Genetic Predisposition to Developmental Dysplasia of the Hip

The Journal of Arthroplasty xxx (2019) 1e10

Contents lists available at ScienceDirect

The Journal of Arthroplasty journal homepage: www.arthroplastyjournal.org

Genetic Predisposition to Developmental Dysplasia of the Hip Eustathios Kenanidis, MD, MSc, PhD a, b, *, Nifon K. Gkekas, MD, MSc a, b, Areti Karasmani, MD a, Panagiotis Anagnostis, MD, PhD, MSc, FRSPH a, Panayiotis Christofilopoulos, MD c, Eleftherios Tsiridis, MD, MSc, PhD, FACS, FRCS a, b a

Centre of Orthopaedic and Regenerative Medicine (CORE), Center for Interdisciplinary Research and Innovation (CIRI)-Aristotle University of Thessaloniki (AUTH), Thessaloniki, Balkan Center, Greece b Academic Orthopaedic Department, Aristotle University Medical School, General Hospital Papageorgiou, Thessaloniki, Greece c Orthopaedic Department, La Tour Hospital, Geneva, Switzerland

a r t i c l e i n f o

a b s t r a c t

Article history: Received 14 April 2019 Received in revised form 14 July 2019 Accepted 12 August 2019 Available online xxx

Background: The etiopathogenesis of developmental dysplasia of the hip (DDH) has not been clarified. This systematic review evaluated current literature concerning all known chromosomes, loci, genes, and their polymorphisms that have been associated or not with the prevalence and severity of DDH. Methods: Following the established methodology of Meta-analysis of Observational Studies in Epidemiology guidelines, MEDLINE, EMBASE, and Cochrane Register of Controlled Trials were systematically searched from inception to January 2019. Results: Forty-five studies were finally included. The majority of genetic studies were candidate gene association studies assessing Chinese populations with moderate methodological quality. Among the most frequently studied are the first, third, 12th,17th, and 20th chromosomes. No gene was firmly associated with DDH phenotype. Studies from different populations often report conflicting results on the same single-nucleotide polymorphism (SNP). The SNP rs143384 of GDF5 gene on chromosome 20 demonstrated the most robust relationship with DDH phenotype in association studies. The highest odds of coinheritance in linkage studies have been reported for regions of chromosome 3 and 13. Five SNPs have been associated with the severity of DDH. Animal model studies validating previous human findings provided suggestive evidence of an inducing role of mutations of the GDF5, CX3CR1, and TENM3 genes in DDH etiopathogenesis. Conclusion: DDH is a complex disorder with environmental and genetic causes. However, no firm correlation between genotype and DDH phenotype currently exists. Systematic genome evaluation in studies with larger sample size, better methodological quality, and assessment of DDH patients is necessary to clarify the DDH heredity. The role of next-generation sequencing techniques is promising. © 2019 Elsevier Inc. All rights reserved.

Keywords: developmental dysplasia hip DDH genes chromosome polymorphism genetic

Developmental dysplasia of the hip (DDH) is one of the most common skeletal deformities [1,2]. DDH is a complex syndrome that encompasses a broad spectrum of anatomical malformations of the growing hip, sharing in common the abnormal relationship

One or more of the authors of this paper have disclosed potential or pertinent conflicts of interest, which may include receipt of payment, either direct or indirect, institutional support, or association with an entity in the biomedical field which may be perceived to have potential conflict of interest with this work. For full disclosure statements refer to https://doi.org/10.1016/j.arth.2019.08.031. This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. * Reprint requests: Eustathios Kenanidis MD, MSc, PhD, Pontou 25, Panorama, 55236, Thessaloniki, Greece. https://doi.org/10.1016/j.arth.2019.08.031 0883-5403/© 2019 Elsevier Inc. All rights reserved.

between the femoral head and acetabulum. Deformities in the shape, size, and orientation of the femoral head, acetabulum, or both are variably expressed [3]. The hips that are grossly deformed, either subluxated or dislocated, are easily recognized at birth and are managed accordingly [4]. However, some subtle characteristics of dysplastic hips, such as shallowness and underdevelopment of the acetabulum, may escape diagnosis [5]. The undetected dysplasia of the hip is one of the primary causes of premature hip osteoarthritis [6]. The prevalence of DDH demonstrates global variability [7]. The population-weighted average incidence of DDH ranges from 0.06 per 1000 births in Black Africans to 76.1 per 1000 births in Native Americans [7]. In a cross-sectional study of a nationally representative sample, 1.52% of Chinese adults were diagnosed to have DDH;

2

E. Kenanidis et al. / The Journal of Arthroplasty xxx (2019) 1e10

the prevalence was significantly higher among women and rural inhabitants compared with men and urban inhabitants, respectively [8]. The etiopathogenesis of DDH is poorly understood; it is a complex disorder that is considered to be multifactorial in origin, implicating both environmental and genetic causative factors [1,2]. Besides, the development of hip joint is composite, involving the timed specific interactions of genes and encoding proteins. Female sex, breech fetal presentation, multiple gestations or primiparity, high birth weight, and oligohydramnios have been reported as risk factors for DDH [9]. Swaddling of babies, which is a technique of covering them with clothes on legs in extension and adduction, has also been accused of increased risk for DDH [10]. Like other complex diseases, it is probable that mutations in many genes contribute to the DDH pathology. Although the primary pathophysiological mechanisms have not been fully clarified, the genetic basis of DDH is well accepted and evidenced through familial heredity [5]. Monozygotic twins have been showed to have a higher risk of DDH than dizygotic twins [10]. Besides, a 12-fold increase for DDH among the first-degree relatives has been reported [11]. There is, also, a relationship between DDH and congenital muscular torticollis, metatarsus adductus, and club foot [12]. A sensitive, precise, and cost-efficient diagnostic blood test for DDH would be beneficial. However, at the moment, it remains a deceptive goal. Numerous genetic studies have highlighted the relationship of candidate genes with DDH phenotype [1]. The autosomal dominant mode with incomplete penetrance is the prevalent theory of inheritance [5]. Besides, the higher availability and lower cost of the new genetic methods will augment research in the next years [5]. The primary aim of our study was to systematically review the literature with regard to the association between genetic predisposition and the risk of DDH. The secondary endpoint was to identify genetic variants (mutations, polymorphisms) potentially related to the severity of the disease. Materials and Methods This systematic review followed the Meta-analysis of Observational Studies in Epidemiology (MOOSE) guidelines [13]. The review protocol was registered in the International Prospective Register of Systematic Reviews (PROSPERO) under the registration number CRD42019124430.

animal model studies that validated the results of human DDH genetics; (4) had no information on responsive genes for DDH or AD. Data Sources and Search Strategy We performed a systematic search of MEDLINE (PubMed), EMBASE, and Cochrane Register of Controlled Trials covering the period from conception until January 31, 2019. Free text searching was combined with Medical Subject Headings terms; the detailed search strategy used can be found in Supplementary Table 1. Moreover, the reference lists of the previously identified studies were manually searched for lost records. Two independent investigators (N.K.G. and A.K.) initially screened all the available eligible articles. Any discrepancy was resolved by a third investigator not involved in the primary procedure (E.K.). The various reasons for ineligible trials are presented in Figure 1. Data Extraction Two researchers (N.K.G. and A.K.) reviewed in duplicate all eligible studies. The following data were extracted and recorded: (1) first author; (2) date of publication; (3) country of origin of the study; (4) nationality of patients; (5) study design; (6) sample size of cases and controls; (7) chromosomes, genes, loci, and variants of genes associated with DDH; (8) genetic methods used. Parameters related to the severity of disease, bilateral or unilateral DDH, and types of DDH were also recorded. Risk of Bias and Study Quality Assessment Two individual investigators assessed the quality of the studies, whereas a senior author resolved disagreements by consensus. We used the Newcastle-Ottawa Scale [14] to assess the methodological rigor of the studies. The Newcastle-Ottawa Scale evaluates studies based on three criteria: participant selection, comparability of study groups, and assessment of outcome or exposure. A study can be awarded a maximum of four stars for the selection, a maximum of two stars for the comparability, and a maximum of three stars for the outcome/exposure category. Studies obtaining eight or nine stars were rated as high quality, those with six or seven of moderate quality, and studies with five or fewer stars were defined as low quality [15]. Results

Inclusion and Exclusion Criteria Descriptive Data The following Population, Intervention or exposure, Comparison, Outcome (PICO) components were applied as inclusion criteria for the systematic review: (1) Population: patients with DDH or acetabular dysplasia (AD); (2) Intervention or exposure: gene mutations or genetic polymorphisms; (3) Comparison group: people without DDH; (4) Outcome: incidence or severity of DDH. Specific inclusion criteria were set as follows: (1) studies conducted in adults or non-adult patients suffering from DDH or AD who had not previously received any surgical treatment; (2) clinically and radiologically proven disease; (3) studies investigating the prevalence of specific genes, variants, or polymorphisms in DDH populations; (4) studies providing extractable data; (5) retrospective, prospective cohorts, case-control, cross-sectional studies were eligible; (6) studies on animal models validating the results of previous human genetic DDH studies. Studies were excluded if they (1) included patients suffering from DDH as a part of a general extraskeletal clinical syndrome; (2) were written in non-English language; (3) were conducted in animals, with the exception of

The initial search disclosed 1742 available references. After the exclusion of duplicates, 1353 records were finally assessed. Sixty articles were deemed relevant after screening for the title and abstract and were evaluated as full texts for eligibility (Figure 1). Of those, fifteen articles were excluded because of the following reasons: (1) genetic study on hip osteoarthritis (n ¼ 3) [16e18]; (2) no full text in English (n ¼ 4) [19e22]; (3) non-human study (n ¼ 1) [23]; (4) DDH as a part of a greater extraskeletal disorder (n ¼ 2) [24,25]; (5) nonegene-detection study (n ¼ 5) [26e30]. Forty-five studies were finally included in the qualitative analysis [1e3,5,31e71]. The studies were published between 1994 and 2018; however, more than half of them were performed during the last five years. Half of the studies evaluated Chinese populations. The sample size ranged from 8 to 8786 cases, yielding a total number of 11.489 cases suffering from DDH or AD. The vast majority of the studies were case-control ones evaluating sporadic cases of DDH. Ten studies assessed the prevalence

E. Kenanidis et al. / The Journal of Arthroplasty xxx (2019) 1e10

3

Eligibility

Screening

IdenƟficaƟon

Records idenƟfied through databases: MEDLINE= 760 SCOPUS=880 COCHRANE=102

Records screened aŌer duplicates removed (n = 1353)

Records excluded by Ɵtle and abstract (n = 1293)

Full-text arƟcles assessed for eligibility (n = 60)

Full-text arƟcles excluded, with reasons (n = 15)

Included

Studies included in qualitaƟve synthesis (n =45)

Studies included in quanƟtaƟve synthesis (meta-analysis) (n =45)

Fig. 1. Meta-analysis of Observational Studies in Epidemiology guidelines flowchart illustrating the search strategy.

of genes in families [5,34,41,52,59,63,66e69], and five evaluated both sporadic and familial cases of DDH [33,35,37,38,49]. The vast majority were candidate gene association studies (CGAS). During the last five years, genome-wide association, linkage, and whole exome sequencing (WES) studies have been increasingly performed. The main characteristics of the studies are presented in Table 1. DDH diagnosis was radiologically and clinically confirmed; however, the radiological evaluation and the determination of the severity of DDH was not uniform. Seven studies provided no specific radiological information about the evaluation, diagnosis confirmation, type, and severity of the involved dysplastic hips [1,33,34,40,43,44,53]. This was also true for two other studies that did not specify a part of DDH population [35,38]. Eleven studies provided information on the classification of the involved dysplastic hips, but without any report on the percentage of different types [32,39,45,47,48,55,56,58,59,61,63]. Twenty-three studies provided considerable information about the diagnosis and the number of studied cases per DDH type [2,3,5,31,36,37,41, 42,46,49e52,54,57,60,62,64e69]. The methodological quality of studies varied considerably. Eighteen studies were considered of moderate [2,32,39,40,42,45,47, 48,50,51,58,60,61,63,64,67e69] and twenty-five of low quality [1,3,5,31,33e38,41,43,44,46,49,52e57,59,62,65,66]. Data on bias assessment are presented in Supplementary Table 2. Power analysis

and sample size evaluation were performed only in six studies [2,36,39,45,58,63]. Jawadi et al. did perform a power analysis but without reaching the necessary sample size [3]. Genetic Loci Associated with the Risk of DDH All genes, loci, and variants that involved in the etiopathogenesis of DDH are depicted in Tables 2 and 3. The first, third, 12th,17th, and 20th are the most frequently studied chromosomes. Among the most common loci and related genes are locus 3p22.2 with gene CX3CR1 (C-X3-C motif chemokine receptor 1); locus 9q22.31 with gene ASPN (Asporin); loci 17q21.32 and 17q21.33 with HOXB9 (homeobox B9) and COL1A1 (collagen type I alpha 1 chain) genes; and locus 20q11.21 with PDRG1 (p53 and DNA damageregulated 1), GDF5 (growth differentiation factor 5), UQCC1 (ubiquinol-cytochrome c reductase complex assembly factor 1), and MMP24 (matrix metallopeptidase 24) genes. However, no gene, locus, or variant has been firmly correlated with DDH phenotype yet. Interestingly, specific genes and variants were associated with DDH etiopathogenesis in some but not all studies. Data Based on the Odds Ratio in Association Studies Four studies reported on rs143383 and rs143384 polymorphisms of the GDF5 gene on chromosome 20 that were

4

E. Kenanidis et al. / The Journal of Arthroplasty xxx (2019) 1e10

Table 1 Demographics, Baseline Patient and Study Characteristics, and Type of Genetic Methods Used in Human Studies. Study(reference)

Year

Population

Radiographic Diagnosis of DDH Cases

Description of DDH

Study Design

Basit et al. [34] Feldman et al. [5]

2018

Saudi Arabian American/ USA British

Uni & Bil DDH 3 severely & 4 moderately affected based on radiographic criteria Adequate radiologic information

F F

CS CS

S

CC

Saudi Arabian

AD: 20%/Dislo: 42% AD þ Subl: 12%/AD þ Dislo 26% N/A Set A: Dislo Set B: AD, Subl, Dislo N/A Bil Dislo: 90%/Uni Dislo: 10% Bil Dislo N/A Uni & Bil AD, Subl, Dislo Set A: Dislo, set B: N/A

S

CC

B S

CC CC

S S F S S B

CC CC CS CC CC CC

B S B

CC CC CS

S S S S

CC CC CC CC

Beukes Hip Dysplasia 11 severely & 13 moderately affected based on radiographic criteria AD, Subl, Dislo Uni: 181, Bil: 11 DDH based on specific radiographic criteria Uni & Bil AD: 36, Subl: 95, Dislo: 566 11 severely & 13 moderately affected based on radiographic criteria AD

F B

CS CS

S S

CC CC

1022 (460/562) 383 (192/191)

CGAA CGAA

S

CC

1404 (697/707)

CGAA

F

CS

S

CC

227 (64/163)

Bil Dislo: 7/Uni Dislo: 147 AD: 24/Subl: 32/Dislo: 254 Bil: 11, Uni: 198 Uni & Bil AD, Subl, Dislo Uni & Bil AD, Subl, Dislo Specific radiographic criteria

S S S S S F

CC CC CC CC CC CS

334 797 382 815 781 15

Severe cases based on radiographic criteria AD: 41, Subl: 61, Dislo: 387 Based on center edge angle & Acetabular Index giving means Severe cases based on radiographic criteria AD

S

CC

478 (239/239)

CGAA

S S

CC CC

1056 (505/551) 140 (45/95)

CGAA CGAA

S

CC

478 (239/239)

CGAA

S

CC

552 (64/488)

CGAA

S F S

CC CS CC

960 (338/622) 114 (41/73) 146 (45/101)

CGAA CGLA CGAA

F F F

CS CS CS

17 (8/9) 32 (N/A) 47 (23/24)

GWLA GWLA RFLP

Hatzikotoulas et al. [2] Jawadi et al. [3] Sadat-Ali et al. [33] Yan et al. [32]

Saudi Arabian Han Chinese

Zhang et al. [1] Zhu et al. [31] Basit et al. [41] Li et al. [40] Ma et al. [39] Qiao et al. [38]

Han Chinese N/A Saudi Arabian Han Chinese Han Chinese Han Chinese

2017

Qiao et al. [37] Sekimoto et al. [36] Zhao et al. [35] Xu et al. [42] Cengic et al. [45] Sun et al. [44] Yilmaz et al. [43] Watson et al Feldman et al. [49]

Han Chinese Japanese Han Chinese 2016 2015

2014

Han Chinese Caucasian Han Chinese Turkish African American/ USA

Hao et al. [48] Liu et al. [47]

Han Chinese Han Chinese

Shi et al. [46]

Han Chinese

Feldman et al. [52]

2013

Sekimoto et al. [51] Zhao et al. [50] Jia et al. [54] Tian et al. [53] Shi et al. [56] Zhu et al. [55] Feldman et al. [59]

N/A

2012 2011 2010

Rouault et al. [58] Wang et al. [57] Ghosh et al. [62]

American/ USA

2009

Han Chinese Han Chinese Han Chinese Han Chinese Han Chinese American/ USA French Han Chinese N/A

Rouault et al. [61]

French

Yamanaka et al. [60] Dai et al. [64] Rubini et al. [63] Kapoor et al. [65]

Japanese

2007

Han Chinese Italian Caucasian

Mabuchi et al. [66] Roby et al Beighton et al

2006 1999 1994

Japanese African African

2008

Uni & Bil Dislo AD 4 Family DDH: Dislo, sporadic DDH: N/A Uni & Bil Dislo Wiberg’s center-edge angle < 20 N/A N/A

AD: 6%, Subl: 16%, Dislo: 78% Family probands with Subl & Dislo Based on center edge angle & Acetabular Index giving means AD Beukes Hip Dysplasia Beukes Hip Dysplasia

Sample Size (Cases/Controls) 8 (4/4) 15 (7/8) 8786 (770/8016) 100 (50/50) 473 (100/373) A: 886 (386/500) B:1143 (574/569) 944 (386/558) 20 (10/10) 5 (3/2) 1378 (689/689) 4206 (1064/3142) A: 760 (409/351) B: 34 (19/15) 3027 (984/2043) 96 (64/32) 59 (41/18) 624 220 2643 55

(170/454) (68/152) (1141/1502) (26/29)

40 (N/A) 72 (24)

72 (24)

(154/180) (310/487) (209/173) (370/445) (368/413) (9/6)

Genetic Method GWLA & ES WES GWAS CGAA CGAA GWAS & CGAA CGAA WES GWLA & ES CGAA CGAA CGAA CGAA CGAA WES CGAA CGAA GWAS PCR and direct sequencing Sanger & WES GWLA & WES

GWLA & WES

Whole-genome CNV & tiling microarray CGAA CGAA CGAA CGAA CGAA GWLA

DDH, developmental dysplasia of the hip; AD, acetabular dysplasia; Subl, subluxation; Dislo, dislocation; Uni, unilateral; Bil, bilateral; N/A, non-answered; F, familial; S, sporadic; CC, case-control; CS, cross-sectional; CGAA, candidate gene association analysis; CGLA, candidate gene linkage analysis; GWLA, genome-wide linkage analysis; GWAS, genome-wide association study; WES, whole exome sequencing; ES, exome sequencing; CNV, copy number variation; PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism.

related with a higher prevalence of DDH phenotype [2,33,58,64]. They demonstrated that the odds ratio of TT genotype in both rs143383 and rs143384 polymorphisms was significantly higher in DDH population than that of CC or other genotype

combinations. The single nucleotide polymorphisms (SNPs) rs143384 of the GDF5 gene on chromosome 20 demonstrated the most robust relation with DDH phenotype in association studies (odds ratio ¼ 1.44, P ¼ 3.55  1022) [2]. The SNP

E. Kenanidis et al. / The Journal of Arthroplasty xxx (2019) 1e10

5

Table 2 Chromosomes, Loci, Genes, and Polymorphisms Positively Correlated With DDH Risk. Chromosome (Reference)

Locus

Gene

Polymorphism

Risk

1 [34,41,54]

1p12 1p36.12 1q25.2

NOTCH2 HSPG2 PAPPA2

c.2355G > C; p.Lys785Asn c.3328G > T rs726252

3 [34,40,49,52]

1q32.1 2p11.2 2q31.1 3p22.2

ATP2B4 RETSAT HOXB9 CX3CR1

c.2264G > A rs711819 rs3732378

4 [5,35,68,69]

2.5-Mb region chr338-42 3q25.2 4q21.21

All affected members of a family All affected members of a family Different allele frequency DDH vs controls (P ¼ .001) All affected members of the family Gene-based analysis, P ¼ 3.70  108 OR ¼ 1.79, P ¼ .045 OR ¼ 2.25, 95% CI: 1.42e3.56 All affected members in a family OR ¼ 1.84, 95% CI: 1.19e2.84 LOD score ¼ 3.31

DHX36 BMP2K

4q34.3-q35.1

TENM3

1815-133C > T c.1432_1440delCAGCAGCAG, c.1440_1441insCAG A to C transversion at 183721398

4q35 4q35

UFSP2 -

c.868T > C 11-cM region between D4S1554 and D4S3051

6p21.32 6q21

WISP3 (CCN6)

6q25.1-q25.2

ESR1

chr6:33,053,906-33,069,893 rs1022313, rs10456877 s69306665, rs17073268 rs1230345 Taq I/Pvu II

7p14.1

TXNDC3

rs10250905

7p15.3

IL-6

rs1800796

8 [34] 9 [31,36,51,56]

8q12.2 9q22.2

CHD7 Sema4D ASPN

c.2373G > A Copy number loss Copy number loss within 60-kb region that harbors gene

10 [47]

10q21.1

DKK1

2 [2,53]

rs3732379

6 [1,34,65]

7 [37,39,45]

D14 the risk and D13 protective allele rs1569198 rs11001560

11 [31] 12 [32,34,65]

11p11.2 12q13.11 12q24.33

LRP4 VDR POLE

-

-

Xba I 1359 þ 117_1359 þ 47delTACGCACGTGTGCCGTCGTCCCCCT CGGCCCTACACCGAGTGTACGGA CCCCGACGAGGCACCGGTAGACC Intronic SNP rs61930502

13 [66]

13q22

15 [34] 17 [31,48,50,57,59]

15q13.3 17p13.1 17q21.32

6.0 cm between D13S1296 and D13S162 MYH10 HOXB9

Several genes PCDH9, DACH, two genes encoding Kruppel-like factors rs17228178, rs1534200 rs2303486

-

4-Mb region between rs2597165 and rs996379

17q21.33

COL1A1

T-139C, C-106T, C-35T [rs113647555]

17q23.2

TBX4

rs3744448

19p13.2 19q13.2

TGFB1

20q11.21 20q11.22

PDRG1 GDF5

rs466123-rs2112461 rs1800470 rs1800470 rs143383

19 [34,39,45]

20 [2,33,44,58,64]

rs143384

All affected members in a family All affected members in a multigeneration family 40 members of Beukes family Members of Beukes family LOD scores 3.58 & 5.73 All affected individuals of a family OR between 0.71 and 0.77 (P < .01) Homozygosity was related with higher AI, P ¼ .03/Pvu II pp associated with low CE (P ¼ .07) Allele T; OR: 0.786, P ¼ 1.53  105 genotype TT; OR: 0.761, P ¼ .0075 OR ¼ 6.36, 95% CI: 2.57e15.7 OR ¼ 0.84, P ¼ .0228 OR ¼ 25.86, P ¼ 4.81  104 More AD (9/64) than controls (0/32); P ¼ .0212. Correlation with worse radiological parameters D14 vs D13, OR ¼ 2.03, CI: 1.38-2.99 A allele frequency, OR ¼ 3.032, 95% CI: 2.034e4.519 Associated with genotype distribution (c2 ¼ 21.9, P < .0001) OR ¼ 2.1, 95% CI: 0.9e4.6 -

Significantly related to DDH vs controls, P ¼ 2.65  107 & 2.0  104 Maximal multipoint LOD score of 3.57 Affected members of a family OR ¼ 1.32, 95% CI: 1.02e1.7 and associated with severity, OR ¼ 1.35, 95% CI: 1.01e1.80 The maximum multipoint LOD score ¼ 1.82 at SNP rs16949053 x2 ¼ 9.917, P ¼ .0016 between DDH and controls OR ¼ 0.56, 95% CI: 0.32- 0.97/related to severity OR ¼ 0.73, 95% CI ¼ 0.55-0.97 OR ¼ 2.42, 95% CI: 1.08e5.43 OR ¼ 1.255, P ¼ .0004 Gene-based analysis P ¼ 1.06  107 OR TT genotype vs CT þ CC ¼ 1.52, 95% CI: 1.05-2.19 OR ¼ 1.40, 95% CI: 1.11-1.75/with severity OR ¼ 1.43; 95% CI: 1.11-1.85 OR TT vs other genotypes ¼ 0.641, 95% CI: 0.932e2.891 allele A, OR ¼ 1.44, 95% CI: 1.34e1.56, P ¼ 3.55  1022 (continued on next page)

6

E. Kenanidis et al. / The Journal of Arthroplasty xxx (2019) 1e10

Table 2 (continued ) Chromosome (Reference)

21 [34]

Locus

Gene

20q11.22

UQCC/UQCC1

20q11.22 21q22.3

MMP24 PCNT

Polymorphism

Risk

rs6060373 640-129_640-128insT

ORTT genotype vs CTþCC ¼ 1.71, 95% CI:1.18-2.48 Allele A, OR ¼ 1.18, P ¼ .0338 Gene-based analysis P ¼ 1.86  1010 Gene-based analysis P ¼ 3.18  109 -

NOTCH2, notch receptor 2; HSPG2, heparan sulfate proteoglycan 2; PAPPA2, pappalysin 2; ATP2B4, ATPase plasma membrane Ca2þ transporting 4; RETSAT, retinol saturase; HOXB9, homeobox B9; CX3CR1, C-X3-C motif chemokine receptor 1; DHX36, DEAH-box helicase 36; BMP2K, BMP2 inducible kinase; UFSP2, ubiquitin-fold modifier 1 (Ufm1)specific peptidase 2 gene; TENM3, teneurin transmembrane protein 3; WISP3 (CCN6), cellular communication network factor 6; ESR1, estrogen receptor 1; TXNDC3, NM23 family member 8; IL-6, interleukin-6; CHD7, chromodomain helicase DNA binding protein 7; Sema4D, semaphorin 4D; ASPN, asporin; DKK1, dickkopf WNT signaling pathway inhibitor 1; LRP4, LDL receptorerelated protein 4; VDR, vitamin D receptor; POLE, DNA polymerase epsilon, catalytic subunit; MYH10, myosin heavy chain 10; COL1A1, collagen type I alpha 1 chain; TBX4, T-box 4; TGFB1, transforming growth factor beta 1; PDRG1, p53 and DNA damage regulated 1; GDF5, growth differentiation factor 5; UQCC1, ubiquinol-cytochrome c reductase complex assembly factor 1; MMP24, matrix metallopeptidase 24; PCNT, pericentrin; OR, odds ratio; LOD, logarithm of the odds; AI, acetabular index; CE, center edge angle; CI, confidence interval.

rs143383 of GDF5 gene has also been related with the severity of DDH [64].

region of 2.61-Mb from the p term of chromosome 3 that was coinherited in an American family [52]. Other linkage studies reported on the LOD score can be found in Table 2 and 3.

Data Based on the Logarithm of the Odds Score in Linkage Studies Association Between Gene Variants and the Severity of DDH Six linkage studies reported on “logarithm of the odds”, the socalled LOD score, estimating the possibility of a variant being cosegregating in a family [49,52,59,63,66,68]. One of the highest LOD scores in a linkage study (LOD: 3.31) has been reported for a

The potential association between specific gene polymorphisms and the severity of DDH was reported in seven studies [39,46,48,55,57,64,65]. The following SNPs rs143383 of GDF5 gene

Table 3 Chromosomes, Loci, Genes, and Variants That Were Not Correlated With DDH Risk. Chromosome (Reference)

Locus

Gene

Variant

Risk

1 [41,46] 3 [34,38,41,43,55]

1q25.2 3p14.1

PAPPA2 ADAMTS9

OR: 0.892, 95% CI ¼ 0.699-1.137 (CA)n ¼ 17.3, P ¼ .960

3p22.2

CX3CR1

rs726252 Number of cytosineeadenine base pair repetition [(CA)n] rs3732379

3p24.3

DVWA

rs3732378 rs3732379 rs7639618, rs9864422, and rs11718863

6 [60,65]

6q25.1-q25.2

ER/ESR1

PvuII and XbaI RFLPs

12 [3,60,63,65,67]

12q13.11

VDR

Xba I wild-type genotype rs731236 (TaqI), rs1544410 (BsmI), rs7975232 (ApaI), rs2228570 (FokI) Fok I ff genotype ApaI and TaqI RFLPs

14 [42]

14q24.2

COL2A1 & VDR COL2A1 SMOC1

15 [62]

15q21.1

FBN1

R2726W

17 [41,48,57,61]

17q21.32

HOXB9

rs8844

Different haplotypes rs3742912

rs8844 and rs2303486

20 [41,58]

17q21.33

COL1A1

17q23.2

TBX4

rs1061947, rs2586488, rs2075559, rs2857396, rs2696247, rs2141279, rs17639446, rs2075555, rs909102 Rs3744438

20q11.22

GDF5

rs224334

Not present in an affected member of the family Allele G, OR: 1.54, 95% CI: 0.85-2.78 Allele C, OR: 0.68, 95% CI: 0.4-1.17 No significant association between hip dislocations (P ¼ .44), subluxations (P ¼ .95), and instability (P ¼ .27) vs controls No difference for PvuII (P ¼ .065) and Xba I (P ¼ .258) between AD vs controls OR: 2.1, 95% CI: 0.9-4.6 No significant difference between DDH and controls Not different between DDH and controls, P ¼ .18 No difference for ApaI (P ¼ .082) and Taq I (P ¼ .271) between AD vs controls LOD score < 2 Negative LOD scores No difference for all genotypes P ¼ .57 between DDH and controls All DDH and controls homozygous for Arg2727 allele No difference between DDH and controls even after stratification for severity No difference between A/G and A/T polymorphisms in DDH and controls No difference for polymorphisms in DDH and controls No difference between DDH/controls in allele/genotype frequencies even stratified for severity OR: 0.65, 95% CI: 0.32-1.30

PAPPA2, pappalysin 2; ADAMTS9, ADAM metallopeptidase with thrombospondin type 1 motif 9; CX3CR1, C-X3-C motif chemokine receptor 1; DVWA, collagen type VI alpha 4 pseudogene 1; ESR1, estrogen receptor 1; VDR, vitamin D receptor; COL2A1, collagen type II alpha 1 chain; SMOC1, SPARC-related modular calcium binding 1; FBN1, fibrillin 1; HOXB9, homeobox B9; COL1A1, collagen type I alpha 1 chain; TBX4, T-box 4; GDF5, growth differentiation factor 5; RFLPs, restriction fragment length polymorphisms; OR, odds ratio; AD, acetabular dysplasia; LOD, logarithm of odds; CI, confidence interval.

E. Kenanidis et al. / The Journal of Arthroplasty xxx (2019) 1e10

[64], rs2303486 of HOXB9 gene [48], and rs3744448 of the Tbx4 gene (T-box 4) [57] and homozygosity for the mutant Taq I Vitamin D receptor t allele and Pvu II pp estrogen receptor genotype [65] were associated with the severity of DDH or radiological parameters of AD. On the other hand, the SNPs rs1800470 in TGFB1 (transforming growth factor beta 1) [39]; rs726252 in PAPPA2 (pappalysin 2) [46]; and rs7639618, rs9864422, and rs11718863 in DVWA (collagen type VI alpha 4 pseudogene 1) gene [55] were not related to the severity of the disease. Animal Models Validating Mutations Found in Genetic Human DDH Studies Animal model studies validated the effect of mutations found previously in human DDH studies [5,69e71]. A threonine to methionine amino acid change in the coding sequence of the CX3CR1 chemokine receptor that was found strongly associated with DDH in an American family [52] was examined in a knock-out murine model [71]. The CX3CR1 ablation affected the morphology of the acetabulum and the gait of knocked-out mice, providing suggestive evidence of an inducing role of CX3CR1 gene in etiopathogenesis of DDH [71]. In another mouse model, the downstream regulation of the GDF5 led to subtle alterations in the morphology of the acetabulum, femoral head, and shaft predisposing to subsequent hip degeneration [70]. Feldman et al. demonstrated that mutated Teneurin 3 (TENM3) slowed chondrogenesis and delayed the development of acetabulum and glenoid fossa in knock-in mutant mice [5]. A unique UFSP2 (ubiquitin-fold modifier 1-specific peptidase 2) mutation was found to segregate with Beukes hip dysplasia phenotype and inactivates UFSP2 proteolytic function, thus accusing the ubiquitin-fold modifier 1 cascade in this type of hip dysplasia [69]. Discussion To the best of our knowledge, this is the first systematic review summarizing the association between specific genetic variants and the risk of DDH. None of the studied polymorphisms has been firmly related to DDH etiopathogenesis. Studies from different populations often report conflicting results on the same gene polymorphism. The SNP rs143384 of GDF5 gene on chromosome 20 was the one most powerfully related with DDH phenotype in association studies [2]. The highest LOD score of coinheritance in a linkage study has been reported for a region of chromosome 3 in an American family [52]. Five SNP polymorphisms rs143383 of GDF5 gene [64], rs2303486 of HOXB9 gene [48], rs3744448 of the Tbx4 gene [57], and homozygosity for the mutant Taq I Vitamin D receptor t allele and Pvu II pp estrogen receptor genotype [65] were related with the severity of the DDH. The number of genetic studies on DDH has been steadily increasing during the last years. Chinese populations have been more frequently studied. CGAS are the vast majority of studies; however, recently, the number of WES and genome-wide association and linkage studies has increased. The methodological quality of studies is generally moderate to low. DDH is a disease with considerable heterogeneity. It is characterized by a broad spectrum of acetabular, femoral, and softtissue deformities leading to femoroacetabular incongruency and sometimes subluxation or dislocation [10]. Each DDH patient is a single entity. Gross deformities are recognized at birth, and treatment usually follows; AD may remain undetected for a long time, often being recognized in adult life together with hip arthritis [5]. The prevalence of DDH varies around the world, being highly reported in Japan, the Mediterranean, and other countries [7]. Most studies and control programs aim to report on

7

subluxated or luxated hips that are easily recognized, but AD usually remains unidentified. There is no doubt that a realistic estimate of the prevalence of the disease, especially for AC, is missing [8]. As a result, a precise and cost-efficient genetic test for DDH would be beneficial; however, at the moment, it remains a deceptive goal [5]. It is necessary to augment the number of genetic studies to the countries with a high prevalence of the disease. The rationale of the disease remains more or less unknown. The heredity is a well-accepted factor, mainly due to the high prevalence of DDH in different members of a family or identical twins [11]; however, no evidence exists concerning a firm gene linkage with the disease. The mode of inheritance is still debated; the autosomal prevalent inheritance with incomplete penetrance between the generations is considered the most possible. Recent studies, however, have demonstrated a different mode of heredity. Basit et al. [41] identified rare heterozygous damaging variants in HSPG2 (heparan sulfate proteoglycan 2) and ATP2B4 (ATPase plasma membrane Ca2þ transporting 4) genes in three affected members and the asymptomatic mother of a third-generation family. Although incomplete penetrance was also supported, this study was the first to report digenic inheritance of DDH. The choice of the genetic method is crucial to validate the genetic variation to phenotypic diversity. The association, linkage, and exome sequencing are the primary studies. The CGAS is the most popular; this is an observational case-control study in which the presence of a set of variants, most commonly SNPs, is compared between two populations; the one demonstrating and the other not demonstrating the phenotype, ideally matched by age, sex, and ethnicity [2]. Numerous candidate genes for DDH, such as HOXB9, UQCC1, DKK 1 (dickkopf WNT signaling pathway inhibitor 1), GDF5, TBX4, ASPN, TGFB1, IL-6 (Interleukin-6), and PAPPA2 have been reported in association studies in different populations [2,39,47,48,54,56,57]. rs143383 and rs143384 Polymorphisms at the GDF5 gene on chromosome 20 were among the most frequently reported SNPs associated with DDH [2,33,58,64]. In one of the largest wide-association studies, Hatzikotoulas and Roposch [2] compared 770 patients with DDH to 8016 controls. They reported the most robust association between DDH phenotype and a leading variant rs143384 at GDF5 gene on chromosome 20 [2]. On the other hand, Basit et al. [41] demonstrated that GDF5 was not a pathogenic variant in the affected members of a Saudi Arabian family. Genome-wide linkage analysis is a genetic method, looking for parts of chromosomes that are coinherited by the phenotypically affected but not present in the unaffected members of a family. This method is more efficient to find responsible variants for rare diseases [49]. Several linkage studies revealed novel variants as CX3CR1, BMP2K (BMP2 inducible kinase), and HSPG2, as responsive genes for DDH [41,49,52]. The results of linkage studies are validated with the LOD score; a score higher than three expresses the possibility that a gene and a phenotype do not coincide in a family by chance. A high LOD score of 3.31 was demonstrated in a linkage study for a region close to the p term of chromosome 3 in an American family [52]. All severely affected members of the family shared the variant rs3732378, causing a specific mutation in the CX3CR1 gene. In addition, in a case-control Chinese study [40], the CX3CR1 was reported as a candidate gene and rs3732378 and rs3732379 susceptible variants for DDH. By contrast, Qiao et al. [38] showed no association between these variants of the CX3CR1 gene and the risk of DDH in the Chinese population. Similarly, in a Saudi Arabian family, the variant rs3732379 did not segregate with DDH; it was not present in one of the affected members [34]. Besides, several previously mentioned genes (namely ASPN, HOXB9, DKK1, GDF5, PAPPA2, TGFB1) were not related to the disease in this family [34].

8

E. Kenanidis et al. / The Journal of Arthroplasty xxx (2019) 1e10

Modern genetic studies promise more accurate results. The WES is a genetic technique that first isolates the protein-coding region of genes, known as exome (1% of the human genome) and then sequences this exonic part of DNA to identify variants that alter the protein sequences [5]. It is usually performed in the small population of the extremely affected phenotypes (in specific families) to find candidate variants that can be confirmed by genotyping in a larger population [5]. Till now, WES studies are minimal. Feldman et al. [5] using WES and genetic material from the more affected individuals in a four-generation family found a novel damaging mutation on chromosome 4q35; this encodes glutamine to proline change at position 2665 in the TENM3 gene that was cosegregated only by the severely affected individuals. The mutation was considered responsible for retarding the maturation of mesenchymal cells intended for chondrocytes [5]. Using also WES, Zhu et al. [31] found specific mutations involved in cytoskeleton structure and function in patients with DDH. The combination of genome-wide linkage analysis and WES has also been reported in Saudi Arabian populations [34,41]. Recently, a novel UFSP2 mutation was recognized to segregate with the phenotype of Beukes hip dysplasia [69]. This is a rare form of hip dysplasia inherited as an autosomal dominant disorder of variable penetrance that was initially described in a South African family of European origin [72]. The number of global copy number variant (CNV) detection studies are also limited in DDH. CNV is a phenomenon of structural variability of the human genome in which short or long parts of the genome are repeated or deleted among individuals [36]. Almost two-thirds of the human genome is constituted from repeats that are recognized as crucial determinants of the human interindividual inevitable variation [36]. Their role has been identified in certain diseases, such as Charcot-Marie-Tooth disease [36]. Three CNV studies for DDH have been conducted in small AD and DDH samples [34,36,51]. Using whole-genome CNV analysis, Sekimoto et al. provided evidence of CNV loss in the semaphorin 4D gene and ASPN gene region in patients with different types of AD [51]. Basit et al., 2018, [34] also found a shared CNV gain on chr6p21.32 among four individuals having DDH in a family. Nowadays, it is also feasible to evaluate the effect of a mutation in animal models [70, 71]. Despite several limitations, these functional studies can validate the mutations found in previous genetic human studies in an animal model, providing further insight into the mechanism of hip development and the etiology of DDH. Murine models provided suggestive evidence on the effect of CX3CR1 deletion on murine acetabular development [71] and further elucidated the role of GDF5 and its regulatory mechanism on hip morphology and growth [70]. The present study has several limitations contributing to conflicting results of the studies between populations. First, the lack of adequately defined and matched groups, insufficient sample size estimation, and stratification of the population represent a unique potential for false-positive results in association studies. Second limitation is the underestimation of the clinical and radiological information of DDH cases. Almost half of the studies did not provide information about the types or severity of DDH cases studied. Better radiologic and clinical evaluation of the affected people and correlation of findings with the severity of the disease are certainly needed. Conclusion Our study summarized all known chromosomes, loci, genes, and their polymorphisms that have been associated or not with the prevalence and severity of DDH. The SNP rs143384 of GDF5 gene on chromosome 20 demonstrated the most robust relation with DDH phenotype in association studies. The highest odds of coinheritance

in linkage studies have been reported for regions of chromosome 3 and 13. Five SNPs have been associated with the severity of DDH. However, at the moment, no firm correlation between genotype and DDH phenotype exist. The previous generation genetic techniques failed to reveal the genetic etiopathogenesis of DDH. Systematic evaluation of genome-wide variation in DDH in studies with larger sample size, better methodological quality, and radiological and clinical assessment of patients with DDH is necessary to clarify the heritable biology of the disease. The role of nextgeneration sequencing techniques in DDH genetics is promising. References [1] Zhang J, Yan M, Zhang Y, Yang H, Sun Y. Association analysis on polymorphisms in WISP3 gene and developmental dysplasia of the hip in Han Chinese population: a case-control study. Gene 2018;664:192e5. https:// doi.org/10.1016/j.gene.2018.04.020. [2] Hatzikotoulas K, Roposch A, DDH Case Control Consortium, Shah KM, Clark MJ, Bratherton S, et al. Genome-wide association study of developmental dysplasia of the hip identifies an association with GDF5. Commun Biol 2018;1: 56. https://doi.org/10.1038/s42003-018-0052-4. [3] Jawadi AH, Wakeel A, Tamimi W, Nasr A, Iqbal Z, Mashhour A, et al. Association analysis between four vitamin D receptor gene polymorphisms and developmental dysplasia of the hip. J Genet 2018;97:925e30. https://doi.org/ 10.3748/wjg.v24.i36.4208. [4] Cady RB. Developmental dysplasia of the hip: definition, recognition, and prevention of late sequelae. Pediatr Ann 2006;35:92e101. [5] Feldman G, Kappes D, Mookerjee-Basu J, Freeman T, Fertala A, Parvizi J. A novel mutation in teneurin 3 found to Co-segregate in all affected in a multigeneration family with developmental dysplasia of the hip. J Orthop Res 2019;37:171e80. https://doi.org/10.1002/jor.24148. [6] Wyles CC, Heidenreich MJ, Jeng J, Larson DR, Trousdale RT, Sierra RJ. The John Charnley award: redefining the natural history of osteoarthritis in patients with hip dysplasia and impingement. Clin Orthop Relat Res 2017;475:336e50. https://doi.org/10.1007/s11999-016-4815-2. [7] Loder RT, Skopelja EN. The epidemiology and demographics of hip dysplasia. ISRN Orthop 2011;2011:238607. https://doi.org/10.5402/2011/238607. eCollection 2011. [8] Tian FD, Zhao DW, Wang W, Guo L, Tian SM, Feng A, et al. Prevalence of developmental dysplasia of the hip in Chinese adults: a cross-sectional Survey. Chin Med J (Engl) 2017;130:1261e8. https://doi.org/10.4103/0366-6999. 206357. [9] Ortiz-Neira CL, Paolucci EO, Donnon T. A meta-analysis of common risk factors associated with the diagnosis of developmental dysplasia of the hip in newborns. Eur J Radiol 2012;81:e344e51. https://doi.org/10.1016/j.ejrad.2011.11. 003. [10] Noordin S, Umer M, Hafeez K, Nawaz H. Developmental dysplasia of the hip. Orthop Rev (Pavia) 2010;2:e19. https://doi.org/10.4081/or. 2010.e19. [11] Stevenson DA, Mineau G, Kerber RA, Viskochil DH, Schaefer C, Roach JW. Familial predisposition to developmental dysplasia of the hip. J Pediatr Orthop 2009;29:463e6. https://doi.org/10.1097/BPO.0b013e3181aa586b. [12] Agarwal A, Gupta N. Risk factors and diagnosis of developmental dysplasia of hip in children. J Clin Orthop Trauma 2012;3:10e4. https://doi.org/10.1016/ j.jcot.2011.11.001. [13] Stroup DF, Berlin JA, Morton SC, Olkin I, Williamson GD, Rennie D, et al. Metaanalysis of observational studies in epidemiology: a proposal for reporting. Meta-analysis of Observational Studies in Epidemiology (MOOSE) group. JAMA 2000;283:2008e12. [14] Wells GA, Shea B, O’Connell D, Peterson J, Welch V, Losos M. The NewcastleOttawa Scale (NOS) for assessing the quality of non-randomized studies in meta-analyses. http://www.ohri.ca/programs/clinical_epidemiology/oxford. asp; 2016. [accessed 01.12.2016]. [15] Hoorntje A, Janssen KY, Bolder SBT, Koenraadt KLM, Daams JG, Blankevoort L, et al. The effect of total hip Arthroplasty on Sports and Work Participation: a systematic review and meta-analysis. Sports Med 2018;48:1695e726. https:// doi.org/10.1007/s40279-018-0924-2. [16] Aki T, Hashimoto K, Ogasawara M, Itoi E. A whole-genome transcriptome analysis of articular chondrocytes in secondary osteoarthritis of the hip. PLoS One 2018;13:e0199734. https://doi.org/10.1371/journal.pone.0199734. [17] Kolund zi c R, Trkulja V, Mikolau ci c M, Jovani c Kolund zi c M, Paveli c SK, Paveli c K. Association of interleukin-6 and transforming growth factor-b1 gene polymorphisms with developmental hip dysplasia and severe adult hip osteoarthritis: a preliminary study. Cytokines 2011;54:125e8. https://doi.org/ 10.1016/j.cyto.2011.02.004. [18] Granchi D, Stea S, Sudanese A, Toni A, Baldini N, Giunti A. Association of two gene polymorphisms with osteoarthritis secondary to hip dysplasia. Clin Orthop Relat Res 2002;403:108e17. [19] Li LY, Sun XK, Zhao Q, Zhang LJ, Li QW, Wang LL, et al. [Gene mapping of developmental dysplasia of the hip in chromosome 17q21 region]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 2010;27:620e5. https://doi.org/10.3760/cma.j.issn.1003-9406.2010.06.004.

E. Kenanidis et al. / The Journal of Arthroplasty xxx (2019) 1e10 [20] Jiang J, Ma HW, Li QW, Lu JF, Niu GH, Zhang LJ, et al. [Association analysis on the polymorphisms of PCOL2 and Sp1 binding sites of COL1A1 gene and the congenital dislocation of the hip in Chinese population]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 2005;22:327e9. [21] Ma HW, Lu Y, Jiang J, Wang YP, Li QW, Wang Y, et al. Transmission disequilibrium between congenital dislocation of the hip and homeobox-containing genes. Chin J Clin Rehabil 2005;9:190e1. [22] Jiang J, Ma HW, Lu Y, Wang YP, Wang Y, Li QW, et al. [Transmission disequilibrium test for congenital dislocation of the hip and HOXB9 gene or COL1AI gene]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 2003;20:193e5. [23] Ha BH, Jeon YJ, Shin SC, Tatsumi K, Komatsu M, Tanaka K, et al. Structure of ubiquitin-fold modifier 1-specific protease UfSP2. J Biol Chem 2011;286: 10248e57. https://doi.org/10.1074/jbc.M110.172171. [24] Eytan O, Sarig O, Israeli S, Mevorah B, Basel-Vanagaite L, Sprecher E. A novel splice-site mutation in the AAGAB gene segregates with hereditary punctate palmoplantar keratoderma and congenital dysplasia of the hip in a large family. Clin Exp Dermatol 2014;39:182e6. https://doi.org/10.1111/ced.12213. [25] Al Kaissi A, Laccone F, Karner C, Ganger R, Klaushofer K, Grill F. [Hip dysplasia and spinal osteochondritis (Scheuermann's disease) in a girl with type II manifesting collagenopathy]. Orthopade 2013;42:963e8. https://doi.org/ 10.1007/s00132-013-2182-1. [26] Wang CL, Wang H, Xiao F, Wang CD, Hu GL, Zhu JF, et al. Cyclic compressive stress-induced scinderin regulates progress of developmental dysplasia of the hip. Biochem Biophys Res Commun 2017;485:400e8. https://doi.org/10.1016/ j.bbrc.2017.02.065. [27] Feldman GJ, Peters CL, Erickson JA, Hozack BA, Jaraha R, Parvizi J. Variable expression and incomplete penetrance of developmental dysplasia of the hip: clinical challenge in a 71-member multigeneration family. J Arthroplasty 2012;27:527e32. https://doi.org/10.1016/j.arth.2011.10.016. [28] Cvjeticanin S, Marinkovic D. Genetic variability in the group of patients with congenital hip dislocation. Genetika 2005;41:1142e6. [29] Sollazzo V, Bertolani G, Calzolari E, Atti G, Scapoli C. A two-locus model for non-syndromic congenital dysplasia of the hip (CDH). Ann Hum Genet 2000;64:51e9. https://doi.org/10.1017/S0003480000007958. [30] Torisu T, Fujikawa Y, Yano H, Masumi S. Association of HLA-DR and HLA-DQ antigens with congenital dislocation and dysplastic osteoarthritis of the hip joints in Japanese people. Arthritis Rheum 1993;36:815e8. [31] Zhu LQ, Su GH, Dai J, Zhang WY, Yin CH, Zhang FY, et al. Whole genome sequencing of pairwise human subjects reveals DNA mutations specific to developmental dysplasia of the hip. Genomics 2018;111:320e6. https:// doi.org/10.1016/j.ygeno.2018.02.006. [32] Yan W, Hao Z, Tang S, Dai J, Zheng L, Yu P, et al. A genome-wide association study identifies new genes associated with developmental dysplasia of the hip. Clin Genet 2019;95:345e55. https://doi.org/10.1111/cge.13483. [33] Sadat-Ali M, Al-Habdan IM, Bubshait DA. Genetic Influence in developmental dysplasia of the hip in Saudi Arabian children due to GDF5 polymorphism. Biochem Genet 2018;56:618e26. https://doi.org/10.1007/s10528-018-9864-7. [34] Basit S, Alharby E, Albalawi AM, Khoshhal KI. Whole genome SNP genotyping in a family segregating developmental dysplasia of the hip detected runs of homozygosity on chromosomes 15q13.3 and 19p13.2. Congenit Anom (kyoto) 2018;58:56e61. https://doi.org/10.1111/cga.12235. [35] Zhao L, Zhou Z, Wang S, Jiao Q, Wu J, Ma F, et al. A recurrent mutation in bone morphogenetic proteins-2-inducible kinase gene is associated with developmental dysplasia of the hip. Exp Ther Med 2017;13:1773e8. https://doi.org/ 10.3892/etm.2017.4191. [36] Sekimoto T, Ishii M, Emi M, Kurogi S, Funamoto T, Yonezawa Y, et al. Copy number loss in the region of the ASPN gene in patients with acetabular dysplasia: ASPN CNV in acetabular dysplasia. Bone Joint Res 2017;6:439e45. https://doi.org/10.1302/2046-3758.67.BJR-2016-0094.R1. [37] Qiao L, Yan W, Dai J, Yao Y, Chen D, Xu Z, et al. A novel missense variant in TXNDC3 is associated with developmental dysplasia of the hip in Han Chinese population. Int J Clin Exp Pathol 2017;10:10483e8. [38] Qiao L, Dai J, Yan W, Yao Y, Sun Y, Chen D, et al. Variants rs3732378 and rs3732379 of gene CX3CR1 are not associated with developmental dysplasia of the hip in Han Chinese population. Int J Clin Exp Pathol 2017;10:2095e9. [39] Ma W, Zha Z, Chen K, Chen H, Wu Y, Ma J, et al. Genetic association study of common variants in TGFB1 and IL-6 with developmental dysplasia of the hip in Han Chinese population. Sci Rep 2017;7:10287. https://doi.org/10.1038/ s41598-017-11185-1. [40] Li L, Wang X, Zhao Q, Wang E, Wang L, Cheng J, et al. CX3CR1 polymorphisms associated with an increased risk of developmental dysplasia of the hip in human. J Orthop Res 2017;35:377e80. https://doi.org/10.1002/jor.23294. [41] Basit S, Albalawi AM, Alharby E, Khoshhal KI. Exome sequencing identified rare variants in genes HSPG2 and ATP2B4 in a family segregating developmental dysplasia of the hip. BMC Med Genet 2017;18:34. https://doi.org/ 10.1186/s12881-017-0393-8. [42] Xu X, Shi D, Yan W, Yao Y, Dai J, Shen Y, et al. Lack of association of a single nucleotide polymorphism in SMOC1 with developmental dysplasia of the hip: a case-control study. Int J Clin Exp Pathol 2016;9:10734e9. [43] Yilmaz AE, Atalar H, Acar M, Dogan M, Aytekin MN, Gunduz M, et al. The role of ADAMTS9 gene promoter (Ca) repeat in developmental hip dysplasia. Clin Invest Med 2015;38:E213e7. [44] Sun Y, Wang C, Hao Z, Dai J, Chen D, Xu Z, et al. A common variant of ubiquinol-cytochrome c reductase complex is associated with DDH. PLoS One 2015;10:e0120212. https://doi.org/10.1371/journal.pone.0120212.

9

[45] Cengic T, Trkulja V, Pavelic SK, Ratkaj I, Markova-Car E, Mikolaucic M, et al. Association of TGFB1 29C/T and IL6 -572G/C polymorphisms with developmental hip dysplasia: a case-control study in adults with severe osteoarthritis. Int Orthop 2015;39:793e8. https://doi.org/10.1007/s00264-015-2675-0. [46] Shi D, Sun W, Xu X, Hao Z, Dai J, Xu Z, et al. A replication study for the association of rs726252 in PAPPA2 with developmental dysplasia of the hip in Chinese Han population. Biomed Res Int 2014;2014:979520. https://doi.org/ 10.1155/2014/979520. [47] Liu S, Tian W, Wang J, Cheng L, Jia J, Ma X. Two single-nucleotide polymorphisms in the DKK1 gene are associated with developmental dysplasia of the hip in the Chinese Han female population. Genet Test Mol Biomarkers 2014;18:557e61. https://doi.org/10.1089/gtmb.2014.0044. [48] Hao Z, Dai J, Shi D, Xu Z, Chen D, Zhao B, et al. Association of a single nucleotide polymorphism in HOXB9 with developmental dysplasia of the hip: a case-control study. J Orthop Res 2014;32:179e82. https://doi.org/10.1002/ jor.22507. [49] Feldman GJ, Parvizi J, Sawan H, Erickson JA, Peters CL. Linkage mapping and whole exome sequencing identify a shared variant in CX3CR1 in a large multigeneration family. J Arthroplasty 2014;29:238e41. https://doi.org/10.1016/ j.arth.2014.05.014. [50] Zhao L, Tian W, Pan H, Zhu X, Wang J, Cheng Z, et al. Variations of the COL1A1 gene promoter and the relation to developmental dysplasia of the hip. Genet Test Mol Biomarkers 2013;17:840e3. https://doi.org/10.1089/gtmb.2013. 0179. [51] Sekimoto T, Ishii M, Emi M, Kurogi S, Funamoto T, Hamada H, et al. Segmental copy number loss in the region of Semaphorin 4D gene in patients with acetabular dysplasia. J Orthop Res 2013;31:957e61. https://doi.org/10.1002/ jor.22310. [52] Feldman GJ, Parvizi J, Levenstien M, Scott K, Erickson JA, Fortina P, et al. Developmental dysplasia of the hip: linkage mapping and whole exome sequencing identify a shared variant in CX3CR1 in all affected members of a large multigeneration family. J Bone Miner Res 2013;28:2540e9. https:// doi.org/10.1002/jbmr.1999. [53] Tian W, Zhao L, Wang J, Suo P, Wang J, Cheng L, et al. Association analysis between HOXD9 genes and the development of developmental dysplasia of the hip in Chinese female Han population. BMC Musculoskelet Disord 2012;13:59. https://doi.org/10.1186/1471-2474-13-59. [54] Jia J, Li L, Zhao Q, Zhang L, Ru J, Liu X, et al. Association of a single nucleotide polymorphism in pregnancy-associated plasma protein-A2 with developmental dysplasia of the hip: a case-control study. Osteoarthr Cartil 2012;20: 60e3. https://doi.org/10.1016/j.joca.2011.10.004. [55] Zhu L, Shi D, Dai J, Qin J, Fan J, Wang Z, et al. Lack of evidence for association between DVWA gene polymorphisms and developmental dysplasia of the hip in Chinese Han population. Rheumatol Int 2011;31:883e7. https://doi.org/ 10.1007/s00296-010-1410-9. [56] Shi D, Dai J, Zhu P, Qin J, Zhu L, Zhu H, et al. Association of the D repeat polymorphism in the ASPN gene with developmental dysplasia of the hip: a case-control study in Han Chinese. Arthritis Res Ther 2011;13:R27. https:// doi.org/10.1186/ar3252. [57] Wang K, Shi D, Zhu P, Dai J, Zhu L, Zhu H, et al. Association of a single nucleotide polymorphism in Tbx4 with developmental dysplasia of the hip: a case-control study. Osteoarthr Cartil 2010;18:1592e5. https://doi.org/ 10.1016/j.joca.2010.09.008. [58] Rouault K, Scotet V, Autret S, Gaucher F, Dubrana F, Tanguy D, et al. Evidence of association between GDF5 polymorphisms and congenital dislocation of the hip in a Caucasian population. Osteoarth Cartil 2010;18:1144e9. https:// doi.org/10.1016/j.joca.2010.05.018. [59] Feldman G, Dalsey C, Fertala K, Azimi D, Fortina P, Devoto M, et al. The Otto Aufranc Award: Identification of a 4 Mb region on chromosome 17q21 linked to developmental dysplasia of the hip in one 18-member, multigeneration family. Clin Orthop Relat Res 2010;468:337e44. https://doi.org/10.1007/ s11999-009-1073-6. [60] Yamanaka M, Ishijima M, Tokita A, Sakamoto Y, Kaneko H, Maezawa K, et al. Association of oestrogen receptor gene polymorphism with the long-term results of rotational acetabular osteotomy. Int Orthop 2009;33:1155e64. https://doi.org/10.1007/s00264-009-0730-4. [61] Rouault K, Scotet V, Autret S, Gaucher F, Dubrana F, Tanguy D, et al. Do HOXB9 and COL1A1 genes play a role in congenital dislocation of the hip? Study in a Caucasian population. Osteoarthr Cartil 2009;17:1099e105. https://doi.org/ 10.1016/j.joca.2008.12.012. [62] Ghosh S, Fryer AA, Hoban PR, Wynn-Jones C, Maffulli N. Fibrillin 1 gene with R2726W mutation is absent in patients with primary protrusio acetabuli and developmental dysplasia of the hip. Med Sci Monit 2009;15: CR199e202. [63] Rubini M, Cavallaro A, Calzolari E, Bighetti G, Sollazzo V. Exclusion of COL2A1 and VDR as developmental dysplasia of the hip genes. Clin Orthop Relat Res 2008;466:878e83. https://doi.org/10.1007/s11999-008-0120-z. [64] Dai J, Shi D, Zhu P, Qin J, Ni H, Xu Y, et al. Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study. Arthritis Res Ther 2008;10:R126. https://doi.org/ 10.1186/ar2540. [65] Kapoor B, Dunlop C, Wynn-Jones C, Fryer AA, Strange RC, Maffulli N. Vitamin D and oestrogen receptor polymorphisms in developmental dysplasia of the hip and primary protrusio acetabuli–a preliminary study. J Negat Results Biomed 2007;6:7. https://doi.org/10.1186/1477-5751-6-7.

10

E. Kenanidis et al. / The Journal of Arthroplasty xxx (2019) 1e10

[66] Mabuchi A, Nakamura S, Takatori Y, Ikegawa S. Familial osteoarthritis of the hip joint associated with acetabular dysplasia maps to chromosome 13q. Am J Hum Genet 2006;79:163e8. https://doi.org/10.1086/505088. [67] Beighton P, Cilliers HJ, Ramesar R. Autosomal dominant (Beukes) premature degenerative osteoarthropathy of the hip joint unlinked to COL2A1. Am J Med Genet 1994;53:348e51. https://doi.org/10.1002/ajmg.1320530408. [68] Roby P, Eyre S, Worthington J, Ramesar R, Cilliers H, Beighton P, et al. Autosomal dominant (Beukes) premature degenerative osteoarthropathy of the hip joint maps to an 11-cM region on chromosome 4q35. Am J Hum Genet 1999;64:904e8. https://doi.org/10.1086/302291. [69] Watson CM, Crinnion LA, Gleghorn L, Newman WG, Ramesar R, Beighton P, et al. Identification of a mutation in the ubiquitin-fold modifier 1-specific

peptidase 2 gene, UFSP2, in an extended South African family with Beukes hip dysplasia. S Afr Med J 2015;105:558e63. https://doi.org/10.7196/ SAMJnew.7917. [70] Kiapour AM, Cao J, Young M, Capellini TD. The role of Gdf5 regulatory regions in development of hip morphology. PLoS One 2018;13:e0202785. https:// doi.org/10.1371/journal.pone.0202785. [71] Feldman G, Offemaria A, Sawan H, Parvizi J, Freeman TA. A murine model for developmental dysplasia of the hip: ablation of CX3CR1 affects acetabular morphology and gait. J Transl Med 2017;15:233. https://doi.org/10.1186/ s12967-017-1335-0. [72] Cilliers HJ, Beighton P. Beukes familial hip dysplasia: an autosomal dominant entity. Am J Med Genet 1990;36:386e90.

E. Kenanidis et al. / The Journal of Arthroplasty xxx (2019) 1e10

Appendix Supplementary Table 1 PubMed “Search String”. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21.

hip dislocation, congenital [MeSH] OR [All Fields] developmental hip dysplasia [All Fields] developmental dysplasia of the hip [All Fields] DDH [All Fields] CDH [All Fields] congenital acetabular dysplasia [All Fields] acetabular dysplasia [All Fields] congenital hip subluxation [All Fields] 1 OR 2 OR 3 OR 4 OR 5 OR 6 OR 7 OR 8 (n¼13303) Genes [MeSH] OR [All Fields] loci, genetic [MeSH] OR [All Fields] genome [MeSH] OR [All Fields] genetic structures [MeSH] OR [All Fields] genetic variation [MeSH] OR [All Fields] mutation [MeSH] OR [All Fields] polymorphism, genetic [MeSH] OR [All Fields] mutagenesis [MeSH] OR [All Fields] DNA damage [MeSH] OR [All Fields] Genotype [MeSH] OR [All Fields] genetic variants [All Fields] 10 OR 11 OR 12 OR 13 OR 14 OR 15 OR 16 OR 17 OR 18 OR 19 OR 20 (n¼2912640) 22. 9 AND 21 (n¼ 760)

10.e1

Supplementary Table 2 Study Quality as Assessed by the Newcastle-Ottawa Scale. Id

First author, y

Selection

Comparability

Exposure/ Outcome

Overall Quality

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

Basit, 2018 Feldman, 2018 Hatzikotoulas, 2018 Jawadi, 2018 Sadat-Ali, 2018 Yan, 2018 Zhang, 2018 Zhu, 2018 Basit, 2017 Li, 2017 Ma, 2017 Qiao, Dai, 2017 Qiao, Yan, 2017 Sekimoto T., 2017 Zhao L., 2017 Xu X., 2016 Cengic T., 2015 Sun Y., 2015 Watson C.M., 2015 Yilmaz A.E, 2015 Feldman G., 2014 Hao Z., 2014 Liu S., 2014 Shi D., 2014 Feldman G., 2013 Sekimoto T., 2013 Zhao L., 2013 Jia J., 2012 Tian W., 2012 Shi D., 2011 Zhu L., 2011 Feldman G., 2010 Rouault K., 2010 Wang Κ., 2010 Ghosh S., 2009 Rouault K., 2009 Yamanaka M., 2009 Dai J., 2008 Rubini M., 2008 Kapoor B., 2007 Mabuchi A., 2006 Roby P., 1999 Beighton P., 1994

3 3 4 1 2 3 3 2 3 3 3 3 3 3 2 3 3 2 2 1 3 3 2 3 3 3 3 3 2 3 3 3 3 3 2 3 4 3 3 2 2 2 2

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 0 2 2 1 2 1 1 0 2 1 1 2 1 1 1 1 1 1 1

1 1 2 1 1 3 1 1 1 2 3 1 1 1 2 2 2 1 3 1 1 2 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 2 2 2 2 3 3

Low Low Moderate Low Low Moderate Low Low Low Moderate Moderate Low Low Low Low Moderate Moderate Low Moderate Low Low Moderate Moderate Low Low Moderate Moderate Low Low Low Low Low Moderate Low Low Moderate Moderate Moderate Moderate Low Low Moderate Moderate