Genetic structure of South Australian Pyrenophora teres populations as revealed by microsatellite analyses

f u n g a l b i o l o g y 1 1 4 ( 2 0 1 0 ) 8 3 4 e8 4 1

journal homepage: www.elsevier.com/locate/funbio

Genetic structure of South Australian Pyrenophora teres populations as revealed by microsatellite analyses Paul BOGACKI*, Felicity J. KEIPER, Klaus H. OLDACH Molecular Plant Breeding CRC, South Australian Research and Development Institute, GPO Box 397, Adelaide, SA 5001, Australia

article info

abstract

Article history:

The aim of this study was to determine the genetic structure of South Australian field

Received 30 September 2009

populations of the barley net blotch pathogens, Pyrenophora teres f. sp. teres (PTT) and P.

Received in revised form

teres f. sp. maculata (PTM), using microsatellite DNA markers. Three PTT populations

17 June 2010

(76 isolates total) and two PTM populations (43 isolates total) were sampled from separate

Accepted 1 August 2010

fields during a single growing season. The results showed that of the 20 microsatellite loci

Available online 7 August 2010

examined, 17 (85 %) were polymorphic within the PTT and PTM populations. In total, 120

Corresponding Editor:

distinct alleles were identified of which only 11 (9 %) were shared between the two pop-

Brenda Diana Wingfield

ulation types. Nei’s measure of gene diversity across the PTT and PTM populations was similar at 0.38 and 0.40, respectively, and also much higher than previously reported

Keywords:

from studies in which other types of molecular markers were used. The coefficient of ge-

Diversity

netic differentiation among both populations was the same (GST ¼ 0.03) and the low and

Microsatellites

insignificant estimates of FST, as indicated by q, between populations of the same type

Net blotch

(PTT: q < 0.008, PTM: q ¼ 0.014) indicated that isolates sampled from different areas within

Population biology

the same field were genetically similar. In contrast, high and significant genetic differen-

Pyrenophora teres

tiation was observed among and between populations of different type (GST ¼ 0.42, q > 0.567). The high number of unique multilocus haplotypes observed within the PTT (84 %) and PTM (100 %) populations, combined with a 1:1 distribution of both mating types, suggested that sexual reproduction was predominant among these populations. However, tests for multilocus associations showed that both PTT and PTM populations were in significant linkage disequilibrium. Although the levels of disequilibrium were low, an asexual reproductive component could not be excluded. Crown Copyright ª 2010 Published by Elsevier Ltd on behalf of The British Mycological Society. All rights reserved.

Introduction Pyrenophora teres is an ascomycete fungus responsible for net blotch disease of barley. The disease is associated with either net or spot form symptoms caused by two different formae specialis of the fungus, with P. teres f. sp. teres (PTT) and P. teres f. sp. maculata (PTM) responsible for the net and spot form of net blotch, respectively (Smedega˚rd-Petersen 1971). Net blotch

is a problem in all barley-growing regions of the world where it causes reductions in both grain yield and malt quality. In Australia, grain yield losses of up to 40 % have been attributed to both forms of the disease (Khan 1987; Jayasena et al. 2007). Resistance breeding based on the incorporation of resistance genes is the most effective method of controlling net blotch disease, however, instances where the pathogen has overcome the effectiveness of resistance genes in cultivars have

* Corresponding author. E-mail address: [email protected] 1878-6146/$ e see front matter Crown Copyright ª 2010 Published by Elsevier Ltd on behalf of The British Mycological Society. All rights reserved. doi:10.1016/j.funbio.2010.08.002

Determining genetic structure of P. teres populations by microsatellite analyses

been reported (Platz et al. 2000). Local pathogen populations are capable of evolving through selection of mutants, recombinants, or immigrants that are better adapted to resistant cultivars. Therefore, investigating the genetic structure of PTT and PTM populations is fundamental to understand the evolutionary potential of these pathogens and for how long particular control measures against them will be effective. Pyrenophora teres has a mixed reproductive system, with one generation of sexual reproduction occurring on the stubble between crops and several generations of asexual reproduction occurring during the growing season of the crop (Peever & Milgroom 1994). Sexual reproduction, which facilitates the generation of genotypic diversity that enables pathogens to adapt to changes in the genetic makeup of host populations, has been reported for both PTT and PTM (Peever & Milgroom 1994; Rau et al. 2003). Due to this mixed reproductive system, P. teres poses a greater risk for overcoming resistance genes compared to strictly asexual or strictly sexual pathogens according to the criteria set out by McDonald & Linde (2002). This is because the sexual cycle leads to the production of new genotypes from which the frequency of individuals with best fitness can increase through an asexual reproductive phase. Although PTT and PTM have been shown to hybridise in the laboratory (McDonald 1963; Campbell et al. 1999), it probably happens very rarely or not at all under field conditions (Campbell et al. 2002; Rau et al. 2003; Leisova et al. 2005b; Serenius et al. 2007). The genetic structure of P. teres populations has previously been investigated using random amplified polymorphic DNA (RAPD) (Peever & Milgroom 1994; Jonsson et al. 2000; Campbell et al. 2002) and amplified fragment length polymorphism (AFLP) (Rau et al. 2003; Leisova et al. 2005b; Serenius et al. 2007) molecular markers. In these studies, varying levels of genetic diversity were detected among populations, with geographical distance shown to be a factor in determining the level of genetic differentiation between populations. Low levels of genetic differentiation have been observed between fields located close to each other (e.g. within 20 km) (Peever & Milgroom 1994; Jonsson et al. 2000; Serenius et al. 2007), whereas fields separated by greater distances (e.g. between different countries, states, or continents) have shown a higher level of genetic differentiation (Serenius et al. 2007). The aim of this study was to investigate the genetic structure both within and among three PTT and two PTM populations sampled from within separate fields located in the barley-growing region of South Australia. Our first objective was to determine the level of genetic diversity and population differentiation among field populations of P. teres based on microsatellite analyses. The second objective was to assess the prevalence of sexual reproduction in these field populations using multilocus analyses of population structure. This work represents the first time that microsatellite markers developed specifically for P. teres (Keiper et al. 2007) have been used to analyse the genetic structure of both PTT and PTM populations. Although multilocus approaches such as RAPD and AFLP are technically convenient, two fundamental limitations of these markers include dominance (only one allele detected), and data are of limited comparability among studies (Sunnucks 2000). In contrast, microsatellites are generally single-locus markers that are co-dominant (multiple alleles can be detected at the same time) and highly reproducible. They are also

835

generally associated with high mutation rates resulting in variation in length and high allelic diversity. For these reasons, the resolution and power of a microsatellite study combining the results from many loci are superior to approaches incorporating RAPDs or AFLPs. Microsatellite markers have previously been used to quantify genetic variation among other fungal species affecting food crops, including Puccinia graminis f. sp. avenae (causal agent of oat stem rust) (Keiper et al. 2006) and Rhynchosporium secalis (causal agent of barley scald) (Bouajila et al. 2007). Their successful application in this study will provide researchers with a powerful method to address many questions associated with P. teres population genetics.

Materials and methods Field sampling, fungal culture, and DNA extraction Barley leaves infected with PTT or PTM were sampled from two South Australian fields during October of the 2005 barley-growing season. The PTT collection was made up of leaves sampled from three segments within a barley field located in Sunnyvale, Yorke Peninsula. Each segment was separated by approximately 500 m in a triangular pattern, and leaves were sampled from within each segment by conducting a circular sweep in which one infected leaf per plant (from cultivar Barque e susceptible to net form of net blotch) was harvested at regular 2 m intervals. The same strategy was used to sample PTMinfected leaves from two different segments separated by approximately 500 m within a barley field in Yeelanna, Eyre Peninsula. However, in contrast to the PTT collection, PTM leaves were harvested from field segments containing a mixture of 25 different breeding lines (that formed part of a national variety trial) with varying levels of resistance to spot form of net blotch. The distance between the fields in Sunnyvale and Yeelana is approximately 230 km. A total of 26, 23, and 27 infected leaves were collected from each PTT-infected field segment, whereas 21 and 22 leaves were sampled from the two PTM-infected field segments. Each segment corresponded to an individual PTT or PTM population (Table 1). Sampled leaves were placed in paper envelopes and air-dried at room temperature for 3 d. To culture single conidial isolates, the infected dry leaves were surface sterilised (30 s in 70 % ethanol, 60 s in 2 % NaOCl, 60 s in distilled water) and placed on wet filter paper in 9 cm plastic petri dishes. Sporulation was induced by incubating petri dishes under a black light blue fluorescent lamp emitting near ultraviolet light (NEC model FL8BL-B) with an alternating photoperiod (10 h light:14 h dark) at 19  C for 3 d. Single conidia were then inoculated onto 3.9 % potato dextrose agar (Becton Dickinson, Sparks, MD, USA) and incubated at room temperature for 7 d. DNA from single conidial cultures was extracted following the method of Campbell et al. (1999). A diagnostic PCR test described by Williams et al. (2001), which differentiates the two formae specialis of Pyrenophora teres, was used to verify the classification of each isolate as either PTT or PTM.

Microsatellite and mating type PCR Twenty microsatellite loci were assayed across all isolates from each population. These twenty loci were amplified using

836

P. Bogacki et al.

Table 1 e South Australian Pyrenophora teres isolates used in this study. Population PTT1 PTT2 PTT3 PTM1 PTM2

No. isolates

Origin

Collector

Date

26 23 27 21 22

Lamshed, Sunnyvale Lamshed, Sunnyvale Lamshed, Sunnyvale Proctor, Yeelanna Proctor, Yeelanna

Hugh Wallwork Hugh Wallwork Hugh Wallwork Hugh Wallwork Hugh Wallwork

5-10-2005 5-10-2005 5-10-2005 4-10-2005 4-10-2005

PTT: Pyrenophora teres f. sp. teres; PTM: Pyrenophora teres f. sp. maculata.

sequence-tagged microsatellite (STM) primers and corresponding anchor primers labelled at their 50 end with the fluorescent dye HEX. Anchor primer and STM primer sequences for eighteen loci (hSPT2-14AGAC, 19AGAC, 21AGAC, 22AGAC, 23AGAC, 25AGAC, 7AGTG, 10AGTG, 11AGTG, 15AGTG, 16AGTG, 23AGTG, 3TCAC, 11TCAC, 12TCAC, 22TCAC, 23TCAC, 25TCAC) are listed in Keiper et al. (2007). The same anchor primers were used with STM primers hSPT2-7AGAC [GATCAGACACTTGTCGTTTCTCG] and hSPT2-6AGTG [TAACAGAGGCAGGGGGTAGGTA] (Keiper, unpubl.) to amplify the additional two loci. PCR products were amplified using a PTC-225 Thermal Cycler (MJ Research, Waltham, MA, USA). The final reaction volume of 6 mL comprised a mixture containing 1 ImmoBuffer (Bioline, London, UK), 1.5 mM MgCl2, 0.2 mM dNTPs, 0.5 mM of each STM and anchor primer, 0.15 U of Immolase DNA polymerase (Bioline), and 1 mL (10 ng) of genomic fungal DNA as template. The PCR was effected using the following cycling conditions: 7 min at 95  C, then 6 cycles of 30 s at 92  C, 1 min at 62  C (decreasing by 1  C/cycle), and 30 s at 72  C, then 40 cycles of 30 s at 92  C, 30 s at 55  C, and 30 s at 72  C, and a final extension step of 10 min at 72  C. PCR products were separated via capillary electrophoresis on a 3730 DNA analyser (Applied Biosystems, Warrington, UK). Microsatellite allele sizes at each locus were determined by visually comparing the mobility of PCR products with that of a LIZ 500 internal size standard (Applied Biosystems) using GeneMapper software v3.7 (Applied Biosystems). To determine the mating type of each isolate (MAT-1 or MAT-2), a PCR assay developed by Rau et al. (2005) was used. PCR products were electrophoresed on a 1.5 % agarose gel, stained with ethidium bromide, and visualised under ultraviolet light.

Data analysis Diversity statistics for each single population and populations grouped by type were calculated using the POPGENE program, version 1.31 (Yeh et al. 1999). These statistics included: [1] the number and percentage of polymorphic loci; [2] the average number of alleles per locus; [3] the allele frequency at each locus; [4] Nei’s (1973) gene diversity (h) estimates at each locus; [5] genetic differentiation estimates among populations according to Nei’s (1973) G-statistics; and [6] Nei’s (1978) unbiased genetic identity (I ) and genetic distance (D) estimates. The degree of genetic differentiation between populations was determined using Weir’s (1996) formulation of FST for haploids, as indicated by the q value, using the Multilocus program, version 1.3 (Agapow & Burt

2001). The statistical significance of the observed q value was determined by comparing q values of 1000 datasets in which individuals were randomised among the populations being compared. The hypothesis of random mating was tested by calculating indices of multilocus association, IA and rd (Brown et al. 1980; Maynard Smith et al. 1993; Agapow & Burt 2001), using the Multilocus program, version 1.3. In addition to using all PTT and PTM individuals, the analysis was also performed on clone-corrected populations to assess the effect of clonality on multilocus associations. P-values for IA and rd were determined by permuting the data 1000 times. A Chi-square (c2) test was used to determine if the populations departed significantly from the expected 1:1 ratio in mating type frequencies.

Results The diagnostic PCR assay developed by Williams et al. (2001) confirmed the original classification of isolates as either PTT or PTM, with the correct diagnostic band being amplified from the DNA of all individuals in each respective population (data not shown). There were no PTT isolates among the PTM populations and vice versa. Table 2 shows the allele composition and distribution of frequencies for the 20 microsatellite loci in the three PTT and two PTM populations analysed. The 20 loci examined were highly polymorphic, with the number of alleles per locus over all populations ranging from 3 (AGAC23) to 10 (AGAC21), and a mean number of alleles per locus of 6.0 (Table 3). There were 120 distinct alleles identified in total, of which 11 (9 %) across six loci (AGAC19/23, AGTG15, TCAC12, 23, 25) were common between PTT and PTM populations. The remaining 14 loci were comprised of alleles specific to either PTT or PTM. Both of the PTT and PTM population groups were also monomorphic at two different loci (PTT: AGAC14, TCAC22; PTM: AGAC7, AGTG11). For the PTT populations, 90 % of the loci assayed were polymorphic, with an average of 3.3 alleles per locus. Nei’s average gene diversity values were very similar for each individual population (h ¼ 0.36e0.39, Table 3), with the average gene diversity across all loci combined being 0.38. The low coefficient of genetic differentiation (GST ¼ 0.03, Table 3) combined with low pairwise comparisons of q values (q < 0.008, Table 4) revealed no significant differentiation among and between the three PTT populations. This was further verified by Nei’s measure of genetic identity being high (I  0.98, Table 5), which means there is at least a 98 % chance of finding the same allele at any locus in two individuals drawn at random from these populations.

Determining genetic structure of P. teres populations by microsatellite analyses

837

Table 2 e Observed allelic frequencies at 20 microsatellite loci for the five Pyrenophora teres populations studied. Alleles are denoted by their total size in basepairs. Locus

No. alleles

AGAC7

6

AGAC14

4

AGAC19

4

AGAC21

10

AGAC22

4

AGAC23

3

AGAC25

4

AGTG6

AGTG7

AGTG10

AGTG11

7

5

6

6

Allele length 209 222 224 228 230 232 160 168 172 174 122 131 133 139 116 118 120 124 126 128 130 132 134 136 170 172 176 178 99 103 107 85 91 92 95 144 146 148 151 153 155 157 158 161 162 163 171 162 164 165 169 173 175 183 185 187 189 191 193

Allele frequencies

Locus

PTT1

PTT2

PTT3

PTM1

PTM2

0.077 0.385 0.462 0.039 0.039 1.000 0.808 0.192 0.308 0.692 0.039 0.962 1.000 0.800 0.200 0.077 0.039 0.885 0.039 0.462 0.500 0.654 0.039 0.308 0.308 0.269 0.192 0.039 0.192

0.609 0.391 1.000 0.826 0.174 0.435 0.565 0.044 0.957 1.000 0.783 0.217 0.174 0.826 0.478 0.522 0.478 0.522 0.522 0.130 0.130 0.217

0.077 0.385 0.500 0.039 1.000 0.741 0.037 0.037 0.185 0.296 0.667 0.037 1.000 0.926 0.074 0.852 0.148 0.037 0.037 0.926 0.444 0.556 0.778 0.222 0.259 0.259 0.148 0.333

1.000 0.474 0.105 0.421 0.278 0.722 0.238 0.095 0.524 0.095 0.048 0.048 0.952 0.300 0.700 0.762 0.238 0.074 0.741 0.111 0.074 0.905 0.095 0.632 0.263 0.105 1.000 -

1.000 0.455 0.273 0.273 0.455 0.546 0.136 0.136 0.409 0.046 0.046 0.046 0.182 1.000 0.091 0.909 0.864 0.136 0.046 0.546 0.364 0.046 0.864 0.136 0.318 0.636 0.046 1.000 -

No. alleles

AGTG15

9

AGTG16

7

AGTG23

8

TCAC3

8

TCAC11

7

TCAC12

5

TCAC22

5

TCAC23

7

TCAC25

5

Allele length 117 121 127 129 133 135 137 149 151 148 150 152 154 156 158 160 162 166 168 171 173 181 185 187 326 328 332 333 334 335 337 339 123 125 131 137 139 141 143 156 158 162 168 170 108 114 116 118 120 152 154 156 158 160 162 164 105 118 120 127 129

Allele frequencies PTT1

PTT2

PTT3

PTM1

PTM2

0.200 0.360 0.440 0.077 0.039 0.885 0.077 0.192 0.731 0.039 0.692 0.039 0.231 0.039 0.577 0.039 0.346 0.731 0.269 1.000 0.500 0.192 0.192 0.039 0.077 0.833 0.167 -

0.130 0.478 0.044 0.348 0.174 0.826 0.046 0.273 0.318 0.364 0.636 0.091 0.273 0.619 0.048 0.286 0.048 0.522 0.478 1.000 0.652 0.044 0.087 0.174 0.044 0.652 0.348 -

0.185 0.259 0.556 0.037 0.037 0.926 0.370 0.296 0.333 0.846 0.154 0.654 0.077 0.269 0.593 0.407 1.000 0.593 0.148 0.148 0.037 0.037 0.037 0.704 0.296 -

0.191 0.048 0.048 0.286 0.381 0.048 0.095 0.667 0.143 0.095 1.000 0.500 0.500 0.913 0.087 0.632 0.316 0.053 0.539 0.039 0.308 0.115 0.083 0.042 0.500 0.333 0.042 0.150 0.700 0.050 0.100

0.546 0.182 0.182 0.091 0.046 0.546 0.364 0.046 0.046 0.864 0.046 0.046 0.046 0.046 0.409 0.500 0.909 0.091 0.591 0.364 0.046 0.546 0.182 0.046 0.227 0.136 0.591 0.273 0.143 0.762 0.095

838

P. Bogacki et al.

Table 3 e Genetic diversity among South Australian Pyrenophora teres populations revealed by 20 microsatellite loci. nIa

Population

nAb

nPLc

%PLd

he

HTf

HSg

GSTh

PTT1 PTT2 PTT3 PTT all

26 23 27 76

2.8 2.5 2.7 3.3

[1.3] [1.1] [1.2] [1.5]

17 17 17 18

85 85 85 90

0.37 [0.23] 0.39 [0.22] 0.36 [0.23] 0.38 [0.23]

0.38 [0.05]

0.37 [0.05]

0.03

PTM1 PTM2 PTM all

21 22 43

2.9 [1.4] 3.0 [1.4] 3.3 [1.6]

17 17 18

85 85 90

0.40 [0.24] 0.39 [0.24] 0.40 [0.23]

0.41 [0.06]

0.39 [0.05]

0.03

119

6.0 [1.9]

20

100

0.65 [0.11]

0.66 [0.01]

0.38 [0.02]

0.42

PTT/PTM

a Number of isolates analysed. b Average number of alleles per locus. c Number of polymorphic loci. d Percentage of polymorphic loci. e Nei’s (1973) average gene diversity. f Gene diversity totalled among subpopulations. g Gene diversity within subpopulations. h Nei’s (1973) coefficient of genetic differentiation.

Conversely, the corresponding genetic distances were very low (D  0.02, Table 5). Similar results were obtained for the PTM populations. The percentage of polymorphic loci was high at 90 % and the average number of alleles per locus was also 3.3. Nei’s average gene diversity index was similar for both PTM populations (h ¼ 0.39–0.40, Table 3) and was comparable to the values obtained for each PTT population. A small and insignificant level of genetic differentiation among and between the two PTM populations was indicated by a low coefficient of genetic differentiation (GST ¼ 0.03, Table 3) and low q value (q ¼ 0.014, Table 4). As with the PTT populations, the genetic identity was high (I  0.97, Table 5) and genetic distance low (D  0.03, Table 5). In contrast, the level of genetic diversity and genetic differentiation increased when the PTT and PTM populations were included together in the same analysis. Nei’s average gene diversity across all loci increased (h ¼ 0.65, Table 3) as did the coefficient of genetic variation (GST ¼ 0.42, Table 3). Pairwise combinations of q values (q > 0.567, Table 4) showed there was significant genetic differentiation between PTT and PTM populations. Pairwise comparisons of genetic identity were low (I  0.1, Table 5), and genetic distance high (D  2.3, Table 5). Results of the multilocus analysis for each of the PTT and PTM populations are shown in Table 6. For the PTT populations, 64 out of the 76 isolates (84 %) had a unique multilocus

a

0.582 0.572a 0.588a 0.014 PTM2

0.008 0.005 0.578a PTT1

0.005 0.567a PTT2

Discussion In this study, microsatellite markers developed specifically for Pyrenophora teres (Keiper et al. 2007) were used to determine the genetic structure of PTT and PTM populations sampled from

Table 5 e Genetic identity and genetic distance between pairs of Pyrenophora teres populations collected from South Australia.

Table 4 e Genetic differentiation between pairs of Pyrenophora teres populations collected from South Australia. PTT1 PTT2 PTT3 PTM1

haplotype. There were four cases in which the same multilocus haplotype was found in the same or different field populations. One DNA fingerprint was shared by 10 isolates (5 PTT1, 2 PTT2, and 3 PTT3), while another three DNA fingerprints were each common to two isolates. In contrast, no multilocus haplotype was shared among the 43 PTM isolates. Because there was low and insignificant genetic differentiation between populations of the same type within each field, samples of the same type were combined to obtain larger sample sizes for greater power in testing the significance of IA estimates. The random mating hypothesis was rejected among PTT and PTM populations as shown by the values of IA and rd, which differed significantly from zero in both cases e even when clones were removed from the analysis in the PTT group. Both mating types were identified and the mating type ratio did not deviate significantly from a 1:1 ratio [c2 ¼ 1.75, df ¼ 1] and [c2 ¼ 0.38, df ¼ 1] within PTT and PTM populations, respectively.

0.584a PTT3

Values correspond to Weir’s (1996) coefficient of differentiation (q). a P < 0.001.

PTT1 PTT2 PTT3 PTM1 PTM2

PTT1

PTT2

PTT3

PTM1

PTM2

**** 0.019 0.009 2.364 2.488

0.982 **** 0.016 2.394 2.538

0.991 0.984 **** 2.414 2.525

0.094 0.091 0.089 **** 0.027

0.083 0.079 0.080 0.973 ****

Nei’s (1978) genetic identity [I] (above diagonal) and genetic distance [D] (below diagonal).

Determining genetic structure of P. teres populations by microsatellite analyses

Table 6 e Indices of multilocus association in Pyrenophora teres populations collected from South Australia. Population nIb nUGc PTT all PTM all a b c d e

76 43

64 43

IAd

rde

P-values for IA and rd

1.40 (0.92)a 0.09 (0.06)a <0.001 (<0.001)a 0.19 0.01 0.027

Number in parenthesis corresponds to clone-corrected samples. Number of isolates. Number of unique genotypes. Index of association. Modified index of association.

two different fields within the state of South Australia. The markers used proved to be highly polymorphic and revealed clear differences in the distribution of alleles for 91 % of the loci tested between the two fungal types. This provides further evidence that the two formae specialis of P. teres are indeed genetically distinct from one another as has been shown in previous studies (Williams et al. 2001; Leisova et al. 2005a; Bakonyi & Justesen 2007; Keiper et al. 2008). Because the forms of net blotch can be difficult to differentiate based on disease symptoms or spore morphology, the 14 STM markers that amplified distinct PTT- or PTM-specific allelic fragments can thus potentially be used as diagnostic markers for accurate disease diagnosis. As a diagnostic tool, this adds to the nine STM markers described by Keiper et al. (2008) and the formae-specific PCR primers developed by Williams et al. (2001) and Leisova et al. (2005a). The mean gene diversity values of 0.38 and 0.40 obtained for the three PTT and two PTM populations, respectively, were much higher than those previously reported for P. teres populations of the same type. Much lower gene diversity indices of 0.046 to 0.045 were observed among PTT and PTM populations from Sardinia, Italy (Rau et al. 2003). Figures of 0.062 and 0.082 were obtained for PTT and PTM populations from South Africa (Campbell et al. 2002), while values ranging from 0.08 to 0.17 were reported among five P. teres populations from North America and Germany (Peever & Milgroom 1994). The highest gene diversity indices previously reported for populations of the same type were 0.182 and 0.216 from two Swedish PTT populations (Jonsson et al. 2000). The values from these studies were generated using either RAPD or AFLP marker data. The co-dominant nature of the microsatellite markers used in the present work, combined with their high polymorphism levels may explain why the genetic diversity detected in this study was much higher than previous reports. Accordingly, Bouajila et al. (2007) observed different levels of genetic variability among the same Rhynchosporium secalis populations from Tunisia depending on whether AFLP or microsatellite markers were used. In their study, the mean gene diversity value of 0.67 obtained using microsatellites was twice that of the value acquired with AFLP markers. The mean gene diversity value of 0.65 obtained when the PTT and PTM populations were analysed collectively is similar to the value of 0.59 reported by Keiper et al. (2007) across a collection of six PTT and PTM isolates. The results of the population differentiation suggest that P. teres populations within each respective field are genetically similar. This was indicated by (a) the low coefficient of genetic

839

differentiation observed among populations of the same type (GST ¼ 0.03 for both PTT and PTM population groups), and (b) the low and insignificant estimates of FST between population pairs of the same type (PTT: q < 0.008, PTM: q ¼ 0.014). The GST value compares well with previous studies in which Nei’s (1973) G-statistics have been used to analyse genetic differentiation among and between P. teres populations sampled from the same or nearby (within 20 km) fields. Campbell et al. (2002) reported a small coefficient of genetic differentiation (GS ¼ 0.0149) between P. teres populations originating from the same field in South Africa, whereas GST values of 0.05 and 0.053 were obtained between P. teres populations separated by approximately 20 km in Canada (Peever & Milgroom 1994) and Sweden (Jonsson et al. 2000), respectively. Elsewhere, Serenius et al. (2007) reported similar low and insignificant levels of genetic differentiation between isolates of the same type from different fields within states of Australia using F-statistics. Their results included an insignificant FST value of 0.002 between two groups of PTM isolates sampled from the same field (Yeelana) as the one from which PTM isolates were collected in this study. In contrast, significant genetic differentiation has been observed among P. teres populations separated by greater distances e.g. between states in Australia and different countries in the northern hemisphere (Serenius et al. 2007). The high coefficient of genetic differentiation (GST ¼ 0.42) observed among PTT and PTM populations combined with high and significant values of q between individual populations of different type (q > 0.567) provides further evidence that the corresponding isolates were genetically distinct from one another. High levels of genotypic diversity were identified among all five P. teres populations, with unique multilocus haplotypes found in 84 % of PTT isolates and all PTM isolates. Similar high levels of genotypic diversity have been observed among PTT and/or PTM field populations in Italy (Rau et al. 2003), Finland (Serenius et al. 2005, 2007), Czech Republic (Leisova et al. 2005b), Russia (Serenius et al. 2007), Sweden (Jonsson et al. 2000) and Australia (Serenius et al. 2007). This evidence indicates that sexual reproduction among P. teres populations is occurring regularly, which in our case was further verified by the presence and equal distribution of both mating types. However, tests for multilocus associations (IA and rd) showed that the PTT and PTM populations were in linkage disequilibrium e indicating that some level of clonality exists among each of the two different population types. Previous studies using tests for multilocus associations have reported evidences both for and against random mating in P. teres populations (Rau et al. 2003; Serenius et al. 2007), which is thought to be influenced by environmental conditions and agronomical practices. In the latter study the hypothesis of random mating was rejected in a population of PTT isolates sampled from a field in Finland in which genotype diversity was also high and there was an equal distribution of mating types. Similar discrepancies have been reported among populations of other fungal species, including Cercospora beticola (Groenewald et al. 2008) and Alternaria brassicicola (Bock et al. 2005). The exact cause of these discrepancies is unclear, however it should be noted that factors other than asexual reproduction such as epistatic selection, population admixture, genetic drift and slow asymptotic decay of historic disequilibrium can all explain

840

non-zero values of IA and rd (Milgroom 1996). In the PTM population, epistatic selection e defined as the selection for phenotypes controlled by the interaction of genes at more than one locus (Milgroom 1996) e may have contributed to this result. A number of different loci harbouring genes that control resistance to spot form of net blotch have been reported in different barley lines (Williams et al. 2003; Friesen et al. 2006; Manninen et al. 2006). The fact that PTM isolates used in this study were sampled from a mixture of 25 different barley lines means that multiple resistance genes could have selected for pathotypes with compatible avirulence genes e resulting in linkage disequilibrium. This has been shown for many genefor-gene systems (Milgroom 1996). Population admixture resulting from the sampling of isolates from two or more subpopulations for which the frequencies of marker alleles differ could also explain the possible occurrence of linkage disequilibrium. Isolates sampled from one field can represent several subpopulations if the primary inoculum is from seed (Bennett et al. 2005), which is recognised as an important source of P. teres inoculum (Jordan 1981). In summary, this study has shed light on the genetic structure of PTT and PTM field populations in South Australia. Both populations were characterised by higher than previously reported gene diversity, whereas the low genetic differentiation between populations of the same type within a field compared well with previous studies. Both population types appeared to be sexually recombining, although an asexual reproductive component was also evident. The potential for using co-dominant, locus-specific microsatellite markers to analyse the genetic structure of P. teres populations was also demonstrated. The use of these microsatellite markers by the wider research community will enable more accurate comparative studies to be performed on the genetic structure and evolution of P. teres populations from different world regions.

Acknowledgements This project was supported by the Molecular Plant Breeding CRC and the Grains Research and Development Corporation (Project No. CMB00020). We would like to thank Hugh Wallwork from the South Australian Research and Development Institute (SARDI) for provision of P. teres isolates, as well as Milica Grcic from SARDI and Justine Chambers from the Australian Genome Research Facility for their technical assistance. Klaus Oldach is also an affiliate of the University of Adelaide.

references

Agapow P-M, Burt A, 2001. Indices of multilocus linkage disequilibrium. Molecular Ecology Notes 1: 101e102. Bakonyi J, Justesen AF, 2007. Genetic relationship of Pyrenophora graminea, P. teres f. maculata and P. teres f. teres assessed by RAPD analysis. Journal of Phytopathology 155: 76e83. Bennett RS, Milgroom MG, Bergstrom GC, 2005. Population structure of seedborne Phaeosphaeria nodorum on New York wheat. Phytopathology 95: 300e305.

P. Bogacki et al.

Bock CH, Thrall PH, Burdon JJ, 2005. Genetic structure of populations of Alternaria Brassicicola suggests the occurrence of sexual recombination. Mycological Research 109: 227e236. Bouajila A, Abang MM, Haouas S, Udupa S, Rezgui S, Baum M, Yahyaoui A, 2007. Genetic diversity of Rhynchosporium secalis in Tunisia as revealed by pathotype, AFLP, and microsatellite analyses. Mycopathologia 163: 281e294. Brown AHD, Feldman MW, Nevo E, 1980. Multilocus structure in natural populations of Hordeum spontaneum. Genetics 96: 523e536. Campbell GF, Crous PW, Lucas JA, 1999. Pyrenophora teres f. maculata, the cause of Pyrenophora leaf spot of barley in South Africa. Mycological Research 103: 257e267. Campbell GF, Lucas JA, Crous PW, 2002. Evidence of recombination between net- and spot-type populations of Pyrenophora teres as determined by RAPD analysis. Mycological Research 106: 602e608. Friesen TL, Faris JD, Lai Z, Steffenson BJ, 2006. Identification and chromosomal location of major genes for resistance to Pyrenophora teres in a doubled-haploid barley population. Genome 49: 855e859. Groenewald M, Linde CC, Groenewald JZ, Crous PW, 2008. Indirect evidence for sexual reproduction in Cercospora beticola populations from sugar beet. Plant Pathology 57: 25e32. Jayasena KW, Van Burgel A, Tanaka K, Majewski J, Loughman R, 2007. Yield reduction in barley in relation to spot-type net blotch. Australasian Plant Pathology 36: 429e433. Jonsson R, Sa¨ll T, Bryngelsson T, 2000. Genetic diversity for random amplified polymorphic DNA (RAPD) markers in two Swedish populations of Pyrenophora teres. Canadian Journal of Plant Pathology 22: 258e264. Jordan VWL, 1981. Aetiology of barley net blotch caused by Pyrenophora teres and some effects on yield. Plant Pathology 30: 77e87. Keiper FJ, Haque MS, Hayden MJ, Park RF, 2006. Genetic diversity in Australian populations of Puccinia graminis f. sp. avenae. Phytopathology 96: 96e104. Keiper FJ, Capio E, Grcic M, Wallwork H, 2007. Development of sequence-tagged microsatellites for the barley net blotch pathogen, Pyrenophora teres. Molecular Ecology Notes 7: 664e666. Keiper FJ, Grcic M, Capio E, Wallwork H, 2008. Diagnostic microsatellite markers for the barley net blotch pathogens, Pyrenophora teres f. maculata and Pyrenophora teres f. teres. Australasian Plant Pathology 37: 428e430. Khan TN, 1987. Relationship between net blotch (Drechslera teres) and losses in grain yield of barley in Western Australia. Australian Journal of Agricultural Research 38: 671e679. Leisova L, Kucera L, Minarikova V, Ovesna J, 2005a. AFLP-based PCR markers that differentiate spot and net forms of Pyrenophora teres. Plant Pathology 54: 66e73. Leisova L, Minarikova V, Kucera L, Ovesna J, 2005b. Genetic diversity of Pyrenophora teres isolates as detected by AFLP analysis. Journal of Phytopathology 153: 569e578. Manninen OM, Jalli M, Kalender R, Schulman A, Afanasenko O, Robinson J, 2006. Mapping of major spot-type and net-type net-blotch resistance genes in the Ethiopian barley line CI9819. Genome 49: 1564e1571. Maynard Smith J, Smith NH, O’Rourke M, Spratt BG, 1993. How clonal are bacteria? Proceedings of the National Academy of Sciences of the United States of America 90: 4384e4388. McDonald BA, Linde C, 2002. Pathogen population genetics, evolutionary potential, and durable resistance. Annual Review of Phytopathology 40: 349e379. McDonald WC, 1963. Heterothallism in Pyrenophora teres. Phytopathology 53: 771e773. Milgroom MG, 1996. Recombination and the multilocus structure of fungal populations. Annual Review of Phytopathology 34: 457e477.

Determining genetic structure of P. teres populations by microsatellite analyses

Nei M, 1973. Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences of the United States of America 70: 3321e3323. Nei M, 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89: 583e590. Peever TL, Milgroom MG, 1994. Genetic structure of Pyrenophora teres populations determined with random amplified polymorphic DNA markers. Canadian Journal of Botany 72: 915e923. Platz GJ, Bell KL, Rees RG, Galea VJ, 2000. Pathotype variation of the Australian net blotch population. In: Logue Susan (ed), Proceedings of the 8th International Barley Genetics Symposium, vol. 2. Manning Press, Adelaide, SA, pp. 160e162. Rau D, Brown AHD, Brubaker CL, Attene G, Balmas V, Saba E, Papa R, 2003. Population genetic structure of Pyrenophora teres Drechs. the causal agent of net blotch in Sardinian landraces of barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 947e959. Rau D, Maier FJ, Papa R, Brown AHD, Balmas V, Saba E, Schaefer W, Attene G, 2005. Isolation and characterization of the mating-type locus of the barley pathogen Pyrenophora teres and frequencies of mating-type idiomorphs within and among fungal populations collected from barley landraces. Genome 48: 855e869. Serenius M, Mironenko N, Manninen O, 2005. Genetic variation, occurrence of mating types and different forms of Pyrenophora

841

teres causing net blotch of barley in Finland. Mycological Research 109: 809e817. Serenius M, Manninen O, Wallwork H, Williams K, 2007. Genetic differentiation in Pyrenophora teres populations measured with AFLP markers. Mycological Research 111: 213e223. Smedega˚rd-Petersen V, 1971. Pyrenophora teres f. maculata f. nov. and Pyrenophora teres f. teres on barley in Denmark. In: Yearbook of the Royal Veterinary and Agricultural University, Copenhagen, pp. 124e144. Sunnucks P, 2000. Efficient genetic markers for population biology. Trends in Ecology and Evolution 15: 199e203. Weir BS, 1996. Genetic Data Analysis II. Sinauer Associates Inc. Publishers, Sunderland, MA, USA. Williams KJ, Smyl C, Lichon A, Wong KY, Wallwork H, 2001. Development and use of a PCR-based assay that differentiates the pathogens causing spot form and net form of net blotch of barley. Australasian Plant Pathology 30: 37e44. Williams KJ, Platz GJ, Barr AR, Cheong J, Willsmore K, Cakir M, Wallwork H, 2003. A comparison of the genetics of seedling and adult plant resistance to the spot form of net blotch (Pyrenophora teres f. maculata). Australian Journal of Agricultural Research 54: 1387e1394. Yeh FC, Yang RC, Boyle T, 1999. Popgene Version 1. 31. Microsoft Window-based Freeware for Population Genetic Analysis Distributed by F. Yeh. University of Alberta, Edmonton, Canada.