Genetic Risk Factors in Japanese Alzheimer’s Disease Patients: α1-ACT, VLDLR, and ApoE

Neurobiology of Aging, Vol. 19, No. 1S, pp. S43–S46, 1998 Copyright © 1998 Elsevier Science Inc. Printed in the USA. All rights reserved 0197-4580/98 $19.00 1 .00

PII:S0197-4580(98)00035-9

Genetic Risk Factors in Japanese Alzheimer’s Disease Patients: a1-ACT, VLDLR, and ApoE H. YAMANAKA,* K. KAMIMURA,* H. TANAHASHI,* K. TAKAHASHI,* T. ASADA,† AND T. TABIRA1* *Division of Demyelinating Disease and Aging and †National Center Hospital for Nervous, Mental and Muscular Disorders, NCNP, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187, Japan YAMANAKA, H., K. KAMIMURA, H. TANAHASHI, K. TAKAHASHI, T. ASADA AND T. TABIRA. Genetic risk factors in Japanese Alzheimer’s disease patients: a1-ACT, VLDLR, and ApoE. NEUROBIOL AGING 19(1S) S43–S46, 1998.—We studied the polymorphism of a1-antichymotrypsin (ACT), very low density lipoprotein receptor (VLDLR) and apolipoprotein E (ApoE) genes in 200 control subjects and 65 patients with Alzheimer’s disease (AD) in Japanese. The subjects consisted of 30 patients with early onset familial Alzheimer’s disease (FAD), a patient with late onset FAD, 29 patients with an early onset isolated form of AD, and 5 patients with late onset AD. ApoE genotypes were significantly different between controls and FAD (p , 0.0005) or AD (p , 0.05), and patients carrying at least one ApoE e4 allele were found in 44% of FAD and 34.3% of AD; both were significantly different (p , 0.001) from the controls (12.5%). ACT genotypes and allele frequencies were not different among these groups except for genotypes between ApoE e42 FAD and ApoE e42 controls (p 5 0.019). There was a slight but significant increase of the 5 repeat allele of VLDLR in AD (p 5 0.014), but the difference was rather diminished in the presence of an ApoE e4 allele. None of combinations of ACT and VLDLR genotypes in the presence or absence of an ApoE e4 allele gave significant difference. Thus, we conclude that among the reported genetic risk factors, ApoE e4 is the only definite risk factor for both FAD and AD, and the VLDLR polymorphism might be associated with AD cases in Japanese. © 1998 Elsevier Science Inc. Alzheimer’s disease Familial Alzheimer’s disease low density lipoprotein receptor

Risk factor

IT is now generally accepted that genetic factors are involved in the pathogenesis of Alzheimer’s disease (AD). So far, three disease genes for familial Alzheimer’s disease (FAD) are identified; amyloid precursor protein (APP) (3), presenilin 1 (PS1) (14), and presenilin 2 (PS2) (7,12). In addition, several risk factor genes have been reported. Among them, the e4 allele of apolipoprotein E (ApoE) is known as the major risk factor for AD (2,13), which was confirmed in Japanese populations (11,15). Further, two other genes are postulated; a1-antichymotrypsin (ACT) (6) and very low density lipoprotein receptor (VLDLR) genes (9), in which the risk was significantly increased when the ACT or VLDLR polymorphism was combined with the ApoE e4 allele. However, these were not confirmed in other studies (1,4,10). Therefore, we conducted studies in Japanese patients to see if any combinations of these three genes increase the risk.

Apolipoprotein E

a1-antichymotrypsin

Very

genes of APP (exons 16 and 17), PS1 (exons 4–13), and PS2 (exons 4–13) (the results will be reported precisely elsewhere). Control samples were collected from 163 patients without dementing or mental disorders (75 males and 88 females) and 37 patients with vasucular dementia or other non-Alzheimer dementia. Genomic DNA was extracted from peripheral blood leukocytes and subjected for polymerase chain reaction (PCR) amplification. Statistical analysis was done by the x2 test. ApoE Genotyping The primer sequences used to detect the tri-allelic polymorphism of ApoE were 59 TCCAAGGAGCTGCAGGCGGCGCA and 59 ACAGAATTCGCCCCGGCCTGGTACACTGCCA (16). PCR was conducted in a final volume of 15 mL sample containing 15 ng genomic DNA, 15 pmol of each primer, 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 10% (v/v) dimethylsulfoxide, 200 mM of each dNTP, and 0.8 units of Taq DNA polymerase. PCR amplification was done by 30 cycles of 1 min. at 94°C, 1 min. at 62°C, and 1 min. at 72°C. The product was digested for 3 h with Hha I, and subjected to electrophoresis in 15% polyacrylamide gel.

MATERIALS AND METHODS

Subjects Thirty-one FAD patients from 27 families (13 males, 18 females) and 34 patients with an isolated form of AD (8 males, 26 females) were examined. They all fulfilled the NINCDS-ADRDA criteria (8). All FAD patients except for one showed early onset (,65 years old) of the disease (mean age of onset, 50.3 years). Twenty-nine of 34 AD cases were of early onset (mean, 51.6 years). All had no mutations in

ACT Genotyping The ACT bi-allelic polymorphism in a single peptide alteration (A/T) was determined by amplification of the 124 bp fragment.

1 Address correspondence to: Takeshi Tabira, National Center Hospital for Nervous, Mental and Muscular Disorders, NCNP, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187, Japan; E-mail: [email protected].

S43

S44

YAMANAKA ET AL. TABLE 1 FREQUENCIES OF APOE GENOTYPES AND e4 ALLELES

FAD AD FAD1AD Cont-1 Cont-2#

n

2/2

2/3

2/4

3/3

3/4

4/4

e41

e42

31 34 65 200 875

0 0 0 11 (5.5) 1 (0.1)

0 1 (2.9) 1 (1.5) 28 (14.0) 67 (7.7)

1 (3.2) 1 (2.9) 2 (3.1) 1 (0.5) 6 (0.7)

17 (54.8) 21 (61.8) 38 (58.5) 136 (68.0) 677 (77.4)

9 (29.0) 10 (29.4) 19 (29.2) 22 (11.0) 122 (13.9)

4 (12.9) 1 (2.9) 5 (7.7) 2 (1.0) 2 (0.2)

18 (29.0) 13 (19.1) 31 (23.8) 27 (6.8) 132 (7.5)

44 (71.0) 55 (80.9) 99 (76.2) 373 (93.3) 1618 (92.5)

Frequencies of ApoE genotypes and alleles are shown in familial Alzheimer’s disease (FAD), isolated cases of Alzheimer’s disease (AD), and our controls (Cont-1) with percentages in parentheses. #, Reported Japanese controls (15). The difference in genotypes is significant between FAD and Cont-1 (p 5 0.0002), AD and Cont-1 (p 5 0.042), between FAD1AD and Cont-1 (p , 0.0001). The difference in e4 allele frequencies is significant between FAD and Cont-1 (p , 0.0001), AD and Cont-1 (p 5 0.0007), and FAD1AD and Cont-1 (p , 0.0001).

Used primers were 59CAGAGTTGAGAATGG and 59TTCTTCTGGGTCAGATTC (6). Amplification was done in a 10 mL reaction sample consisting of 10 ng genomic DNA, 5 pmol of each primer, 160 mM of each dNTP, 50 mM Tris-HCl pH 8.3, 50 mM KCl, 1% Triton-X 100, 2 mM MgCl2, and 0.5 units of Taq DNA polymerase. PCR amplification was done by 35 cycles of 1 min. at 94°C, 1 min. at 58°C, and 2 min. at 72°C. The product was digested for 3 h with Bst NI, and subjected to electrophoresis in 12% polyacrylamide gel. Allele A was characterized by two distinctive bands of 84 bp and 33 bp, while allele T was detected as a single distinctive band. VLDLR Genotyping The primer sequences used in amplification of the polymorphic CGG repeat in the 59-untranslated region of VLDLR gene were A34R:59GCAGCCAGA-GCGCCCAGAGCG and UA: 59AGGGCTGGTAACTTGTTGTGCGGAG (5). The primer A34R was end-labeled with g-[32P]ATP using the polynucleotide kinase. PCR was conducted in a final volume of 10 mL solution containing 10 ng genomic DNA, 10 pmol of each primer, 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 10% (v/v) dimethylsufoxide, 200 mM of each dNTP, and 0.5 units of Taq DNA polymerase. PCR amplification was done by 30 cycles of 1 min. at 94°C, 1 min. at 62°C, and 1 min. at 72°C. PCR product was electrophoresed in the 6% denaturing polyacrylamide gel. RESULTS

ApoE ApoE genotypes were significantly different between FAD and controls (p 5 0.042), between AD and controls (p 5 0.0002), and between total AD and controls (p , 0.0001), but were not different between FAD and AD (p 5 0.529). Allele frequencies of ApoE e4 were significantly higher in FAD (p , 0.0001), AD (p 5 0.0007), and total AD (p , 0.0001) than controls (Table 1). When patients with other dementing diseases were excluded from the control, the difference in ApoE genotypes was again significant between FAD and controls (p , 0.0001), between AD and controls (p , 0.0057), and between total AD and controls (p , 0.001). Our controls were essentially the same as those reported by others in Japan (15), except for a slightly higher incidence of ApoE e2 in ours probably due to the difference in age distribution and to the inclusion of non-Alzheimer patients. ACT The AA genotype of ACT was slightly decreased in FAD, AD, and total AD, but the difference was not statistically significant.

The allele frequencies were also not different. There was no significant difference in any of the combinations of ACT genotypes and ApoE e4 except for in those between ApoE e42 FAD and ApoE e42 controls (p 5 0.019) (Table 2). Even though non-Alzheimer dementia patients were excluded from the control, no statistically significant difference was seen in ACT genotypes and the allele frequencies. VLDLR The genotypes were not different between AD and FAD, FAD and controls, AD and controls, and total AD and controls. The 8 repeat allele was slightly more frequent in FAD, but the difference was not statistically different. The 5 repeat allele was slightly higher in AD than controls (p 5 0.014), but this difference disappeared in the presence of ApoE e4 (Table 3). When nonAlzheimer dementia patients were excluded from the control, the difference in the genotypes was again statistically significant between AD and controls (p 5 0.045). All Combinations We looked for differences among all combinations of ACT and VLDLR genotypes in the presence or absence of ApoE e4, but none gave statistical significance. DISCUSSION

Here we analyzed the reported genetic risk factors in Japanese AD and FAD, and compared with Japanese controls. As in most other studies, ApoE e4 was a significant risk factor for both FAD and AD in this study. Most of our patients had early onset of the disease. This higher association with early onset AD was reported by Okuizumi and others (11). Most of our controls came from a northern part of Japan. When our controls were compared with the reported large series of Japanese controls (15) in terms of ApoE genotype frequencies, they were essentially the same except for a slightly higher incidence of ApoE e2 in our controls. This difference could be due to the difference in age; our controls consisted of slightly older individuals. Also, our controls contained 34 patients with non-Alzheimer dementia. However, VLDLR allele frequencies of our controls were also not different from other Japanese controls (9). Therefore, our controls seem to reflect the general Japanese population. As a matter of fact, exclusion of patients with non-Alzheimer dementing disease from our controls did not affect the results. Kamboh et al. (6) reported that frequencies of the genotype A/A or allele A were significantly higher in AD particularly in the presence of an ApoE e4 allele, but we could not confirm this in

GENETIC RISK FACTORS IN ALZHEIMER’S DISEASE

S45 TABLE 2

FREQUENCIES OF ACT GENOTYPES AND ALLELES

FAD ApoE e41 ApoE e42 AD ApoE e41 ApoE e42 FAD1AD ApoE e41 ApoE e42 Cont ApoE e41 ApoE e42

n

AA

AT

TT

A

T

31 14 17 34 12 22 65 26 39 200 25 175

3 (9.7) 2 (14.3) 1 (5.9)* 5 (14.7) 3 (25.0) 2 (9.1) 8 (12.3) 5 (19.2) 3 (7.7) 48 (24.0) 6 (24.0) 42 (24.0)

17 (54.8) 10 (71.4) 7 (41.2)* 21 (61.8) 5 (41.7) 16 (72.7) 38 (58.5) 15 (57.7) 23 (60.0) 101 (50.5) 9 (36.0) 92 (52.6)

11 (35.5) 2 (14.3) 9 (52.9)* 8 (23.5) 4 (33.3) 4 (18.2) 19 (29.2) 6 (23.1) 13 (33.3) 51 (25.5) 10 (40.0) 41 (23.4)

23 (37.1) 14 (50.0) 9 (26.5) 31 (45.6) 11 (45.8) 20 (45.5) 54 (41.5) 25 (48.1) 29 (37.2) 197 (49.3) 21 (42.0) 176 (50.3)

39 (62.9) 14 (50.0) 25 (73.5) 37 (54.4) 13 (54.2) 24 (54.5) 76 (58.5) 27 (51.9) 49 (62.8) 203 (50.8) 29 (58.0) 174 (49.7)

Frequencies of ACT genotypes and alleles are shown with percentages in parentheses. There is no statistically significant difference except for genotype frequencies between ApoE e42 FAD and ApoE e42 Cont (p 5 0.019).

Japanese. Although we saw a slight difference in the genotypes between ApoE e42 FAD and ApoE e42 controls, the meaning is unknown. Okuizumi et al. (9) reported that frequencies of the 5 repeat allele in VLDLR gene were significantly higher in AD than controls particularly in the presence of an ApoE e4 allele. Because the genotypes and allele frequencies were quite different between Japanese and Caucasians, no significant association of this polymorphism was observed in Caucasian patients with AD (10). In our study, we could confirm a slight but significant increase of the 5 repeat allele in Japanese patients with AD. Frequencies of the 5 repeat allele tended to be higher in those patients with the age of onset being younger than 65 years (9). This was compatible with the fact that our patients consisted mainly of early onset AD cases. Therefore, VLDLR could be a risk factor gene for Japanese AD patients, particularly for those who have earlier age of onset, although the polymorphism exists in the non-coding region. Because our study did not confirm the positive modification by ApoE e4, these risk factors seem to be independent. We speculated that a higher risk could be seen in combinations

of certain genotypes of ACT and VLDLR, particularly in those who carry ApoE e4. However, we could not see any significant genotype combinations that increase the risk of Alzheimer’s disease. Therefore, the combination analysis of these genes is not useful to detect high risk people. In our AD and FAD cases, all possible mutations of APP, PS1, and PS2 were excluded. Although ApoE e4 was confirmed as an important genetic risk factor, we found only 5 individuals who were homozygous for ApoE e4 (4 in FAD and 1 in AD), and 60% of the patients were free from ApoE e4. Therefore, we conclude that important disease gene(s) and/or risk factor gene(s) are missing. ACKNOWLEDGEMENT

We thank Drs. Mitsuo Kaneko, Hirofumi Metoki, Tetsuo Kitaguchi, Shinobu Kawakatsu, Kuniaki Tanaka, Mitsuhiro Osame, Shotai Kobayashi, Manabu Hashimoto, and Tomofumi Yoshinaga for providing us patients’ blood samples. This work was partially supported by a grant from Science and Technology Agency (COE) and by a grant for Research on Aging and Health from the Ministry of Health and Welfare, Japan.

TABLE 3 FREQUENCIES OF VLDLR GENOTYPES AND ALLELES

FAD e41 e42 AD e41 e42 FAD1AD e41 e42 Cont e41 e42

n

9/8

8/8

8/5

5/5

9

8

5

31 14 17 34 12 22 65 26 39 200 25 175

0 0 0 1 (2.9) 1 (8.3) 0 1 (1.5) 1 (3.8) 0 0 0 0

15 (48.4) 7 (50.0) 8 (47.1) 8 (23.5) 4 (33.3) 4 (18.2) 23 (35.4) 11 (42.3) 12 (30.8) 71 (35.5) 5 (20.0) 66 (37.7)

13 (41.9) 7 (50.0) 6 (35.3) 17 (50.0) 6 (50.0) 11 (50.0) 30 (46.2) 13 (50.0) 17 (43.6) 103 (51.5) 16 (64.0) 87 (49.7)

3 (9.7) 0 3 (17.6) 8 (23.5) 1 (8.3) 7 (31.8) 11 (16.9) 1 (3.8) 10 (25.6) 26 (13.0) 4 (16.0) 22 (12.6)

0 0 0 1 (1.5) 1 (4.2) 0 1 (0.8) 1 (1.9) 0 0 0 0

43 (69.4) 21 (75.0) 22 (64.7) 34 (50.0) 15 (62.5) 19 (43.2) 77 (59.2) 36 (69.2) 41 (52.6) 245 (61.3) 26 (52.0) 219 (62.6)

19 (30.6) 7 (25.0) 12 (35.3) 33 (48.5)* 8 (33.3) 25 (56.8) 52 (40.0) 15 (28.8) 37 (47.4) 155 (38.8) 24 (48.0) 131 (37.4)

Frequencies of VLDLR genotypes and alleles are shown with percentages in parentheses. There is no statistical difference except for allele 5 frequencies between AD and Cont (p 5 0.014).

S46

YAMANAKA ET AL. REFERENCES

1. Chung, H.; Roberts, C. T.; Greenberg, S.; Rebeck, G. W.; Christie, R.; Wallace, R.; Jacob, H. J.; Hyman, B. T. Lack of association of trinucleotide repeat polymorphisms in very-low-density lipoprotein receptor gene with Alzheimer’s disease. Ann. Neurol. 39:800 – 803; 1996. 2. Corder, E. H.; Saunders, A. M.; Strittmatter, W. J.; Schmechel, D. E.; Gaskell, P. C.; Small, G. W.; Roses, A. D.; Haines, J. L.; PericakVance, M. A. Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer’s disease in late onset families. Science 261:921–923; 1993. 3. Goate, A.; Chartier-Harlin, M. C.; Mullan, M.; Brown, J.; Crawford, F.; Fidani, L.; Giuffra, L.; Haynes, A.; Irving, N.; James, L.; Mant, R.; Newton, P.; Rooke, K.; Roques, P.; Talbot, C.; Pericak-Vance, M. A.; Roses, A.; Williamson, R.; Rossor, M.; Owen, M.; Hardy, J. Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer’s disease. Nature 349:704 –706; 1991. 4. Haines, J. L.; Pitchard, M. L.; Saunders, A. M.; Schildkraut, J. M.; Growdon, J. H.; Gaskell, P. C.; Farrer, L. A.; Auerbach, S. A.; Gusella, J. F.; Locke, P. A.; Rosi, B. L.; Yamaoka, L.; Small, G. W.; Conneally, P. M.; Roses, A. D.; Pericak-Vance, M. A. No genetic effect of alpha 1-antichymotrypsin in Alzheimer disease. Genomics 33:53–56; 1996. 5. Jokinen, E.; Sakai, J.; Yamamoto, T.; Hobbs, H. H. CGG triple repeat polymorphism in VLDL receptor (VLDL-R) gene. Hum. Mol. Genet. 3:521; 1994. 6. Kamboh, M. I.; Sanghera, D. K.; Ferrell, R. E.; DeKosky, S. T. APOE 4-associated Alzheimer’s disease risk is modified by alpha 1-antichymotrypsin polymorphism. Nature Genet. 10:486 – 488; 1995. 7. Levy-Lahad, E.; Wasco, W.; Poorkaj, P.; Romano, D. M.; Oshima, J.; Pettingell, W. H.; Yu, C. E.; Jondro, P. D.; Schmidt, S. D.; Wang, K.; Crowley, A. C.; Fu, Y-H.; Guenette, S. Y.; Gals, D.; Nemens, E.; Wijsman, E. M.; Bird, T. D.; Schellenberg, G. D.; Tanzi, R. E. Candidate gene for the chromosome 1 familial Alzheimer’s disease locus. Science 269:973–977; 1995. 8. McKhann, G.; Drachman, D.; Folstein, M.; Katzman, R.; Price, D.; Stadlan, E. M. Clinical diagnosis of Alzheimer’s disease: Report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer’s Disease. Neurology 34:939 –944; 1984.

9. Okuizumi, K.; Onodera, O.; Namba, Y.; Ikeda, K.; Yamamoto, T.; Seki, K.; Ueki, A.; Nanko, S.; Tanaka, H.; Takahashi, H.; Oyanagi, K.; Mizusawa, H.; Kanazawa, I.; Tsuji, S. Genetic association of very low density lipoprotein (VLDL) receptor gene with sporadic Alzheimer’s disease. Nature Genet. 11:207–209; 1995. 10. Okuizumi, K.; Onodera, O.; Seki, K.; Tanaka, H.; Namba, Y.; Ikeda, K.; Saunders, A. M.; Perikac-Vance, M. A.; Roses, A. D.; Tsuji, S. Lack of association of very low density lipoprotein (VLDL) receptor gene polymorphism with Caucasian Alzheimer’s disease. Ann. Neurol. 40:251–254; 1996. 11. Okuizumi, K.; Onodera, O.; Tanaka, H.; Kobayashi, H.; Tsuji, S.; Takahashi, H.; Oyanagi, K.; Seki, K.; Tanaka, M.; Naruse, S.; Miyatake, T.; Mizusawa, H.; Kanazawa, I. ApoE-e4 and early-onset Alzheimer’s disease. Nature Genet. 7:10 –11; 1994. 12. Rogaev, E. I.; Sherrington, R.; Rogaeva, E. A.; Levesque, G.; Ikeda, M.; Liang, Y.; Chi, H.; Lin, C.; Holman, K.; Tsuda, T.; Mar, L.; Sorbi, S.; Nacmias, B.; Piacentini, S.; Amaducci, L.; Chumakov, I.; Cohen, D.; Lamnfelt, L.; Fraser, P. E.; Rommens, J. M.; St George-Hyslop, P. H. Familial Alzheimer’s disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer’s disease type 3 gene. Nature 376:775–778; 1995. 13. Roses, A. D. Apolipoprotein E alleles as risk factors in Alzheimer’s disease. Annu. Rev. Med. 47:387– 400; 1996. 14. Sherrington, R.; Rogaev, E. I.; Liang, Y.; Rogaeva, E. A.; Levesque, G.; Ikeda, M.; Chi, H.; Lin, C.; Li, G.; Holman, K.; Tsuda, T.; Mar, L.; Foncin, J-F.; Bruni, A. C.; Montesi, M. P.; Sorbi, S.; Rainero, I.; Pinessi, L.; Nee, L.; Chumakov, I.; Pollen, D.; Brookes, A.; Sanseau, P.; Polinsky, R. J.; Wasco, W.; Da Silva, H. A. R.; Haines, J. L.; Pericak-Vance, M. A.; Tanzi, R. E.; Roses, A. D.; Fraser, P. E.; Rommens, J. M.; St George-Hyslop, P. H. Cloning of a gene bearing missense mutations in early-onset familial Alzheimer‘s disease. Nature 375:754 –760; 1995. 15. Ueki, A.; Kawano, M.; Namba, Y.; Kawakami, M.; Ikeda, K. A high frequency of apolipoprotein E4 isoprotein in Japanese patients with late-onset nonfamilial Alzheimer’s disease. Neurosci. Lett. 163:166 – 168; 1993. 16. Wenham, P. R.; Price, W. H.; Blandell, G. Apolipoprotein E genotyping by one-stage PCR. Lancet 337:1158 –1159; 1991.