in flavonoid and phenolic contents in E. elatum could be due to developmental stage, harvest season, drying processes and environmental factors in comparison to the published reports. The study presents the first report on the comparison of TFC & TPC in underground rhizome and aerial part (leaves) in E. elatum.

source of antioxidant molecules (Zhang et al., 2014a,b, 2013). Herba Epimedii is used as a nutraceutical ingredient in many Asian countries particularly China, Japan and Korea and recent findings have also confirmed that their constituents can be used in treating neurodegenerative disorders such as Alzheimer’s disease (Jang and Kim, 2015). This will not only bring the plant under captive cultivation but will also help in its conservation and commercialization.

3.5. Antioxidant activity Antioxidant activities of each accession in leaves and rhizomes were measured by DPPH and FRAP assay methods. The free radical scavenging and ferric reducing activities of ascorbic acid were considered to be 100% at 50 ␮g/ml concentration in both assays. The results were calculated in comparison with ascorbic acid as percentage scavenging power and percentage Fe-reducing power, respectively (Table 4). Initially, ethanolic extracts were screened at different concentrations ranging from 100 to 500 ␮g/ml and extracts showed antioxidant activity (more or less) comparable to that of ascorbic acid at 500 ␮g/ml concentrations. So, all accessions were tested at the above concentration for antioxidant activity. Almost all accessions showed significant variation in the percentage inhibition of free radicals and percentage Fe-reducing potential (Table 4). In leaves, the DPPH scavenging activity varied from low (5.93 ± 3.52) in DP accession to high (90.30 ± 4.89) in BR accession while, in rhizomes it ranged from low (48.2 ± 2.28) in YS accession to high (98.76 ± 1.03) in CNG accession, respectively. FRAP values in leaves varied from low (17.18 ± 2.43) in DP accession to high (76.55 ± 3.52) in DGM accession, while in the rhizome, it ranged from minimum (98.16 ± 4.63) in YS accession to maximum (116.12 ± 6.72) in BR accession, respectively (Table 4). The average DPPH value (% inhibition) in all accessions was observed to be higher (91.9 ± 0.00) in rhizomes than leaves (48.88 ± 0.00) whereas the average FRAP values in rhizomes ranged much higher (110 ± 2.52) than leaves (51.4 ± 2.82).The present study demonstrated that E. elatum rhizomes have good antioxidant potential. The accumulation of higher antioxidants in underground parts of this species needs to be worked out for its future medicinal efficacy. Earlier reports have reported Epimedium leaves to be a good

4. Conclusions The distribution of E. elatum in different habitats is reported for the first time from 20 geographical areas of Kashmir Himalayas. Simultaneous determination of four prenylated flavonoids in E. elatum led to the identification of elite chemotypes (like BR & AB) based on the relative composition of prenylated flavonoid (ABCI). Genetic diversity assessment of twenty accessions revealed a moderate to high genetic polymorphism, successfully utilizing the forty primer sequences published on related genus (Podophyllum) and also demonstrating the cross-genus applicability of the studied primers. The accessions showed good antioxidant activity corresponding with a high content of total flavonoids. Total phenolics, however were reported lower than published reports on other Epimedium species. These findings will serve to give a deeper understanding of the chemical spectrum of the E. elatum on four important phytochemicals. Systematic phytochemical characterization along with proper conservation strategy is essential to convert this understudied species into potential source of prenylated flavonoids. The study will have conservation and cultivation implications for E. elatum. Efforts are needed to domesticate the elite chemotypes/genotypes of E. elatum at low altitude conditions in shade gardens for cultivation trials. This will help in germplasm conservation and exploiting the species for medicinal purposes. Wild populations of this species could become threatened, if timely and effective protective measures are not taken. The present study lays the foundation of assessing the gene pool and more studies are needed to elucidate the genetic basis and metabolic processes of E. elatum.

Please cite this article in press as: Lone, S.A., et al., Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromat. Plants (2016), http://dx.doi.org/10.1016/j.jarmap.2016.11.003

G Model JARMAP-102; No. of Pages 10

ARTICLE IN PRESS S.A. Lone et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2016) xxx–xxx

Acknowledgements The authors are thankful to director IIIM Jammu for providing necessary facilities and support. First author extends acknowledgements to University Grants Commission (UGC), New Delhi for providing fellowship and AcSIR cell for academic support. Grant from Council For Scientific and Industrial Research (CSIR) network project BSC 0110 is also acknowledged.

References Ainsworth, E.A., Gillespie, K.M., 2007. Estimation of total phenolic content and other oxidation substrates in plant tissues using Folin–Ciocalteu reagent. Nature Protocols 2 (4), 875–877. Anderson, G.A., Churchill, J.E., Autrique, S.D., Tanksley, M.E., 1993. Optimizing parental selection for genetic linkage maps. Genome 36, 181–186. Arief, Z.M., Munshi, A.H., Shawl, A.S., 2015. Evaluation of medicinal value of Epimedium elatum on the basis of pharmacologically active constituents, Icariin and Icariside-II. Pakistan Journal of Pharmaceutical Sciences 28 (5), 1665–1669. Benzie, I.F., Strain, J.J., 1996. The ferric reducing ability of plasma (FRAP) as a measure of antioxidant power: the FRAP assay. Analytical Biochemistry 239 (1), 70–76. Cho, W.K., Weeratunga, P., Lee, B.H., Park, J.S., Kim, C.J., Ma, J.Y., Lee, J.S., 2015. Epimedium koreanum Nakai displays broad spectrum of antiviral activity in vitro and in vivo by inducing cellular antiviral state. Viruses 7 (1), 352–377. Dewanto, V., Wu, X., Adom, K.K., Liu, R.H., 2002. Thermal processing enhances the nutritional value of tomatoes by increasing total antioxidant activity. Journal of Agricultural and Food Chemistry 50 (10), 3010–3014. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19, 11–15. Guo, B.L., Wang, C.L., Chen, J.M., Xiao, P.G., 1996. Determination of 9 flavonoids in 5 species of Epimedium recorded in Chinese pharmacopoeia by HPLC. Acta Pharmacologica Sinica 31, 292–295. Jaccard, P., 1908. Nouvelles recherche sur la distribution florale. Bulletin de la Société Vaudoise des Sciences Naturelles 44, 223–270. Jang, M., Kim, G.H., 2015. Icarin Levels using HPLC/MS and Antioxidant and neuronal PC12 cell protective effects from Epimedium koreanum on hydrogen peroxide-induced oxidative damage. FASEB 29 (1), 771–775. Jin, F., Gong, Q.H., Xu, Y.S., Wang, L.N., Jin, H., Li, F., Shi, J.S., 2014. Icariin, a phoshphodiesterase-5 inhibitor, improves learning and memory in APP/PS1 transgenic mice by stimulation of NO/cGMP signalling. International Neuropsychological Society 17 (6), 871–881. Kang, H.K., Choi, Y.H., Kwon, H., Lee, S.B., Kim, D.H., Sung, C.K., Dong, M.S., 2012. Estrogenic/antiestrogenic activities of a Epimedium koreanum extract and its major components: in vitro and in vivo studies. Food and Chemical Toxicology 50 (8), 2751–2759. Ke, Z., Liu, J., Xu, P., Gao, A., Wang, L., Ji, L., 2015. The cardioprotective effect of icariin on ischemia–reperfusion injury in isolated rat heart: potential involvement of the PI3K-Akt signaling pathway. Cardiovascular Therapeutics 33 (3), 134–140. Kovac, J.R., Pan, M., Arent, S., Lipshultz, L.I., 2015. Dietary adjuncts for improving testosterone levels in hypogonadal males. American Journal of Men’s Health, 1557988315598554. Li, H.M., Zhou, C., Chen, C.H., Li, R.T., Lee, K.H., 2015a. Flavonoids isolated from heat-processed epimedium koreanum and their anti-HIV-1 activities. Helvetica Chimica Acta 98 (8), 1177–1187. Li, J., Jiang, K., Zhao, F., 2015b. Icariin regulates the proliferation and apoptosis of human ovarian cancer cells through microRNA-21 by targeting PTEN, RECK and Bcl-2. Oncology Reports 33 (6), 2829–2836. Liu, W., Yin, D., Liu, J., Li, N., 2014. Genetic diversity and structure of Sinopodophyllum hexandrum (Royle) ying in the qinling mountains, China. PLoS One 9 (10), e110500. Ma, H., He, X., Yang, Y., Li, M., Hao, D., Jia, Z., 2011. The genus Epimedium: an ethnopharmacological and phytochemical review. Journal of Ethnopharmacology 134 (3), 519–541. Mahboubi, M., Kazempour, N., Hosseini, H., Mahboubi, M., 2013. Antimicrobial and antioxidant activity of Epimedium pinnatum. Herba Polonica 59 (2), 24–34. Milbourne, D., Meyer, R., Bradshaw, J.E., Baird, E., Bonar, N., Provan, J., Powell, W., Waugh, R., 1997. Comparison of PCRbased marker systems for the analysis of genetic relationships in cultivated potato. Molecular Breeding 3, 127–136. Ming, L.G., Chen, K.M., Xian, C.J., 2013. Functions and action mechanisms of flavonoids genistein and icariin in regulating bone remodeling. Journal of Cellular Physiology 228 (3), 513–521. Naik, P.K., Alam, M.A., Singh, H., Goyal, V., Parida, S., Kalia, S., Mohapatra, T., 2010. Assessment of genetic diversity through RAPD, ISSR and AFLP markers in Podophyllum hexandrum: a medicinal herb from the Northwestern Himalayan region. Physiology and Molecular Biology of Plants 16 (2), 135–148. Naseer, S., Lone, S.H., Lone, J.A., Khuroo, M.A., Bhat, K.A., 2015. LC–MS guided isolation, quantification and antioxidant evaluation of bioactive principles from Epimedium elatum. Journal of Chromatography B 989, 62–70. Nasir, E., Ali, S.I., 1980–2005. Flora of Pakistan. Berberidaceae 87, 1–31. University of Karachi, Pakistan.

9

Pei, L.K., Huang, W.H., He, T.G., Guo, B.L., 2007. Systematic studies on quality of main species of Herba Epimedii. China Journal of Chinese Materia Medica 32, 2217–2222. Perveen, A., Qaiser, M., 2010. Pollen flora of Pakistan–LXV. Berberidaceae. Pakistan Journal of Botany 42 (1), 1–6. Pharmacopoeia Commission of P.R., 2010. China, in Pharmacopoeia of the People’s Republic of China, China Medico-Pharmaceutical Science & Technology Publishing House, Beijing. Vol. I, p. 306. Porebski, S., Bailey, L.G., Baum, B.R., 1997. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology Reporter 15, 8–15. Prevost, A., Wilkinson, M.J., 1999. A new system of comparing PCR primers applied to ISSR fingerprinting of potato cultivars. Theoretical and Applied Genetics 98, 107–112. Prior, R.L., Wu, X., Schaich, K., 2005. Standardized methods for the determination of antioxidant capacity and phenolics in foods and dietary supplements. Journal of Agricultural and Food Chemistry 53 (10), 4290–4302. Quan, Q.M., Fang, Z.L., Wu, W., Li, Y., 2011. Comparative analysis of morphological characteristics and effective composition content of wild and cultivated Epimedium pubescens and Epimedium wushanense (Berberidaceae). Journal of Medicinal Plants Research 5, 6523–6527. Rohlf, F.J., 1992. NTSYS-pc. Numerical Taxonomy and multivariate analysis system: version 2.02e. Applied Biostatistics, New York. Spice board of India website. http://www.indianspices.com/pdf/state prd.pdf. Schluesener, J.K., Schluesener, H., 2014. Plant polyphenols in the treatment of age-associated diseases: revealing the pleiotropic effects of icariin by network analysis. Molecular Nutrition & Food Research 58 (1), 49–60. Sheng, M.Y., Chen, Q.F., Yang, Q.X., 2008. Variation in icariin and flavonoid contents of barrenwort accessions native to Guizhou, China. Biochemical Systematics and Ecology 36 (9), 719–723. Shin, Y.S., Zhao, C., Zhang, L.T., Park, J.K., 2015. Current status and clinical studies of oriental herbs in sexual medicine in korea. The World Journal of Men’s Health 33 (2), 62–72. Sofi, S.N., Shakeel-u-Rehman Qazi, P.H., Lone, S.H., Bhat, H.M., Bhat, K.A., 2014. Isolation, identification, and simultaneous quantification of five major flavonoids in Epimedium elatum by high performance liquid chromatography. Journal of Liquid Chromatography & Related Technologies 37 (8), 1104–1113. Song, J., Huang, H., Xia, Z., Wei, Y., Yao, N., Zhang, L., Zhang, Z., 2015. TPGS/phospholipids mixed micelles for delivery of icariside II to multidrug-resistant breast cancer. Integrative Cancer Therapies, 1534735415596571. Tali, B.A., Ganie, A.H., Nawchoo, I.A., Wani, A.A., Reshi, Z.A., 2015. Assessment of threat status of selected endemic medicinal plants using IUCN regional guidelines: a case study from Kashmir Himalaya. Journal for Nature Conservation 23, 80–89. Tantry, M.A., Dar, J.A., Idris, A., Akbar, S., Shawl, A.S., 2012. Acylated flavonol glycosides from Epimedium elatum, a plant endemic to the Western Himalayas. Fitoterapia 83 (4), 665–670. Wang, G.J., Tsai, T.H., Lin, L.C., 2007. Prenylflavonol, acylated flavonol glycosides and related compounds from Epimedium sagittatum. Phytochemistry 68 (19), 2455–2464. Wang, Y., Guo, Z., Jin, Y., Zhang, X., Wang, L., Xue, X., Liang, X., 2010. Identification of prenyl flavonoid glycosides and phenolic acids in Epimedium koreanum Nakai by Q-TOF-MS combined with selective enrichment on click oligo (ethylene glycol) column. Journal of Pharmaceutical and Biomedical Analysis 51 (3), 606–616. Wang, B., Yan, F., Cai, L., 2014. Anti-fatigue properties of icariin from Epimedium brevicornum. BioMed Research International 25 (3), 297–302. Wang, Z.M., Song, N., Ren, Y.L., 2015. Anti-proliferative and cytoskeleton-disruptive effects of icariin on HepG2 cells. Molecular Medicine Reports 12 (5), 6815–6820. Wu, H., Lien, E.J., Lien, L.L., 2003. Chemical and pharmacological investigations of Epimedium species: a survey. Progress in Drug Research, 1–57, Birkhäuser Basel.s. Xiao, M., Li, Q., Wang, L., Guo, L., Li, J., Tang, L., Chen, F., 2006. ISSR analysis of the genetic diversity of the endangered species Sinopodophyllym hexandrum (Royle) Ying from western Sichuan Province, China. Journal of Integrative Plant Biology 48 (10), 1140–1146. Xie, J.P., Wang, Z.D., Sun, W.J., 2007. The Investigation of epimedin C and icariin in the leaves of 9 species of Epimedium. Chinese Traditional and Herbal Drugs 38, 613–614. Xie, X., Pei, F., Wang, H., Tan, Z., Yang, Z., Kang, P., 2015. Icariin: a promising osteoinductive compound for repairing bone defect and osteonecrosis. Journal of Biomaterials Applications, 0885328215581551. Xiong, W., Ma, X., Wu, Y., Chen, Y., Zeng, L., Liu, J., Hu, Y., 2015. Determine the structure of phosphorylated modification of icariin and its antiviral activity against duck hepatitis virus A. BMC Veterinary 11 (1), 205. Xu, Y., Li, Z., Yuan, L., Zhang, X., Lu, D., Huang, H., Wang, Y., 2013. Variation of epimedins A–C and icariin in ten representative populations of Epimedium brevicornu Maxim., and implications for utilization. Chemistry & Biodiversity 10 (4), 711–721. Zhai, Y.K., Guo, X.Y., Ge, B.F., Zhen, P., Ma, X.N., Zhou, J., Chen, K.M., 2014. Icariin stimulates the osteogenic differentiation of rat bone marrow stromal cells via activating the PI3K–AKT–eNOS–NO–cGMP–PKG. Bone 66, 189–198. Zhang, W., Chen, H., Wang, Z., Lan, G., Zhang, L., 2013. Comparative studies on antioxidant activities of extracts and fractions from the leaves and stem of

Please cite this article in press as: Lone, S.A., et al., Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromat. Plants (2016), http://dx.doi.org/10.1016/j.jarmap.2016.11.003

G Model JARMAP-102; No. of Pages 10 10

ARTICLE IN PRESS S.A. Lone et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2016) xxx–xxx

Epimedium koreanum Nakai. Journal of Food Science and Technology 50 (6), 1122–1129. Zhang, L., Zhang, Z., Luo, Q., Lu, H., Liang, Y., 2014a. Evaluation and prediction of the antioxidant activity of Epimedium from multi-wavelength chromatographic fingerprints and chemometrics. Analytical Methods 6 (4), 1036–1043. Zhang, X., Liu, T., Huang, Y., Wismeijer, D., Liu, Y., 2014b. Icariin: does it have an osteoinductive potential for bone tissue engineering? Phytotherapy Research 28 (4), 498–509. Zhao, H., Guo, Y., Li, S., Han, R., Ying, J., Zhu, H., Cai, J., 2015. A novel anti-cancer agent Icaritin suppresses hepatocellular carcinoma initiation and malignant growth through the IL-6/Jak2/Stat3 pathway. Oncotarget 6 (31), 31927–31943.

Zhou, C., Chen, Z., Lu, X., Wu, H., Yang, Q., Xu, D., 2015. Icaritin activates JNK-dependent mPTP necrosis pathway in colorectal cancer cells. Tumor Biology, 1–10. Zong, M., Liu, H.L., Qiu, Y.X., Yang, S.Z., Zhao, M.S., Fu, C.X., 2008. Genetic diversity and geographic differentiation in the threatened species Dysosma pleiantha in China as revealed by ISSR analysis. Biochemical Genetics 46, 180–196.

Please cite this article in press as: Lone, S.A., et al., Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromat. Plants (2016), http://dx.doi.org/10.1016/j.jarmap.2016.11.003