Genetic screening of Lactobacillus sakei and Lactobacillus curvatus strains for their peptidolytic system and amino acid metabolism, and comparison of their volatilomes in a model system

Systematic and Applied Microbiology 34 (2011) 311–320

Contents lists available at ScienceDirect

Systematic and Applied Microbiology journal homepage: www.elsevier.de/syapm

Genetic screening of Lactobacillus sakei and Lactobacillus curvatus strains for their peptidolytic system and amino acid metabolism, and comparison of their volatilomes in a model system Simone Freiding, K. Amelie Gutsche, Matthias A. Ehrmann, Rudi F. Vogel ∗ Technische Universität München, Lehrstuhl für Technische Mikrobiologie, Weihenstephaner Steig 16, D-85350 Freising, Germany

a r t i c l e

i n f o

Article history: Received 5 November 2010 Keywords: Lactobacillus sakei Lactobacillus curvatus Biogenic amine Peptidolytic system Aminotransferase Volatile formation Fermented sausage Flavour

a b s t r a c t A total of 51 Lactobacillus sakei and 28 Lactobacillus curvatus strains from different origins were screened for their potential to produce biogenic amines (BAs), and for their diversity of peptidolytic systems and specific aminotransferases (AraT, BcaT) that initiate amino acid conversion to volatiles relevant for aroma formation in meat products. The profiles of volatiles formed (volatilomes) were analysed in the headspace of fermentations by solid phase microextraction followed by GC–MS analysis. Tyramine-forming potential was detected only within L. curvatus and was strain-dependent. Histamine decarboxylase (HDC) activity could only be detected in one L. sakei strain, previously described as histidine decarboxylase positive (HDC+ ). Peptide transporters and peptidases were nearly ubiquitous in L. sakei and only a few strains lacked single peptidases. In L. curvatus, differences were detected in the occurrence of peptidase genes detected with PCR primers derived from L. sakei. All strains lacked known aminotransferases specific for branched-chain amino acids (BCAAs) and aromatic amino acids (ACAAs). Although L. sakei is suggested as a genetically very heterogenous species, and relatedness between L. curvatus and L. sakei at the genomic level is rather low, they appeared to be nearly uniform in the genes forming the peptidolytic system. The volatilomes of L. sakei and L. curvatus strains were qualitatively nearly identical. However, slight differences in the formation of single volatile compounds and the interaction with staphylococci may impact upon sausage fermentation which occurs over a period of many weeks. Among the compounds expected to contribute to the aroma were dimethyldisulphide, 3-methyl-1-butanol, acetic acid, 1-butanol and butanoic acid. © 2011 Published by Elsevier GmbH.

Introduction Lactobacillus sakei (formerly Lactobacillus sake) [59] has been isolated from several raw fermented products of plant and animal origin but is mainly found in meat products, where it is often, together with Lactobacillus curvatus, the predominant Lactobacillus species [16,18]. Fermented sausages produced with starter cultures in western Europe often contain L. sakei and L. curvatus [17], as well as coagulase negative staphylococci. Lactobacilli contribute to the hygienic safety and quality of fermented products by their ability to decrease the pH by lactic acid formation, and the formation of bacteriocins, which are inhibitory towards intrinsic

Abbreviations: mMRS, modified MRS; BA, biogenic amines; BcaT, branchedchain amino acid aminotransferase; AraT, aromatic amino acid amino transferase; ArAAs, aromatic amino acids; BCAAs, branched-chain amino acids; TMW, Technische Mikrobiologie Weihenstephan. ∗ Corresponding author. Tel.: +49 08161 713663; fax: +49 08161 713327. E-mail address: [email protected] (R.F. Vogel). 0723-2020/$ – see front matter © 2011 Published by Elsevier GmbH. doi:10.1016/j.syapm.2010.12.006

lactobacilli of the meat microbiota, pathogenic or spoilage bacteria [15,40,58,64]. Peptidolytic activities of lactic acid bacteria (LAB) play a major role in growth, and also in the development of flavour and texture of fermented products. In dairy LAB, these activities are generally well documented and there are also some studies concerning LAB in sourdough [14,61], while insight into the peptidolytic system of L. sakei and L. curvatus is limited. However, global proteinase and aminopeptidase activities have been demonstrated for some L. sakei strains on pork sarcoplasmic and myofibrillar proteins [46], and four L. sakei peptidases, as well as one L. curvatus peptidase, have been purified and studied in detail [11,39,47,48]. Nevertheless, the involvement of peptidases in growth and physiology or their possible impact on meat technology is not established. The availability of the genome sequence of L. sakei 23 K and a study comparing the peptidolytic system of LAB provides in silico information about the peptidolytic potential of this strain. As a result, it has been shown that L. sakei 23 K possesses an oligopeptide ABC transport system (Opp), a di/tripeptide ion-linked transporter (DtpT), a putative oligopeptide transporter (Puopt) and a set of

312

S. Freiding et al. / Systematic and Applied Microbiology 34 (2011) 311–320

19 peptidases with different specificities [9,26]. Free amino acids transported into the cell or released intracellularly by peptidase activity can be converted to various volatile (flavour) compounds through amino acid catabolism or can be transformed into biogenic amines (BA) via specific decarboxylases. Histamine from histidine and, to a lesser extent, tyramine from tyrosine are the most toxic biogenic amines (BAs) affecting human health [33]. They may cause anything from headaches to intracranial haemorrhaging [51], in the case of tyramine, and cutaneous reactions to heart palpitations, in the case of histamine [43], according to the ingested concentrations and individual human sensitivity. Bover-Cid and Holzapfel [7] and Bover-Cid et al. [8] observed in fermented sausages that, among lactobacilli, L. curvatus appeared to be the main producer, but also some strains of L. bavaricus, L. brevis, L. paracasei, and L. sakei formed tyramine. L. sakei LTH 2076 has been described as an HDC+ strain. During the last decade, several PCR and DNA hybridization methods for the detection of BA-producing bacteria on foods have been described (reviewed in [24]). Branched-chain amino acids (valine, leucine, and isoleucine), aromatic amino acids (tyrosine, tryptophan, and phenylalanine), and sulphur-containing amino acids (methionine and cysteine) are the main amino acid sources for aroma compounds [2,50,66]. Specific aminotransferases AraT and BcaT are responsible for the conversion of these amino acids to their corresponding ␣keto acids. Several studies concerning L. lactis describe gene cloning, mutant construction, and characterization of genes encoding enzymes responsible for degradation of ArAAs and BCAAs [3,44,65,67]. Transamination appears to be the only enzymatic system catalyzing the first step of leucine degradation in lactobacilli, and catabolism of leucine by L. curvatus and L. sakei was very low in comparison with other relevant meat organisms [25]. This fits with the absence of araT and bcaT genes in L. sakei 23 K, although they are present in the genomes of several other LAB [27]. Characterization of a Lactobacillus BcaT was only carried out for L. paracasei [57]. The ␣-keto acids formed in the transaminase reaction can subsequently be converted into aldehydes, alcohols, and carboxylic acids, which contribute to the flavour. Volatiles, such as 3-methylbutanal and 3-methylbutanoic acid, that are likely to be derived from leucine and phenylacetaldehyde from phenylalanine catabolism are described as having a strong effect on the sensorial qualities of sausages [6,30,38,49,54]. To date, some screening studies have been carried out with L. sakei looking, for example, at acidification rates, growth under different conditions and/or utilization of different substrates [1,34]. Headspace-SPME-GC–MS methods have been established for the analysis of volatiles from fermented sausages and they are mainly used for the investigation of volatile formation by staphylococci [31,32,56,60]. Furthermore, Sollner and Schieberle [52] identified the main aroma compounds in Hungarian salami and successfully reconstituted the respective flavour. However, little is known about the production of volatile compounds by L. sakei and L. curvatus. The release of the genome sequence of L. sakei 23 K has allowed the potential of the peptidolytic system, as well as the potential for aroma formation and the formation of BAs in silico [9,26,27], to be investigated. However, the diversity within the L. sakei species is quite high. PFGE analysis demonstrated a 25% variation in genome size between different L. sakei strains from 1815 kb to 2320 kb [10]. DNA–DNA reassociation analysis has revealed very low levels of relatedness (as low as 72%) between L. sakei strains, indicating that this species exhibits important elements of genetic heterogeneity [12]. In spite of a high phenotypical relatedness, the L. sakei and L. curvatus species are clearly separated at the genomic level (40–50% identity) [21,22]. The aim of this study was to screen L. sakei and L. curvatus strains for their potential to produce undesirable biogenic amines (BAs), and characterise the diversity of their genes forming

the peptidolytic system that code for specific aminotransferases (AraT, BcaT). In addition, a comparison of the volatile profiles (volatilomes) of these organisms was performed by model fermentations and solid phase microextraction (SPME) in their headspace, followed by gas chromatographic–mass spectrometric (GC–MS) analysis. Materials and methods Bacteria, media, and growth The strains used in this study are listed in Table S1. Bacteria were routinely grown at 30 ◦ C in mMRS medium [55] containing 1.5% glucose. Model fermentations for subsequent volatilome analysis were performed in mMRS medium containing 0.3% glucose in order to mimick the conditions prevailing in fermenting sausage. Overnight cultures were washed twice with mMRS 0.3% glucose. GC vials (20 mL; VWR, Germany) were filled with 10 mL mMRS containing 0.3% glucose and they were inoculated with washed cells to a density of 106 cells mL−1 . Fermentation was performed for 5 days at 30 ◦ C. Samples were analysed in duplicate at days 0 and 5. Analysis of volatile compounds by SPME-GC–MS Analysis of volatile compounds in the headspaces of the GC vials was carried out with a 75 ␮m SPME carboxen/polydimethylsiloxane fibre type (CAR/PDMS) (Supelco, Bellefonte, PA, USA) coupled to a GC–MS. Before the analysis, the fibres were preconditioned in the injection port of the GC as indicated by the manufacturer. The trapped compounds were thermally desorbed at 250 ◦ C for 10 min and injected onto the columm of an Agilent 7890A gas chromatograph equipped with a ZB-Wax capillary column (60 m × 0.25 mm × 0.25 ␮m film thickness; Zebron, Phenomenex). Volatile compounds were separated under the following conditions: helium carrier gas (1.03 mL min−1 ), initial column temperature 30 ◦ C for 15 min, heated to 50 ◦ C at 30 ◦ C min−1 , followed by heating to 110 ◦ C at 4 ◦ C min−1 , heating to 150 ◦ C at 5 ◦ C min−1 , heating to 250 ◦ C at 10 ◦ C min−1 and holding for 10 min for a total run time of 64.67 min. The GC column was connected without splitting to the ion source of an Agilent 5975C mass spectrometer operating in the scan mode within a mass range of m/z 29–150. Ionisation was performed by electronic impact at 70 eV, and calibration was performed by autotuning. Compounds were identified by comparison of the mass spectral data with those of the Nist 2002 Mass Spectral Database library. DNA extraction Chromosomal DNA was isolated from overnight cultures by the E.Z.N.A. Bacterial DNA Kit (Omega Bio-tek, USA), following the manufacturer’s instructions. DNA sequencing and sequence analysis PCR fragments were purified with the Quiaquick® PCR Purification Kit and sent to GATC Biotech (Konstanz, Germany) for sequencing. Alignments were performed using the online tool ClustalW (EMBL-EBI, Heidelberg, Germany). Sequence comparisons against international databases were performed with BLAST [4]. Screening PCRs Screening experiments with negative or indistinct results were conducted at least twice in order to obtain clear results. In sev-

Table 1 Primers used in this study. Gene

Annotation

Primer

Primer sequence: 5 → 3

Tm [◦ C]

Size [bp]

GI #

Species considered

Reference

hdc

Histidine decarboxylase

HDC-for HDC-rev

TGGTATTGTTTCGTATGACCG GGCTTCATCATTGCATGTGC

55.9 57.3

594

GI:60418971 GI:74315243 GI:55794127

This study

HDC3

GATGGTATTGTTTCKTATGA

50.1

437

HDC4

CAAACACCAGCATCTTC

50.4

Tdc-for Tdc-rev TDC1 TDC2 ARA-deg-for3 ARA-deg-rev3+4

ATGTTATGGAATGGTAATAACG TACCATAGCCAGTAACGTTC ATGAGTAACACTAGTTTTAGTGC TTATTTACGATCTTCGTAAATTGC CCNGAYTTYAAYACNCCN NGCRAADATRTARAANGC

52.8 55.3 55.3 54.2 53.7 48.7

ARA-deg-for4 ARA-deg-rev3+4

GTHCANGTHGGNGCNACN NGCRAADATRTARAANGC

57.5 48.7

924

Bcat-deg-for A Bcat-deg-revA

TRCCAACWGGMRTDGCAAARA CAAGHYTTTGARGGBWTRAARG

56.6 56.5

301

Bcat-deg-forB Bcat-deg-revB

AARGCTTATCGSASAAAAGAYGG CCTTTAAHATAAGMRCCAACWGG

58.9 57.7

296

GI:159162017 GI:111610258 GI:6979305

TACCAAGTSGTTAARGATCCTTC TTTCTTASCAGYATCCGTATCATC TTGTCGCTTCTGTGACGTTC GACGAAGTTGGGAATCGAAA ACGATCGCYCGRCTGAYTCGGGC

58.0 58.4 57.3 55.3 68.7

474

tdc

bcaT

Aromatic amino acid aminotransferase

Branched chain amino acid aminotransferase

1013

GI:68051177

1866

GI:68051177

L. curvatus HSCC1737

This study

GI:104774152 GI:161507426 GI:111610256 GI:58337237 GI:90821006 GI:90961288 GI:28270875 GI:90960990 GI:28271793 GI:104773257

This study

GI:28378027 GI:78609959 GI:78609960

L. delbrueckii ATCC11842 L. helveticus DPC4571 L. helveticus CNRZ32 L. acidophilus NCFM L. salivarius UCC118 1 L. salivarius UCC118 2 L. plantarum WCFS1 1 L. salivarius UCC118 L. plantarum WCFS1 L. delbrueckii subsp. bulgaricus ATCC 11842 L. acidophilus NCFM L. helveticus CNRZ32 Lactococcus lactis subsp. cremoris L. plantarum WCFS1 L. sakei 23 K L. sakei 23 K

205

GI:28378029 GI:78609961

L. plantarum WCFS1 L. sakei 23 K

This study

660

[13]

This study

This study

This study

This study

oppA

Substrate-binding lipoprotein precursor

oppB

ABC transporter, membrane-spanning subunit

oppC

ABC transporter, membrane-spanning subunit

oppA-forward oppA-reverse oppB-sakei-F OppB-sakei-R oppC-deg-for

oppD

ABC transporter, ATP-binding subunit

oppC-deg-rev oppD-forward

CAATCCCGATAWAACTCAAGAAYGCTTCG GGCAACGGATTGTGATTG

64.6 53.7

364

GI:28378030 GI:78609962

L. plantarum WCFS1 L. sakei 23 K

This study

oppF

ABC transporter, ATP-binding subunit

oppD-reverse oppF-forward

GGTGGWTCCAACAAATCTGG AAGGTGAAACATTYGGGTTAGTTGG

57.3 60.5

394

GI:28378031 GI:81428321

L. plantarum WCFS1 L. sakei 23 K

This study

dtpt

Di-/tripeptide:H(+) symporter

oppF-reverse Dtpt-deg-for

CGGGCAATYCCRATCCGTTG TYGGGATYAACTTVGGDTC

61.4 54.5

836

This study

puopt

Putative oligopeptide transporter

Dtpt-deg-rev OPT-for

TARGAACCACATRCTCATCAT GGRATGATGCTTTGTGGWGGT

54.5 58.8

311

GI:78610847 GI:28377435 GI:191638802 GI:237658873

383

Aminopeptidase N

pepS

Aminopeptidase S

pepC2

Cysteine aminopeptidase

ATTGTCATMCCTGATACACAGG CTCAGCAACATGCCTGAAAA ACTAAATCGCCGAACCATTG AACGTCCAAGATGGCGATAC TCAACACGGGTTGTCTTGAA GCCACAGCTTACAAGCACAA TCCGGTAAACTTCGGTCAAC

57.5 55.3 55.3 57.3 55.3 57.3 57.3

434

GI:81427933 GI:81427839

479

GI:81429135

L. sakei 23 K

This study

402

GI:81429300

L. sakei 23 K

This study

This study

This study

313

OPT-rev pepN-F pepN-R PepS-F PepS-R PepC2-F pepC2-R

This study

L. sakei 23 K L. plantarum WCFS1 L. casei BL23 Cl. butyricum E4 str. BoNT E BL5262 Cl. perfringens B str. ATCC 3626 L. sakei 23 K L. sakei 23 K

GI:151558388

pepN

This study

S. Freiding et al. / Systematic and Applied Microbiology 34 (2011) 311–320

araT

Tyrosine decarboxylase

Lactobacillus sakei LTH 2076 L. buchneri DSM 5987 L. hilgardii IOEB 0006 Tetragenococcus muriaticus LMG 18498 L. sakei Oenococcus oeni L. buchneri L 30a Clostridium perfringens L. curvatus HSCC1737

314

Table 1 (Continued ) Annotation

Primer

Primer sequence: 5 → 3

Tm [◦ C]

Size [bp]

GI #

Species considered

Reference

pepO

Endopeptidase

L. sakei 23 K

This study

438

GI:22004641

L. sakei 23 K

This study

pepC1

Cysteine aminopeptidase

477

This study

Dipeptidase D-type (U34 family)

456

GI:81429298 GI:81429299 GI:78609430

L. sakei 23 K

pepD1

L. sakei 23 K

This study

pepD2

Dipeptidase D-type (U34 family

423

GI:81427806

L. sakei 23 K

This study

pepD3

Dipeptidase D-type (U34 family)

466

GI:78609576

L. sakei 23 K

This study

pepD4

Dipeptidase D-type (U34 family)

454

GI:78609841

L. sakei 23 K

This study

pepD5

Dipeptidase D-type (U34 family)

443

GI:7861014

L. sakei 23 K

This study

pepF1

Oligoendopeptidase

439

GI:78609541

L. sakei 23 K

This study

pepF2

Oligoendopeptidase

450

GI:81429492

L. sakei 23 K

This study

pepQ

Xaa-Pro dipeptidase (Proline dipeptidase)

448

GI:78609669

L. sakei 23 K

This study

pepV1

Xaa-His dipeptidase V

450

GI:81429301

L. sakei 23 K

This study

pepV2

Xaa-His dipeptidase V

460

GI:78609679

L. sakei 23 K

This study

pepX

X-Prolyl dipeptidyl-aminopeptidase

456

GI:78609900

L. sakei 23 K

This study

pepT

Tripeptide aminopeptidase

461

GI:78610140

L. sakei 23 K

This study

pepM

Methionyl aminopeptidase

53.2 57.3 57.3 57.3 59.4 68.3 53.2 57.1 55.3 53.2 57.3 57.3 55.3 55.3 59.4 57.3 57.3 57.3 55.3 55.3 57.3 57.3 57.3 55.3 57.3 57.3 55.3 57.3 53.2 57.3 57.3 57.3

GI:81427668

Prolyl aminopeptidase

AAAGAAGCGTTGGCTTTTGA TAACGGCGGCCATAGTAATC GTGACCAAACGTGAATGTGG ATACGGCCAACACTTGAAGG TACTCAAGTCTCTTCAGTATTG TTGATGATTGAATATATAACTTGG TTCAATCGACGGTTCAACAA GTTTCCAGCCACCAAACACT AAACCAAGTGGCGATTCAAC ACATCGTTGCGCAATTGTAA CAGCCGAAGGTAATGGTGTT TCTTCCGTCCCATTACCAAG ATTCCGCGTTATTCAACCAG ATTAGGCGCAACAACAAAGG AACCGCCTGTACCAGTGTTC CGGTTGTGCCATATTCACTG ATCAAGCTCAGGTCGATGCT ATCTCAGTCGCAAGGGTTGT AGCAAATGGGCAGTTTTGTC AACGATCCCAAGTTTGTTGC CTAACGCAACATTCCCTGGT CCGGGTTTAACAGCATCTTG CAAGTCGGTGATTGTGTTGG CCCGTCAATCGCTGTAATTT TCGGGACTGACGAAGAAAGT CCGATGTAGTTGCCACCTTT CCTAACTTGGCGGATTTGAA CAAGCCGTTTTCACGGTAGT ATCAAACATGGCGACATCAA GTTGCTTTAACGCGACCTTC GGTGTTCATCGTGGTTTGC GTTGGTTGGATACCGTGACC

437

pepR

pepO-F pepO-R pepR-F pepR-R PepC1-F PepC1-R pepD1-F pepD1-R pepD2-F pepD2-R pepD2-F pepD3-R pepD4-F pepD4-R pepD5-F pepD5-R pepF1-F pepF1-R pepF2-F pepF2-R pepQ-F pepQ-R pepV-1-F pepV-1-R pepV-F pepV-R pepX-F pepX-R pepT-F pepT-R pepM-bF pepM-bR

461

GI:78610771

L. sakei 23 K

This study

S. Freiding et al. / Systematic and Applied Microbiology 34 (2011) 311–320

Gene

S. Freiding et al. / Systematic and Applied Microbiology 34 (2011) 311–320

eral cases, additional primer sets were designed to verify the absence/presence of genes. Very weak bands were assessed as negative. Paq5000 DNA Polymerase (Stratagene, La Jolla, USA) was used according to the manufacturer’s recommendations for screening PCR reactions. The amplification program depended on the melting temperatures of the primers, and the length of the amplified fragment. The general program used was: 95 ◦ C for 2 min, 32 cycles of 95 ◦ C for 20 s (primer melting temperature − x; see Tm in Table 1) ◦ C for 20 s, 72 ◦ C (1000 bp = 30 s) with a final extension at 72 ◦ C for 5 min. All screening PCRs were performed either in a Primus 96 cycler (MWG-Biotech, Ebersberg, Germany) or in an Eppendorf Gradient Cycler (Eppendorf, Hamburg, Germany). Ten microliters of PCR products was examined using 1% agarose gels (0.5 × TBE). Gels were stained with ethidium bromide and the banding profiles were visualized under UV light and digitalized by the gel documentation system from INTAS Science Imaging Instruments GmbH (Göttingen, Germany). The primers used for PCR screening experiments, their characteristics and the organisms from which genome sequences were obtained are listed in Table 1.

315

not give an amplificate with TMW 1.23, TMW 1.114, TMW 1.163, TMW 1.454, TMW 1.579 and TMW 1.578. Altogether, there was no strain of L. sakei that lacked more than one of the peptidases. PepC1 of L. sakei 23 K contained a point mutation at base position 1209 (Fig. S1), which led to the stop codon TGA. Sequencing data of four further L. sakei strains indicated that this frame shift mutation was not widely distributed among L. sakei strains, since it was only found in this strain. Some of the L. sakei specific primers for the peptidase screening were also suitable for L. curvatus. PepC1, pepD1, pepD2, pepD3, pepV1, pepV2, pepM and pepT could be detected with the respective primers in all L. curvatus strains tested. Only L. curvatus TMW 1.1408 lacked pepC2. PepN, pepR and pepS showed a strain dependent appearance in L. curvatus. PepR could be detected in 45%, pepS in 52% and pepN in 76% of the L. curvatus strains. None of the L. curvatus strains showed an amplificate for pepX, pepQ, pepD4, and pepO. Primers for pepD5, pepF1, pepF2 and pepM only gave positive PCR results for single strains of L. curvatus. PCR and physiological screening for decarboxylase activity

Physiological screening for biogenic amine production L. sakei and L. curvatus were screened for their decarboxylase activity against the amino acids histidine and tyrosine using a slight modification of the procedure described by Bover-Cid and Holzapfel [7]. Liquid medium was used instead of agar plates, and 1 mL of the respective decarboxylase medium was inoculated with a single colony of the strains to be checked and then incubated at 30 ◦ C for 36–48 h. A positive result was indicated by a colour change of the medium caused by the response of the pH indicator bromcresol purple to a pH shift due to the formation of the more alkaline BA from the precursor amino acids initially added to the medium. Results PCR screening for peptide transport and peptidases The results of PCR screenings and the physiological screening for decarboxylase activity are summarized in Table 2. The genome of L. sakei 23 K contains five opp genes (oppABCDF) each coding for a subunit of the oligopeptide ABC transport system Opp, one gene for a di/tripeptide ion-linked transporter (dtpt) and one gene for a putative oligopeptide transporter (puopt). All L. sakei strains tested showed amplificates for each of the seven transporter genes. Also, most of the L. curvatus strains gave PCR products for the peptide transport genes. The primers specific for oppB did not give positive results for any of the L. curvatus strains, whereas amplificates of oppACDF fragments could be obtained for all L. curvatus strains tested. PCR amplification with oppA-forward and oppC-deg-rev showed amplificates with the expected size of 2761 bp for all L. curvatus strains. Screening PCRs for dtpt and puopt were positive for all L. sakei and L. curvatus strains. A total of 19 different peptidases are annotated for L. sakei 23 K. There are four aminopeptidases pepN, pepS, pepC2 and pepM, four endopeptidases pepC1, pepO, pepF1 and pepF2, seven dipeptidases pepD1-pepD5, pepV1 and pepV2, three proline peptidases pepR, pepX and pepQ, and a tripeptidase pepT. The distribution of these peptidase genes within the L. sakei species was very uniform. PepN, pepS, pepC2, pepO, pepR, pepD1, pepD2, pepD3, pepD5, pepF1 + 2, pepQ, pepV1 + 2, pepX, pepM and pepT could be detected in all L. sakei strains by PCR amplification. There were only some differences regarding the peptidases pepC1, pepD3 and pepD4. PepC1 could not be found in the L. sakei strains TMW 1.13, TWM 1.46, TMW 1.161, TMW 1.587, TMW 1.1189, TMW 1.1239, TMW 1.1240 and TMW 1.1388, pepD3 was not detectable in TMW 1.1396, and pepD4 did

Neither the PCR screening procedure nor the physiological tests could detect a tyrosine (TDC+ ) or a histidine decarboxylase (HDC+ ) positive L. sakei strain, except for one exception. Strain L. sakei LTH 2076 showed amplification of the 594 bp and the 437 bp fragments with primer pairs HDCfor/rev and HDC3/4, respectively, which corresponded to the hdc gene and was also positive in the physiological histamine screening. None of the L. curvatus strains were positive in the HDC screenings (PCR and physiological), whereas the screening for a tyrosine decarboxylase showed strain dependence within the L. curvatus species. A total of 20 of the 29 strains tested gave a PCR product for the 1013 bp tdc gene fragment. Contrary to this result, only 19 of the PCR positive strains induced a colour change in the tyramine test medium. To check these ambiguous results, the complete tdc gene of L. curvatus TMW 1.51 was amplified using the primer set TDC1/TDC2 and it was sequenced. Sequencing showed a deletion of 5 base pairs that led to a frame shift in the tdc gene sequence at positions 188–192 of L. curvatus strain TMW 1.51 (Fig. S2) and subsequently to a non-functional decarboxylase. PCR screening for araT and bcaT Aminotransferases specific for the transamination of branchedchain amino acids and aromatic amino acids could not be found in the genome of L. sakei 23 K. Thus, degenerated primers were designed using aminotransferase sequences from several lactobacilli. However, none of the primer combinations amplified either a bcat or an araT fragment of the right size. Only positive controls showed the expected PCR product. Analysis of volatile compounds of model fermentations In the model fermentations with modified mMRS medium nearly 30 volatile compounds were identified. These compounds were carbon dioxide, hexane, carbon disulphide, octane, butanal, 2-butanone, 2-methylbutanal, 3-methylbutanal, 2-ethylfuran, 2-pentanone, thiophene, toluene, dimethyldisulphide, 2-methylthiophene, 2-methyl-2butenal, 3-methyl-1-butanolacetate, 2n-butylfuran, 1-butanol, 2-heptanone, limonene, 2-methyl-1-butanol, 3-methyl-1butanol, 2-pentylfuran, 3-hydroxy-2-butanone, acetic acid, benzaldehyde, 2-methylpropanoic acid and butanoic acid. The compounds dimethyldisulphide, 1-butanol, 2-methylbutanol, 3-methylbutanol, 3-hydroxy-2-butanone, acetic acid, 2methylpropanoic acid and butanoic acid were produced by

316

S. Freiding et al. / Systematic and Applied Microbiology 34 (2011) 311–320

L. sakei

TMW 1.2

L. sakei

TMW 1.3

L. sakei

TMW 1.4

L. sakei

TMW 1.13

L. sakei

TMW 1.22

L. sakei

TMW 1.23

L. sakei

TMW 1.30

L. sakei

TMW 1.46

L. sakei

TMW 1.114

L. sakei

TMW 1.147

L. sakei

TMW 1.148

L. sakei

TMW 1.149

L. sakei

TMW 1.150

L. sakei

TMW 1.151

L. sakei

TMW 1.152

L. sakei

TMW 1.153

L. sakei

TMW 1.154

L. sakei

TMW 1.155

L. sakei

TMW 1.161

L. sakei

TMW 1.162

L. sakei

TMW 1.163

L. sakei

TMW 1.165

L. sakei

TMW 1.402

L. sakei

TMW 1.411

L. sakei

TMW 1.412

L. sakei

TMW 1.417

L. sakei

TMW 1.454

L. sakei

TMW 1.578

L. sakei

TMW 1.579

L. sakei

TMW 1.587

L. sakei

TMW 1.588

L. sakei

TMW 1.589

L. sakei

TMW 1.1189

L. sakei

TMW 1.1239

L. sakei

TMW 1.1240

L. sakei

TMW 1.1290

L. sakei

TMW 1.1322

L. sakei

TMW 1.1366

L. sakei

TMW 1.1383

L. sakei

TMW 1.1285

L. sakei

TMW 1.1386

L. sakei

TMW 1.1388

L. sakei

TMW 1.1392

L. sakei

TMW 1.1393

L. sakei

TMW 1.1395

L. sakei

TMW 1.1396

L. sakei

TMW 1.1397

L. sakei

TMW 1.1398

L. sakei

TMW 1.1399

L. sakei

TMW 1.1474

L. sakei

TMW 1.1407

L. curvatus TMW 1.7

x

L. curvatus TMW 1.17

x

L. curvatus TMW 1.27

x

L. curvatus TMW 1.48

x

L. curvatus TMW 1.49

x

L. curvatus TMW 1.50 L. curvatus TMW 1.51

x *

x

L. curvatus TMW 1.167

x

L. curvatus TMW 1.401

x

L. curvatus TMW 1.407

x

L. curvatus TMW 1.408

x

L. curvatus TMW 1.421

x

L. curvatus TMW 1.439

x

L. curvatus TMW 1.440

x

L. curvatus TMW 1.593

x

L. curvatus TMW 1.594

x

L. curvatus TMW 1.595

x

L. curvatus TMW 1.596

x

L. curvatus TMW 1.624

x

L. curvatus TMW 1.1291

x

L. curvatus TMW 1.1365

x

L. curvatus TMW 1.1381

x

L. curvatus TMW 1.1382

x

L. curvatus TMW 1.1384

x

L. curvatus TMW 1.1389

x

L. curvatus TMW 1.1390

x

L. curvatus TMW 1.1391

x

L. curvatus TMW 1.1408

x

araT

bcaT

pepM

pepT

pepV2

pepX

pepQ

pepV1

pepF1

pepF2

pepD5

pepD4

pepD2

pepD3

pepR

pepD1

pepC2

pepO

pepC1

pepS

puopt

pepN

oppF

dtpt

oppC

oppD

oppB

HDC

oppA

TDC

hdc

tdc

Table 2 Results of screening PCRs for genes coding for peptide transporters (opp, dtpt, puopt), peptidases (pep), aminotransferases (araT, bcaT), decarboxylases (tdc, hdc) and results for decarboxylase activity (TDC, HDC); filled boxes indicate positive results, empty boxes negative results; (x = indirect positive result by primer pair oppA-forward/oppC-degrev; *frame shift mutation in the tdc sequence).

S. Freiding et al. / Systematic and Applied Microbiology 34 (2011) 311–320

317

Fig. 1. Volatilomes of L. sakei and L. curvatus in the headspace after 5 days fermentation. L. sakei 23 K (A); L. sakei TMW 1.1393 (B); L. curvatus DSM 20019T (C); L. curvatus TMW 1.1381 (D); 1 = dimethyldisulphide, 2 = 1-butanol, 3 = 2methyl-1-butanol/3-methyl-1-butanol, 4 = 3-hydroxy-2-butanone, 5 = acetic acid, 6 = 2-methylpropanoic acid, 7 = butanoic acid.

the L. sakei and L. curvatus strains within 5 days (Fig. 1). All other volatile compounds were already found in the medium by day 0. The amount of the main metabolite produced, lactic acid, could not be analysed with the method used since it detected only volatile compounds. All screened L. sakei and L. curvatus strains showed a similar volatilome but the relative peak heights varied slightly. Discussion Strain dependence of decarboxylase activity The screening for decarboxylase genes and for the ability of BA formation showed that neither L. curvatus nor L. sakei possessed a distinct potential for histamine production. Only strain L. sakei LTH 2076 was positive in the PCR screening and in the screening medium with histamine as a precursor. This strain, known as HDC+ , was therefore used as a positive control for the experiments. Within the strains used in this study, tyramine production was only associated with L. curvatus strains. Nearly two thirds of the L. curvatus strains tested showed TDC activity and a PCR product for a tdc fragment, whereas none of the L. sakei strains were able to induce a pH shift in the screening medium with tyrosine as a precursor and produce an amplificate for tdc. This result agrees with other studies, which also describe L. curvatus as a main producer of tyramine within the LAB found in dry fermented sausages [5,8]. Therefore, our findings corroborate these studies and suggest that Lactobacillus sakei would, on the basis of competitiveness and hygienic aspects, such as biogenic amine production, be the species of choice for further use as a starter culture in fermented sausage production. However, according to the results, some strains of L. curvatus, which proved negative for tyramine production potential, may form safe alternatives. The peptidolytic system of L. sakei and L. curvatus is genetically homogenous Within the genome of sequenced LAB, cell wall-bound proteinases (PrtP) have only been found on the chromosome of a

few dairy-relevant LAB [26]. Since there are low amounts of free amino acids and peptides, and absence of peptidolytic activity in milk, dairy LAB are dependent on a peptidolytic system that allows degradation of milk proteins (caseins) [20,36]. In this study, weak degradation halos of casein were detected in the agar plate assay (mMRS with 10% skim milk) for all strains tested, but there was no significant strain dependence for proteolytic activity (data not shown). Proteolytic activities against meat proteins have also been shown to be weak in L. curvatus and L. sakei [46]. In general, bacterial enzymes have been reported to have a minor participation in protein breakdown in meats, and the initial degradation of myosin and actin into peptides is due to cathepsin D, while the later decomposition of peptides into free amino acids by peptidases is bacterial [37,62]. Based on our results, we support this suggestion and specify that in dry fermented sausages, the microbial part of proteolysis evolves from microbiota other than these lactobacilli (e.g. staphylococci used in combinations with these LAB). Peptide and amino acid transport systems have been studied extensively in lactococci. Peptide uptake occurs via one or two oligopeptide transport systems (Opp, Opt) and one or two di/tripeptide transporters (DtpT, DtpP) (reviewed by Kunji et al. [23]). Much less is known as yet about peptide and amino acid transporters in lactobacilli. Oligopeptide transport systems of sequenced LAB were compiled by Liu et al. [26]. The screening for the peptide transport systems dtpt, oppABCDF and puopt in L. sakei did not show any strain dependence of these genes. In the same way, all L. curvatus strains showed amplificates for dtpt and puopt. However, it was not possible to obtain any amplificate for oppB with any of the L. curvatus strains. Probably this was due to non-matching primers, as these were primarily designed for L. sakei screening. This is further supported by the fact that PCR reactions with primers oppA-forward and oppC-deg-rev showed amplificates with the expected size of 2761 bp for all L. curvatus strains. Moreover, all L. curvatus strains gave positive results for all other opp subunits oppACDF and it is most unlikely that L. curvatus lost only one of these.

318

S. Freiding et al. / Systematic and Applied Microbiology 34 (2011) 311–320

Following proteolysis in the meat matrix, degradation of peptides to free amino acids is mainly performed by bacterial peptidases. The number of peptidases within the genome sequenced LAB varies between 27 peptidases in L. helveticus and 12 peptidases in Streptococcus thermophilus. L. sakei with its 19 peptidases represents approximately the average. Many of the peptidases seem to be essential for bacterial growth or survival as they are encoded in all LAB genomes (PepC2, PepN, PepM, PepX, PepQ) [26]. Results of our study suggested that there was no strain dependence within L. sakei with respect to peptidases, and there were only slight differences in the distributions of pepC1 and pepD4 within the strains. Since PepD1 and PepD4 belong to the same PepD subfamily [26], it could be suggested that the lack of one of these peptidases should not be of great relevance for the physiology of the respective L. sakei strain. However, to date, no data about the physiological role of single peptidases are available for L. sakei. With regard to the distribution of peptidases among strains, the situation in L. curvatus follows that found in L. sakei. PepV, pepV2, pepT, pepM and pepD1-D4 could be detected for all L. curvatus strains tested. It can be assumed that pepN, pepS, pepC2 and pepR are strain dependent, and pepO, pepD4, pepD5, pepF1, pepF2 and pepQ could be amplified either not at all or only for single strains of L. curvatus. One obvious explanation would be the absence of these peptidases in L. curvatus. As only pepR has been purified and characterised for L. curvatus [29], very little is known about the physiological requirement of this species, so this option cannot be discussed any further here. On the other hand, primers specifically designed for L. sakei may not have matched the respective L. curvatus genes. The presence of ArAAs and BCAAs influences the volatilomes of LAB Catabolism of aromatic amino acids (ArAAs), branched-chain amino acids (BCAAs), and methionine is believed to play a major role in the formation of aroma compounds in fermented meat, as well as in fermented dairy products [38,42,66]. In L. lactis, the only enzymes that are responsible for the deamination of ArAAs and BCAAs seem to be aminotransferases [3,44,65,67]. The ilvE gene is responsible for approximately 90% of the total isoleucine and valine aminotransferase activity and also for 60% of the leucine activity in L. lactis. No gene coding for AraT or BcaT could be found in the genome of L. sakei 23 K. An approach to amplify aminotransferase fragments with degenerated primers was also unsuccessful for any of the L. sakei strains used in this study. For Staphylococcus carnosus, which is also widely used for manufacturing fermented meat products, a BcaT has been characterized [28]. Furthermore, only very low catabolism of leucine was shown for L. sakei and L. curvatus, in contrast to other meat relevant organisms such as staphylococci [25]. Therefore, it can be supposed that in meat fermentations volatile compounds derived from amino acids, some of which impact on the aroma, are preferentially produced by staphylococci rather than by lactobacilli [6]. Nevertheless, chromatogram profiles (Fig. 1), to a certain degree, showed production of 3-methyl-1-butanol probably resulting from leucine metabolism, as well as 2-methyl-1-butanol from isoleucine and 2-methylpropanoic acid from valine metabolism [38]. As sausage fermentation and ripening can last weeks, or even months, any aroma impact driven by lactobacilli cannot be excluded. Similar situations may prevail in cheese ripening where, for example, the amount of 3-methyl-1-butanol and 2-methylpropanoic acid is higher if the fermentation is carried out with lactobacilli [19]. Taken as single compounds, 3-methyl-1-butanol provides a fruity and alcoholic flavour, and 2-methylpropanoic acid has a cheesy and fatty flavour [38,41]. They belong to the main volatile compounds of dry fermented sausages [31,35,38,41]. The transamination of

leucine, for example, could possibly occur via side reactions of other enzymes. As an example, for side activities of decarboxylases, it was demonstrated that the aspartate-4-decarboxylase of Pseudomonas sp. ATCC19121 exhibited aminotransferase activity with some amino acids [63]. Such an activity could also be assumed for the l-aspartate-␤-decarboxylase (GI:78609562) of L. sakei. The formation of acetic acid in the model fermentations results from side reactions of the homofermentative carbohydrate metabolism (e.g. alternative degradation of pyruvate by Pdc or Pfl) found in lactic acid bacteria as well as staphylococci. It is a typical aroma compound of dry fermented sausages [38]. The production of dimethyldisulphide shows that the L. sakei and L. curvatus strains are able to metabolize the amino acid methionine, which sometimes leads to them being spoilage organisms in vacuum packed meats. Dimethyldisulphide imparts a cauliflower flavour and is also found in raw sausages [35,38,53]. 1-Butanol has a sweet and fusel oil-like flavour and is a product of alcoholic and heterolactic fermentation [45]. It is produced in olives fermented with lactobacilli [45] and is another volatile compound found in dry sausages [53]. Butanoic acid has a rancid and cheesy flavour and likely originates from lipid metabolism [38,50], and it is also a volatile compound of raw sausages [35,38]. 3-hydroxy-2-butanone or acetoin has a buttery flavour and is a part of pyruvate catabolism [38]. It is produced in olives fermented with lactobacilli [45] and is found in some sausages [53]. Despite the description of such “single compound flavour impressions” the contribution of a single compound to the flavour of fermented sausages remains to be established in quantitative molecular aroma analyses. Taken together, the results show that L. sakei appears to be genetically homogenous with regard to its peptidolytic system (proteinase, peptide transport, and peptide degradation) despite the fact that it is generally considered as a genetically very heterogenous species. Obviously, typical ecological niches harbouring L. sakei do not differ significantly with respect to the requirements needed for the respective lifestyle of these strains. To a certain extent, this could also be assumed for L. curvatus species. This general conclusion derived from the analysis of the genetic setting is corroborated by the similarity of the volatilomes from L. sakei and L. curvatus, which showed only slight differences. Both the comparison among the L. sakei and L. curvatus strains and between these species resulted in at least qualitative uniformity. With regard to their use as aroma forming starter cultures, there is apparently no major difference as to which strain of L. sakei or L. curvatus is used. As meats cannot be pasteurized prior to fermentation, the usefulness as a starter must be preferably based on the competitiveness and acidification rate of the strain. McLeod et al. [34] and Ammor et al. [1] have shown that there are some differences between L. sakei strains in their growth and acidification rates. However, slight differences in the formation of single volatile compounds may impact upon sausage fermentation that occurs over a period of many weeks (much more than, for example, in 4–5 h yoghurt or Feta cheese production), and interaction with staphylococci may affect the overall volatilome significantly. Acknowledgments This research project was supported by the German Ministry of Economics and Technology and the FEI (Forschungskreis der Ernährungsindustrie e.V., Bonn) in project AiF 15458N. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.syapm.2010.12.006.

S. Freiding et al. / Systematic and Applied Microbiology 34 (2011) 311–320

References [1] Ammor, S., Dufour, E., Zagorec, M., Chaillou, S., Chevallier, I. (2005) Characterization and selection of Lactobacillus sakei strains isolated from traditional dry sausage for their potential use as starter cultures. Food Microbiol. 22, 529–538. [2] Ardo, Y. (2006) Flavour formation by amino acid catabolism. Biotechnol. Adv. 24, 238–242. [3] Atiles, M.W., Dudley, E.G., Steele, J.L. (2000) Gene cloning, sequencing, and inactivation of the branched-chain aminotransferase of Lactococcus lactis LM0230. Appl. Environ. Microbiol. 66, 2325–2329. [4] Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. [5] Aymerich, T., Martin, B., Garriga, M., Vidal-Carou, M.C., Bover-Cid, S., Hugas, M. (2006) Safety properties and molecular strain typing of lactic acid bacteria from slightly fermented sausages. J. Appl. Microbiol. 100, 40–49. [6] Berdagué, J.L., Monteil, P., Montel, M.C., Talon, R. (1993) Effects of starter cultures on the formation of flavour compounds in dry sausage. Meat Sci. 35, 275–287. [7] Bover-Cid, S., Holzapfel, W.H. (1999) Improved screening procedure for biogenic amine production by lactic acid bacteria. Int. J. Food Microbiol. 53, 33–41. [8] Bover-Cid, S., Hugas, M., Izquierdo-Pulido, M., Vidal-Carou, M.C. (2001) Amino acid-decarboxylase activity of bacteria isolated from fermented pork sausages. Int. J. Food Microbiol. 66, 185–189. [9] Chaillou, S., Champomier-Verges, M.-C., Cornet, M., Crutz-Le Coq, A.-M., Dudez, A.-M., Martin, V., Beaufils, S., Darbon-Rongere, E., Bossy, R., Loux, V., Zagorec, M. (2005) The complete genome sequence of the meat-borne lactic acid bacterium Lactobacillus sakei 23 K. Nat. Biotech. 23, 1527–1533. [10] Chaillou, S., Daty, M., Baraige, F., Dudez, A.-M., Anglade, P., Jones, R., Alpert, C.-A., Champomier-Verges, M.-C., Zagorec, M. (2009) Intraspecies genomic diversity and natural population structure of the meat-borne lactic acid bacterium Lactobacillus sakei. Appl. Environ. Microbiol. 75, 970–980. [11] Champomier-Verges, M.-C., Marceau, A., Mera, T., Zagorec, M. (2002) The pepR gene of Lactobacillus sakei is positively regulated by anaerobiosis at the transcriptional level. Appl. Environ. Microbiol. 68, 3873–3877. [12] Champomier, M.C., Montel, M.C., Grimont, F., Grimont, P.A.D. (1987) Genomic identification of meat lactobacilli as Lactobacillus sake. Ann. Inst. Pasteur Microbiol. 138, 751–758. [13] Coton, E., Coton, M. (2005) Multiplex PCR for colony direct detection of Grampositive histamine- and tyramine-producing bacteria. J. Microbiol. Meth. 63, 296–304. [14] Gänzle, M.G., Vermeulen, N., Vogel, R.F. (2007) Carbohydrate, peptide and lipid metabolism of lactic acid bacteria in sourdough. Food Microbiol. 24, 128–138. [15] Ghalfi, H., Benkerroum, N., Ongena, M., Bensaid, M., Thonart, P. (2010) Production of three anti-listerial peptides by Lactobacillus curvatus in MRS broth. Food Res. Int. 43, 33–39. [16] Hammes, W.P., Bantleon, A., Min, S. (1990) Lactic acid bacteria in meat fermentation. FEMS Microbiol. Lett. 87, 165–174. [17] Hammes, W.P., Hertel, C. (1996) Selection and improvement of lactic acid bacteria used in meat and sausage fermentation. Lait 76, 159–168. [18] Hugas, M., Garriga, M., Aymerich, T., Monfort, J.M. (1993) Biochemical characterization of lactobacilli from dry fermented sausages. Int. J. Food Microbiol. 18, 107–113. [19] Irigoyen, A., Ortigosa, M., Juansaras, I., Oneca, M., Torre, P. (2007) Influence of an adjunct culture of Lactobacillus on the free amino acids and volatile compounds in a Roncal-type ewe’s-milk cheese. Food Chem. 100, 71–80. [20] Juillard, V., Le Bars, D., Kunji, E.R., Konings, W.N., Gripon, J.C., Richard, J. (1995) Oligopeptides are the main source of nitrogen for Lactococcus lactis during growth in milk. Appl. Environ. Microbiol. 61, 3024–3030. [21] Kagermeier-Callaway, A.S., Lauer, E. (1995) Lactobacillus sake Katagiri, Kitahara, and Fukami 1934. Is the senior synonym for Lactobacillus bavaricus Stetter and Stetter 1980. Int. J. Syst. Bacteriol. 45, 398–399. [22] Kandler, O., Weiss, N. (1986) Genus Lactobacillus Beijerinck 1901, The Williams & Wilkins Co., Baltimore, pp. 1209–1234. [23] Kunji, E.R.S., Mierau, I., Hagting, A., Poolman, B., Konings, W.N. (1996) The proteotytic systems of lactic acid bacteria. Antonie Van Leeuw. 70, 187–221. [24] Landete, J.M., de Las Rivas, B., Marcobal, A., Munoz, R. (2007) Molecular methods for the detection of biogenic amine-producing bacteria on foods. Int. J. Food Microbiol. 117, 258–269. [25] Larrouture, C., Ardaillon, V., Pépin, M., Montel, M.C. (2000) Ability of meat starter cultures to catabolize leucine and evaluation of the degradation products by using an HPLC method. Food Microbiol. 17, 563–570. [26] Liu, M., Bayjanov, J.R., Renckens, B., Nauta, A., Siezen, R.J. (2010) The proteolytic system of lactic acid bacteria revisited: a genomic comparison. BMC Genomics 11, 36. [27] Liu, M., Nauta, A., Francke, C., Siezen, R.J. (2008) Comparative genomics of enzymes in flavor-forming pathways from amino acids in lactic acid bacteria. Appl. Environ. Microbiol. 74, 4590–4600. [28] Madsen, S.M., Beck, H.C., Ravn, P., Vrang, A., Hansen, A.M., Israelsen, H. (2002) Cloning and inactivation of a branched-chain-amino-acid aminotransferase gene from Staphylococcus carnosus and characterization of the enzyme. Appl. Environ. Microbiol. 68, 4007–4014. [29] Magboul, A.A.A., McSweeney, P.L.H. (1999) Purification and characterization of an aminopeptidase from Lactobacillus curvatus DPC2024. Int. Dairy J. 9, 107–116.

319

[30] Marco, A., Navarro, J.L., Flores, M. (2007) Quantitation of selected odor-active constituents in dry fermented sausages prepared with different curing salts. J. Agric. Food Chem. 55, 3058–3065. [31] Marco, A., Navarro, J.L., Flores, M. (2004) Volatile compounds of dry-fermented sausages as affected by solid-phase microextraction (SPME). Food Chem. 84, 633–641. [32] Masson, F., Hinrichsen, L., Talon, R., Montel, M.C. (1999) Factors influencing leucine catabolism by a strain of Staphylococcus carnosus. Int. J. Food Microbiol. 49, 173–178. [33] Masson, F., Talon, R., Montel, M.C. (1996) Histamine and tyramine production by bacteria from meat products. Int. J. Food Microbiol. 32, 199–207. [34] McLeod, A., Nyquist, O.L., Snipen, L., Naterstad, K., Axelsson, L. (2008) Diversity of Lactobacillus sakei strains investigated by phenotypic and genotypic methods. Syst. Appl. Microbiol. 31, 393–403. [35] Meynier, A., Novelli, E., Chizzolini, R., Zanardi, E., Gandemer, G. (1999) Volatile compounds of commercial Milano salami. Meat Sci. 51, 175–183. [36] Mills, O.E., Thomas, T.D. (1981) Nitrogen sources for growth of lactic streptococci in milk. N. Z. J. Dairy Sci. Technol. 16, 43–55. [37] Molly, K., Demeyer, D., Johansson, G., Raemaekers, M., Ghistelinck, M., Geenen, I. (1997) The importance of meat enzymes in ripening and flavour generation in dry fermented sausages. First results of a European project. Food Chem. 59, 539–545. [38] Montel, M.C., Masson, F., Talon, R. (1998) Bacterial role in flavour development. Meat Sci. 49, S111–S123. [39] Montel, M.C., Seronie, M.P., Talon, R., Hebraud, M. (1995) Purification and characterization of a dipeptidase from Lactobacillus sake. Appl. Environ. Microbiol. 61, 837–839. [40] Nettles, C.G., Barefoot, S.G. (1993) Biochemical and genetic characteristics of bacteriocins of food-associated lactic acid bacteria. J. Food Protect. 56, 339–356. [41] Olivares, A., Navarro, J.L., Flores, M. (2009) Establishment of the contribution of volatile compounds to the aroma of fermented sausages at different stages of processing and storage. Food Chem. 115, 1464–1472. [42] Ordonez, J.A., Hierro, E.M., Bruna, J.M., de la Hoz, L. (1999) Changes in the components of dry-fermented sausages during ripening. Crit. Rev. Food Sci. Nutr. 39, 329–367. [43] Pfannhauser, W., Pechanek, U. (1984) Biogene amine in lebensmitteln: Bildung, vorkommen, Analytik und toxikologische Bewertung. Z. Ges. Hyg. 30, 66–76. [44] Rijnen, L., Bonneau, S., Yvon, M. (1999) Genetic characterization of the major lactococcal aromatic aminotransferase and its involvement in conversion of amino acids to aroma compounds. Appl. Environ. Microbiol. 65, 4873–4880. [45] Sabatini, N., Mucciarella, M.R., Marsilio, V. (2008) Volatile compounds in uninoculated and inoculated table olives with Lactobacillus plantarum (Olea europaea L., cv. Moresca and Kalamata). LWT – Food Sci. Technol. 41, 2017–2022. [46] Sanz, Y., Fadda, S., Vignolo, G., Aristoy, M.C., Oliver, G., Toldrá, F. (1999) Hydrolysis of muscle myofibrillar proteins by Lactobacillus curvatus and Lactobacillus sake. Int. J. Food Microbiol. 53, 115–125. [47] Sanz, Y., Mulholland, F., Toldra, F. (1998) Purification and characterization of a tripeptidase from Lactobacillus sake. J. Agric. Food Chem. 46, 349–353. [48] Sanz, Y., Toldra, F. (1997) Purification and characterization of an aminopeptidase from Lactobacillus sake. J. Agric. Food Chem. 45, 1552–1558. [49] Schmidt, S., Berger, R.G. (1998) Aroma compounds in fermented sausages of different origins. Lebensm. Wiss. Technol. 31, 559–567. [50] Smit, G., Smit, B.A., Engels, W.J. (2005) Flavour formation by lactic acid bacteria and biochemical flavour profiling of cheese products. FEMS Microbiol. Rev. 29, 591–610. [51] Smith, J.S., Kenney, P.B., Kastner, C.L., Moore, M.M. (1993) Biogenic amine formation in fresh vacuum packaged beef during storage at 1 ◦ C for 120 days. J. Food Protect. 56, 497–532. [52] Sollner, K., Schieberle, P. (2009) Decoding the key aroma compounds of a Hungarian-type salami bymolecular sensory science approaches. J. Agric. Food Chem. 57, 4319–4327. [53] Stahnke, L.H. (1994) Aroma components from dried sausages fermented with Staphylococcus xylosus. Meat Sci. 38, 39–53. [54] Stahnke, L.H. (1999) Volatiles produced by Staphylococcus xylosus and Staphylococcus carnosus during growth in sausage minces Part I. Collection and identification. Lebensm. Wiss. Technol. 32, 357–364. [55] Stolz, P., Böcker, G., Hammes, W.P., Vogel, R.F. (1995) Utilization of electron acceptors by lactobacilli isolated from sourdough. II Lactobacillus pontis, L. reuteri, L. amulovorus, and L. fermentum. Z. Lebensm. Unters. Forsch., 402–410. [56] Sun, W., Zhao, Q., Zhao, H., Zhao, M., Yang, B. (2010) Volatile compounds of Cantonese sausage released at different stages of processing and storage. Food Chem. 121, 319–325. [57] Thage, B.V., Rattray, F.P., Laustsen, M.W., Ardo, Y., Barkholt, V., Houlberg, U. (2004) Purification and characterization of a branched-chain amino acid aminotransferase from Lactobacillus paracasei subsp. paracasei CHCC 2115. J. Appl. Microbiol. 96, 593–602. [58] Tichaczek, P.S., Vogel, R.F., Hammes, W.P. (1993) Cloning and sequencing of curA encoding curvacin A, the bacteriocin produced by Lactobacillus curvatus LTH1174. Arch. Microbiol. 160, 279–283. [59] Truper, H.G., De’clari, L. (1997) Taxonomic note: necessary correction of specific epithets formed as substantives (nouns) “in apposition”. Int. J. Syst. Bacteriol. 47, 908–909. [60] Vergnais, L., Masson, F., Montel, M.C., Berdague, J.L., Talon, R. (1998) Evaluation of solid-phase microextraction for analysis of volatile metabolites produced by staphylococci. J. Agric. Food Chem. 46, 228–234.

320

S. Freiding et al. / Systematic and Applied Microbiology 34 (2011) 311–320

[61] Vermeulen, N., Pavlovic, M., Ehrmann, M.A., Ganzle, M.G., Vogel, R.F. (2005) Functional characterization of the proteolytic system of Lactobacillus sanfranciscensis DSM 20451T during growth in sourdough. Appl. Environ. Microbiol. 71, 6260–6266. [62] Verplaetse, A. (1994) Influence of raw meat properties and processing technology on aroma quality of raw fermented meat productsL. In: 40th International Congress on Meat and Technology, The Hague, The Netherlands. [63] Wang, N., Lee, C.Y. (2006) Molecular cloning of the aspartate 4-decarboxylase gene from Pseudomonas sp. ATCC19121 and characterization of the bifunctional recombinant enzyme. Appl. Microbiol. Biotechnol. 73, 339–348. [64] Xiraphi, N., Georgalaki, M., Driessche, G.V., Devreese, B., Beeumen, J.V., Tsakalidou, E., Metaxopoulos, J., Drosinos, E.H. (2006) Purification and characterization

of curvaticin L442, a bacteriocin produced by Lactobacillus curvatus L442. Anton. Van Leeuw. 89, 19–26. [65] Yvon, M., Chambellon, E., Bolotin, A., Roudot-Algaron, F. (2000) Characterization and role of the branched-chain aminotransferase (BcaT) isolated from Lactococcus lactis subsp. cremoris NCDO 763. Appl. Environ. Microbiol. 66, 571–577. [66] Yvon, M., Rijnen, L. (2001) Cheese flavour formation by amino acid catabolism. Int. Dairy J. 11, 185–201. [67] Yvon, M., Thirouin, S., Rijnen, L., Fromentier, D., Gripon, J.C. (1997) An aminotransferase from Lactococcus lactis initiates conversion of amino acids to cheese flavor compounds. Appl. Environ. Microbiol. 63, 414–419.