- Email: [email protected]
Genetic variability in the major capsid L1 protein of human papillomavirus type 16 (HPV-16) and 18 (HPV-18)
Infection, Genetics and Evolution 11 (2011) 2119–2124
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
Genetic variability in the major capsid L1 protein of human papillomavirus type 16 (HPV-16) and 18 (HPV-18) E. Frati a, S. Bianchi a, D. Colzani a, A. Zappa a, G. Orlando b, E. Tanzi a,c,⇑ a
Dipartimento di Sanità Pubblica-Microbiologia-Virologia, Università degli Studi di Milano, Via C. Pascal 36, 20133 Milan, Italy STD Unit, II Division Infectious Diseases, L. Sacco University Hospital, Via G.B. Grassi 47, 20157 Milan, Italy c CIRI-IV, Dipartimento di Scienze della Salute, Università degli Studi di Genova, Via Pastore 1, 16132 Genova, Italy b
a r t i c l e
i n f o
Article history: Available online 26 June 2011 Keywords: HPV-16 HPV-18 L1 capsid protein Immunodominant epitopes Intratypic variants Cervical cancer
a b s t r a c t HPV-16 and HPV-18 infections result in nearly 73% of cervical cancers worldwide. The L1 protein comprising HPV vaccine formulations elicit high-titre neutralizing antibodies. The aim of this study was to detect L1 HPV-16 and HPV-18 gene polymorphisms and analyze intratypic variations. HPV-16 (n = 29) and HPV-18 (n = 5) L1 gene sequences were obtained from cervical samples harvested from Italian women. Phylogenetic trees were constructed using the Neighbor-Joining and the Kimura 2-parameters methods (MEGA software). To estimate selection pressures acting on the L1 gene, codon-specific nonsynonymous (dN) and synonymous (dS) substitutions were inferred using the Nei–Gojobori method and Jukes–Cantor model (MEGA software) and integrated analyses carried out using SLAC, FEL and REL methodologies. All the HPV-16 L1 sequences analyzed fell into the European branch (99.4–99.7% similarity). Thirty-four single nucleotide changes were observed and 18 (52.9%) were non-synonymous mutations (7/18 were identified in sequences encoding an immunodominant loop and one occurred in the sequence encoding the a-4 domain associated with VLP conformation). There was no evidence of positive selection in the sequence alignment of L1 HPV-16 genes (P-value < 0.1). One mutation was identified in a negatively selected codon. HPV-18 L1 analyzed sequences fell into two phylogenetic branches: the HPV18 European branch (99.5–100% similarity) and the HPV-18 African branch (99.8% similarity). Nine single nucleotide changes were observed and 4/9 (44.5%) of these nucleotide mutations were non-synonymous and one was present in a sequence encoding the immunodominant FG loop. There was no evidence of positive selection in the sequence alignment of L1 HPV-18 genes (P-value < 0.1). This study identified polymorphisms of undefined biological activity in HPV-16 and HPV-18 L1 sequences. Information regarding the genetic diversity of HPV-16 and HPV-18 L1 gene sequences may help define the oncogenic potential of respective strains and to better understand immune escape mechanisms. Ó 2011 Elsevier B.V. All rights reserved.
1. Introduction Human papillomaviruses (HPVs) are a heterogeneous group of double-stranded DNA viruses with a genome consisting of up to eight genes classified as either ‘‘early’’ (E1–E2, E4–E7) or ‘‘late’’ (L1 and L2) genes based on temporal expression (Danos et al., 1982). HPV is recognized as the etiological agent of cervical cancer (Bosch et al., 2002). More than 120 distinct HPV genotypes have the potential of infecting mucosal and cutaneous human epithelial cells. The 40 mucosal HPV genotypes are classified into low- and high-risk types, depending on their association with cervical intraepithelial neoplasia and cancer (Bernard et al., 2010). ⇑ Corresponding author at: Dipartimento di Sanità Pubblica-Microbiologia-Virologia, Università degli Studi di Milano, Via C. Pascal 36, 20133 Milan, Italy. Tel.: +39 0250315139; fax: +39 0250315120. E-mail address: [email protected] (E. Tanzi). 1567-1348/$ - see front matter Ó 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.meegid.2011.06.014
Pentamers of the major late protein (L1) can self-assemble into empty capsids, referred as virus like particles (VLPs) (Bishop et al., 2007), which are components used in the design of prophylactic vaccines. The two currently available prophylactic L1 VLPs vaccines are able to effectively induce higher levels of type-specific neutralizing antibodies than those induced within natural infections and cell-mediated immunity, resulting in protection against persistent infection and associated cervical neoplasia attributable to HPV vaccine types (Bishop et al., 2007; Moscicki and Smith, 2008). Despite the ongoing vaccine trials, little is known about the variability of the viral L1 immunodominant epitopes that should be recognized by the neutralizing vaccine-induced antibodies. Crystallographic studies have been used to define specific loop structures present on the surface of assembled capsids (Chen et al., 2000) and have identified five hypervariable immunodominant regions (named BC, DE, EF, FG, and HI loops), each ranging between 10 and 30 amino acids in length and located within
2120
E. Frati et al. / Infection, Genetics and Evolution 11 (2011) 2119–2124
surface-exposed loops (Christensen et al., 1996; Christensen and Kreider, 1990; Olcese et al., 2004; White et al., 1998). HPV L1 loops exhibit considerable polymorphism within and between HPV types (Carter et al., 2006; Christensen et al., 2001; Olcese et al., 2004), resulting in the generation of neutralizing antibodies of different binding affinities (Varsani et al., 2006). L1 polymorphisms likely play a role in mediating escape from neutralization antibody responses since non synonymous variations are localized closely to neutralizing epitopes (Pastrana et al., 2001; Roden et al., 1997). Despite these important observations, there is limited information regarding L1 gene polymorphisms (Gagnon et al., 2007; Icenogle et al., 1995; Raiol et al., 2009; Stewart et al., 1996; Yamada et al., 1995) even though L1 sequence analyses have been used to classify HPV isolates into either genera, species, types, subtypes and variants (de Villiers et al., 2004). The Papillomavirus Nomenclature Committee has established that HPV genomes be classified into molecular variants when they present with more than 98% similarity to the prototype L1 gene sequence (Bernard, 2002; Bernard et al., 2010; de Villiers et al., 2004; Yamada et al., 1995). HPV evolutionary analysis has identified the African origin of the virus (Alvarez-Salas and DiPaolo, 2007) and its dissemination throughout the world. HPV-16 and -18 are the HPV types associated with the highest risk of cervical cancer, accounting for nearly 57% and 16%, respectively, of all cervical cancers reported worldwide (Li et al., 2011). HPV-16 variants can be classified phylogenetically and are distributed differentially within the five continents and within different ethnic groups. These variants include the European (E), the Asian (As), the Asian-American (AA), that also includes the North-American (NA1) variant; the African type 1 (Af1) and type 2 (Af2) variants (Chen et al., 2005; Ho et al., 1998; Wheeler et al., 1997; Yamada et al., 1995). E and As variant branches are closely related, such that As variant can be considered a subclass of the E variant branch (Yamada et al., 1997). For HPV-18, different variants have been defined as Asian-American (AA), the African (Af), the European (E) variants (Chen et al., 2009; Ong et al., 1993). Comparative nucleotide sequence analyses of these viruses have assisted in the elucidation of their respective phylogenetic relationships. In addition, HPV intratype variability analysis has also been used as an important tool in epidemiological studies designed to define viral transmission patterns, viral persistence and progression to clinically relevant cervical lesions. To date, there are little data regarding the functional significance and the molecular epidemiology of HPV variants. The purpose of this study was to identify nucleotide polymorphisms within the L1 gene of HPV-16 and HPV-18 sequences collected in Italy and to analyze intratypic variations. 2. Materials and methods 2.1. Study sequences HPV-16 (n = 29) and HPV-18 (n = 5) sequences obtained from cervical swabs of Italian HPV-infected women were used for molecular characterization by sequence analysis of the L1 gene. 2.2. Nucleic acid extraction and sequencing amplification Nucleic acids were extracted from cervical samples using a NucliSENSÒ miniMAGÒ kit (bioMérieux Clinical Diagnostics, France). Molecular characterization was performed by sequence analysis of a 1,488 bp L1 gene amplicon (nucleotides 5,613–7,101 of HPV-16 European prototype, AF536179) for HPV-16 and a 1,489 bp L1 gene amplicon (nucleotides 5,613–7,101 of HPV-18 European prototype sequence, X05015) for HPV-18.
Partial HPV-16 and HPV-18 L1 gene sequences were amplified using degenerate primer pairs (Table 1). Two partially overlapping fragments for each virus were amplified. The amplification of the fragments was performed using 1 lg extracted DNA as template and reactions carried out in 50 ll reaction volumes containing 5X PCR Buffer, 200 lM dNTPs, 30 pmol of each primer and 1 U Taq (GoTaqÒ DNA Polymerase 5 U/ll Promega, Madison WI). The cycling conditions were as follows: 94 °C for 5 min followed by 40 cycles at 94 °C for 30 sec, 55 °C for 1 min (HPV-16) or 60 °C for 1 min (HPV-18), 72 °C for 1 min and a final 72 °C extension for 7 min. Amplicons were visualized on 2% agarose gels stained with ethidium bromide. Following PCR amplification of the L1 gene, amplicons were purified using NucleoSpinÒ Extract II (Macherey-Nagel GmbH, Germany) and nucleotide sequences were obtained following automated DNA sequencing using an ABI PRISM 3100 genetic analyzer (Applied Biosystem, CA, USA). 2.3. Molecular characterization and phylogenetic analysis Multiple L1 gene nucleotide sequences were aligned using ClustalX, version 2.0. Phylogenetic trees of respective HPV-16 and HPV-18 L1 sequences were constructed using the Neighbor-Joining method (Saitou and Nei, 1987) and the Kimura 2-Parameter model (Kimura, 1980) using the MEGA package, version 4.1 (Tamura et al., 2007). A bootstrap re-sampling analysis was performed (1,000 replicates) to test tree robustness (Felsenstein, 1985). The HPV16 and HPV-18 L1 gene sequences of the viral strains studied were deposited into NCBI GenBank Database [], under accession numbers: JF728155–JF728188. The reference viral strains used for the construction of phylogenetic trees were obtained from the NCBI GenBank Database (HPV-16: AY686580, FJ006723, AY686581, EU118173, AF534061, U89348, AF536179, AF472508, AF536180, AF472509, and AY686579; HPV-18: EF202146, AY262282, EF202143, X05015, EF202144, EF202145, EF202150, EF202151, EF202148, EF202147, EF202149, EF202152, EF202155, EF202154 and EF202153). 2.4. Selective pressure analysis To estimate selection pressure acting on the HPV-16 and HPV18 L1 gene sequences, codon-specific, non-synonymous (dN) and synonymous (dS) substitutions were inferred using the Nei–Gojobori method (Nei and Gojobori, 1986) and the Jukes–Cantor model (Jukes and Cantor, 1969) with MEGA software and the Single Likelihood Ancestor Counting (SLAC), Fixed Effects Likelihood (FEL) and Random Effects Likelihood (REL) methods, all incorporating the HKY85 substitution models with phylogenetic trees inferred using the Neighbor-Joining method available at Datamonkey (). 3. Results 3.1. Phylogenetic analysis of L1 HPV-16 sequences LI HPV-16 sequences were determined and analyzed by aligning the L1 1,318 nucleotide sequences from all viral strains (n = 40) (including the reference sequences). All HPV-16 L1 sequences fell into one of the phylogenetic branches: HPV-16 European prototype branch (Fig. 1). The sequences showed a high similarity (99.4– 99.7%) to the HPV-16 European prototype reference sequence. Thirty-four single nucleotide changes were identified among the sequences studied. Specifically, 16/34 (47.1%) were synonymous mutations and 18/34 (52.9%) were non synonymous muta-
2121
E. Frati et al. / Infection, Genetics and Evolution 11 (2011) 2119–2124 Table 1 Primers used for the molecular characterization of HPV-16 and HPV-18 L1 gene.
HPV-16 L1 PCR Fragment 1 Fragment 2 HPV-18 L1 PCR Fragment 1 Fragment 2
Primer name
Sequence 50 ? 30
Gene
Amplicon size (bp)
References
L1_16_1F L1_16_1R L1_16_2F L1_16_2R
ATGTCTCTTTGGCTGCCTAG GCATCAGAGGTAACCATAGAAC CTATGGACTTTACTACATTACAGGCTA GTTTAGCAGTTGTAGAGGTAGATGA
L1
911
This study
L1
879
L1_18_1F L1_18_1R L1_18_2F L1_18_2R
ATGGCTWTGTGGCGGCCTAG GAGTCAGAGGTAACAATAGAGC CCAYGGRCTTTAGTACATTGCAAGATA GTTTAGAAGACGTAGYGGCAGATGG
L1
910
L1
869
tions (Table 2S). Of the 18 non synonymous mutations, 7 (38.9%) occurred in sequences encoding immunodominant loops. Specifically, three mutations in the FG loop gene sequence resulted in amino acid substitutions at residues 292 (alanine to threonine), 296 (asparagine to threonine), and 307 (glycine to tryptophan); two mutations present in the DE loop sequence resulted in amino
This study
acid changes at residues 165 (alanine to glutamic acid) and 139 (leucine to serine); and one mutation present in the BC loop sequence resulted in an amino acid change at residue 77 (proline to serine) and one in the HI loop sequence resulted in an amino acid change at residue 378 (threonine to isoleucine) (Fig. 1). Only one amino acid mutation occurred in the sequence encoding the
Fig. 1. Neighbor joining phylogenetic tree generated using nucleotide sequences of L1 HPV-16 gene. Study sequences are labeled in black and major amino acid changes are reported in block letters.
2122
E. Frati et al. / Infection, Genetics and Evolution 11 (2011) 2119–2124
a-4 domain at residue 440 (leucine to valine), an important domain critical to VLP conformation integrity (Bishop et al., 2007). Insertion and deletion events were not identified and there was no evidence of premature stop codons or nucleotide deletions in the L1 HPV-16 sequences analyzed. 3.2. Selective pressure analysis of the L1 HPV-16 gene There was no evidence of positive selection in the sequence alignment of L1 HPV-16 gene (P-value < 0.1). The [dN dS (±S.E.)] value was [0.007 (±0.002)]. The integrative selection analysis (SLAC P-value = 0.1; FEL P-value = 0.1 and REL BF = 50) identified 16 negatively selected codons, none within the immunodominant epitopes. Only one amino acid mutation from glutamic acid to aspartic acid in position 266 observed in sequence MI_518_05 (GenBank Accession number: JF728173) fell into negative selected codon. 3.3. Phylogenetic analysis of L1 HPV-18 sequences LI HPV-18 sequences were determined and analyzed by aligning the L1 1,386 nucleotide sequences from all viral strains (n = 20) (including the reference sequence). HPV-18 L1 sequences fell into two principal phylogenetic branches (Fig. 2). Specifically, 4/5 belonged to the HPV-18 European branch (99.5–100% similarity) and 1/5 belonged to the HPV-18 African branch (99.8% similarity) and nine single nucleotide changes were observed (Table 3S). Of these, six were present in the HPV-18 European branch and three within the African branch. Specifically, 5/9 mutations were synonymous and 4/9 were non synonymous. Only one amino acid mutation was identified within a sequence encoding for an immunodominant loop (loop FG) at residue 338 (isoleucine to leucine). This mutation was found in sequence MI_430_09 (GenBank Accession number: JF728185), HPV-18 European branch. No amino acid changes were observed in the sequences belonging to African branch. Insertion and deletion events were not present and there was no evidence of premature stop codons or nucleotide deletions within the L1 HPV-18 analyzed sequences.
3.4. Selective pressure analysis of the L1 HPV-18 gene There was no evidence of positive selection in the sequence alignment of L1 HPV-18 gene sequences examined (P-value < 0.1). The [dN dS (±S.E.)] value was [0.015 (±0.004)]. In particular, the [dN dS (±S.E.)] value was [0.011 (±0.004)] in European branch sequences and [0.001 (±0.002)] in African branch sequences. 4. Discussion Oncogenic HPV infection is the necessary cause of cervical cancer. Approximately 73% of invasive cervical cancer cases worldwide are associated with either HPV-16 or HPV-18, with HPV-16 being the most common type (57% of cases), followed by HPV-18 (16% of cases). (Li et al., 2011). Several studies have provided evidence demonstrating that specific intratype HPV-16 and HPV-18 genome variations may be relevant to virus infectivity and pathogenicity (Hildesheim et al., 2001; Pista et al., 2007). These variations may influence viral persistence and progression to invasive cancer that partly explains the wide spectrum of pathologies resulting from these infections and the high prevalence rates of cervical cancer in some countries/populations compared to others. Amino acid substitutions resulting from mutations to viral genome sequences may affect viral assembly, carcinogenic potential and host immune responses. Moreover, it is still not known whether immunity to one HPV variant can protect against infection by another. Therefore, identification of HPV genetic diversity in specific clinical settings may be important for the rational design of diagnostic, therapeutic and vaccine strategies (Stewart et al., 1996). Since the HPV L1 protein represents the major HPV capsid protein, we analyzed the genetic variability of HPV-16 and HPV-18 L1 gene region over a span of 1,300 nucleotides encoding both linear and conformational epitopes responsible for eliciting the generation of type-specific, neutralizing, antibody-mediated immune response (Kirnbauer et al., 1992). Specifically, molecular characterization of 29 HPV-16 and 5 HPV-18 L1 sequences was performed. As expected, European HPV-16 and HPV-18 variants were significantly more frequently identified (33/34, 97%). Indeed, HPV-
Fig. 2. Neighbor joining phylogenetic tree generated using nucleotide sequences of L1 HPV-18 gene. Study sequences are labeled in black and major amino acid changes are reported in block letters.
E. Frati et al. / Infection, Genetics and Evolution 11 (2011) 2119–2124
16 L1 sequences in this study showed variation typical of European branch isolates, presenting with 99.4–99.7% similarity. One HPV18 L1 sequence fell into the African branch (99.8% similarity), and all the other sequences belonged to the European branch (99.5–100% similarity). Eighteen amino acid variations (52.9%) within the HPV-16 L1 and four (44.5%) within the HPV-18 L1 gene were identified. Eight mutations were present in sequences encoding the immunodominat epitope loop (seven for HPV-16 and one for HPV-18). Only one amino acid mutation (T378I, loop HI) was previously observed (Pista et al., 2007). Amino acid alterations of L1 and, in particular, in the immunodominant epitope loop could affect infection efficiency or alter viral antigenicity. Furthermore, polymorphisms within hypervariable L1 loops could have been the result of host immune response selective pressure. The average dN dS value of HPV-16 and HPV-18 L1 were less than 1 (0.007 ± 0.002 and 0.011 ± 0.004, respectively), indicating that these sequences are under strong purifying selective pressure. Moreover, the low rate of change could be attributed to the fact that HPV uses the host cell’s DNA replication machinery that is characterized by high fidelity, proofreading capacity and post replication repair mechanisms. In addition, many core functions of HPV-encoded proteins are required for the vegetative viral life cycle. These functions (e.g., viral capsid structure formation) result in selection that limits the actual number of possible evolutionary events. The primary limitation of the present study was the small sample size analyzed. However, to the best of our knowledge, this is the first study examining both HPV-16 and -18 variants in Italy considering nearly the complete sequence of the L1 gene. A larger sample size, in particular for HPV-18, will be required to carry out selective pressure analysis with most appropriate tools.
5. Conclusions This analysis identified partial HPV-16 and HPV-18 L1 gene polymorphisms, however, the biological role of these mutations remains unknown. Currently no indication of how these amino acid substitutions could affect host immune responses is apparent. However, it has been recognized that HPV intratype variations represent a distinct risk factor for developing cervical cancer and these mutations could have affected infection efficacy or viral antigenicity. Particular attention should be paid to assessing whether HPV intratypic variants correlate with different clinical outcomes and how well the L1-virus-like particle-based prophylactic vaccines protect against variants. Diverse and comprehensive research efforts will be required to elucidate the biological nature of HPV intratypic variations and their relative risk in causing disease. New data regarding HPV-16 and HPV-18 L1 gene diversity may help us understand the oncogenic potential of respective viral strains and how these polymorphisms can affect the host response following infection or vaccination. Acknowledgements This work was in part supported by the Italian Ministry of University and Research (MIUR, PRIN-2007. Prot. 20074B5ZBC_002)
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.meegid.2011.06.014.
2123
References Alvarez-Salas, L.M., DiPaolo, J.A., 2007. Molecular approaches to cervical cancer therapy. Curr. Drug. Discov. Technol. 4, 208–219. Bernard, H.U., 2002. Gene expression of genital human papillomaviruses and considerations on potential antiviral approaches. Antivir. Ther. 7, 219–237. Bernard, H.U., Burk, R.D., Chen, Z., van Doorslaer, K., zur Hausen, H., de Villiers, E.M., 2010. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology 401, 70–79. Bishop, B., Dasgupta, J., Klein, M., Garcea, R.L., Christensen, N.D., Zhao, R., Chen, X.S., 2007. Crystal structures of four types of human papillomavirus L1 capsid proteins: understanding the specificity of neutralizing monoclonal antibodies. J. Biol. Chem. 282, 31803–31811. Bosch, F.X., Lorincz, A., Munoz, N., Meijer, C.J., Shah, K.V., 2002. The causal relation between human papillomavirus and cervical cancer. J. Clin. Pathol. 55, 244–265. Carter, J.J., Wipf, G.C., Madeleine, M.M., Schwartz, S.M., Koutsky, L.A., Galloway, D.A., 2006. Identification of human papillomavirus type 16 L1 surface loops required for neutralization by human sera. J. Virol. 80, 4664–4672. Chen, Z., DeSalle, R., Schiffman, M., Herrero, R., Burk, R.D., 2009. Evolutionary dynamics of variant genomes of human papillomavirus types 18, 45, and 97. J. Virol. 83, 1443–1455. Chen, Z., Terai, M., Fu, L., Herrero, R., DeSalle, R., Burk, R.D., 2005. Diversifying selection in human papillomavirus type 16 lineages based on complete genome analyses. J. Virol. 79, 7014–7023. Chen, X.S., Garcea, R.L., Goldberg, I., Casini, G., Harrison, S.C., 2000. Structure of small virus-like particles assembled from the L1 protein of human papillomavirus 16. Mol. Cell. 5, 557–567. Christensen, N.D., Cladel, N.M., Reed, C.A., Budgeon, L.R., Embers, M.E., Skulsky, D.M., McClements, W.L., Ludmerer, S.W., Jansen, K.U., 2001. Hybrid papillomavirus L1 molecules assemble into virus-like particles that reconstitute conformational epitopes and induce neutralizing antibodies to distinct HPV types. Virology 291, 324–334. Christensen, N.D., Dillner, J., Eklund, C., Carter, J.J., Wipf, G.C., Reed, C.A., Cladel, N.M., Galloway, D.A., 1996. Surface conformational and linear epitopes on HPV-16 and HPV-18 L1 virus-like particles as defined by monoclonal antibodies. Virology 223, 174–184. Christensen, N.D., Kreider, J.W., 1990. Antibody-mediated neutralization in vivo of infectious papillomaviruses. J. Virol. 64, 3151–3156. Danos, O., Katinka, M., Yaniv, M., 1982. Human papillomavirus 1a complete DNA sequence. a novel type of genome organization among papovaviridae. Embo J. 1, 231–236. de Villiers, E.M., Fauquet, C., Broker, T.R., Bernard, H.U., zur Hausen, H., 2004. Classification of papillomaviruses. Virology 324, 17–27. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Gagnon, S., Hankins, C., Money, D., Pourreaux, K., Franco, E., Coutlee, F., 2007. Polymorphism of the L1 capsid gene and persistence of human papillomavirus type 52 infection in women at high risk or infected by HIV. J. Acquir. Immune Defic. Syndr. 44, 61–65. Hildesheim, A., Schiffman, M., Bromley, C., Wacholder, S., Herrero, R., Rodriguez, A., Bratti, M.C., Sherman, M.E., Scarpidis, U., Lin, Q.Q., Terai, M., Bromley, R.L., Buetow, K., Apple, R.J., Burk, R.D., 2001. Human papillomavirus type 16 variants and risk of cervical cancer. J. Natl. Cancer Inst. 93, 315–318. Ho, G.Y., Bierman, R., Beardsley, L., Chang, C.J., Burk, R.D., 1998. Natural history of cervicovaginal papillomavirus infection in young women. N. Engl. J. Med. 338, 423–428. Icenogle, J.P., Clancy, K.A., Lin, S.Y., 1995. Sequence variation in the capsid protein genes of human papillomavirus type 16 and type 31. Virology 214, 664–669. Jukes, T.H., Cantor, C.R., 1969. Evolution of protein molecules. In: Munro, H.N. (Ed.), Mammalian Protein Metabolism. Academic Press, New York, pp. 21–132. Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Kirnbauer, R., Booy, F., Cheng, N., Lowy, D.R., Schiller, J.T., 1992. Papillomavirus L1 major capsid protein self-assembles into virus-like particles that are highly immunogenic. Proc. Natl. Acad. Sci. USA 89, 12180–12184. Li, N., Franceschi, S., Howell-Jones, R., Snijders, P.J.F., Clifford, G.M., 2011. Human papillomavirus type distribution in 30,848 invasive cervical cancers worldwide: variation by geographical region, histological type and year of publication. Int. J. Cancer 128, 927–935. Moscicki, A.B., Smith, J.S., 2008. Issues in human papillomavirus vaccination in adolescents. J. Adolesc. Health 43, S1–4. Nei, M., Gojobori, T., 1986. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3, 418–426. Olcese, V.A., Chen, Y., Schlegel, R., Yuan, H., 2004. Characterization of HPV16 L1 loop domains in the formation of a type-specific, conformational epitope. BMC Microbiol. 4, 29. Ong, C.K., Chan, S.Y., Campo, M.S., Fujinaga, K., Mavromara-Nazos, P., Labropoulou, V., Pfister, H., Tay, S.K., ter Meulen, J., Villa, L.L., et al., 1993. Evolution of human papillomavirus type 18: an ancient phylogenetic root in Africa and intratype diversity reflect coevolution with human ethnic groups. J. Virol. 67, 6424–6431. Pastrana, D.V., Vass, W.C., Lowy, D.R., Schiller, J.T., 2001. NHPV16 VLP vaccine induces human antibodies that neutralize divergent variants of HPV16. Virology 279, 361–369.
2124
E. Frati et al. / Infection, Genetics and Evolution 11 (2011) 2119–2124
Pista, A., Oliveira, A., Barateiro, A., Costa, H., Verdasca, N., Paixao, M.T., 2007. Molecular variants of human papillomavirus type 16 and 18 and risk for cervical neoplasia in Portugal. J. Med. Virol. 79, 1889–1897. Raiol, T., Wyant, P.S., de Amorim, R.M., Cerqueira, D.M., Milanezi, N.G., Brigido Mde, M., Sichero, L., Martins, C.R., 2009. Genetic variability and phylogeny of the high-risk HPV-31, -33, -35, -52, and -58 in central Brazil. J. Med. Virol. 81, 685– 692. Roden, R.B., Armstrong, A., Haderer, P., Christensen, N.D., Hubbert, N.L., Lowy, D.R., Schiller, J.T., Kirnbauer, R., 1997. Characterization of a human papillomavirus type 16 variant-dependent neutralizing epitope. J. Virol. 71, 6247–6252. Saitou, N., Nei, M., 1987. The Neighbor-Joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Stewart, A.C., Eriksson, A.M., Manos, M.M., Munoz, N., Bosch, F.X., Peto, J., Wheeler, C.M., 1996. Intratype variation in 12 human papillomavirus types: a worldwide perspective. J. Virol. 70, 3127–3136. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.
Varsani, A., Williamson, A.L., Jaffer, M.A., Rybicki, E.P., 2006. A deletion and point mutation study of the human papillomavirus type 16 major capsid gene. Virus Res. 122, 154–163. Wheeler, C.M., Yamada, T., Hildesheim, A., Jenison, S.A., 1997. Human papillomavirus type 16 sequence variants: identification by E6 and L1 lineage-specific hybridization. J. Clin. Microbiol. 35, 11–19. White, W.I., Wilson, S.D., Bonnez, W., Rose, R.C., Koenig, S., Suzich, J.A., 1998. In vitro infection and type-restricted antibody-mediated neutralization of authentic human papillomavirus type 16. J. Virol. 72, 959–964. Yamada, T., Manos, M.M., Peto, J., Greer, C.E., Munoz, N., Bosch, F.X., Wheeler, C.M., 1997. Human papillomavirus type 16 sequence variation in cervical cancers: a worldwide perspective. J. Virol. 71, 2463–2472. Yamada, T., Wheeler, C.M., Halpern, A.L., Stewart, A.C., Hildesheim, A., Jenison, S.A., 1995. Human papillomavirus type 16 variant lineages in United States populations characterized by nucleotide sequence analysis of the E6, L2, and L1 coding segments. J. Virol. 69, 7743–7753.
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
Genetic variability in the major capsid L1 protein of human papillomavirus type 16 (HPV-16) and 18 (HPV-18) E. Frati a, S. Bianchi a, D. Colzani a, A. Zappa a, G. Orlando b, E. Tanzi a,c,⇑ a
Dipartimento di Sanità Pubblica-Microbiologia-Virologia, Università degli Studi di Milano, Via C. Pascal 36, 20133 Milan, Italy STD Unit, II Division Infectious Diseases, L. Sacco University Hospital, Via G.B. Grassi 47, 20157 Milan, Italy c CIRI-IV, Dipartimento di Scienze della Salute, Università degli Studi di Genova, Via Pastore 1, 16132 Genova, Italy b
a r t i c l e
i n f o
Article history: Available online 26 June 2011 Keywords: HPV-16 HPV-18 L1 capsid protein Immunodominant epitopes Intratypic variants Cervical cancer
a b s t r a c t HPV-16 and HPV-18 infections result in nearly 73% of cervical cancers worldwide. The L1 protein comprising HPV vaccine formulations elicit high-titre neutralizing antibodies. The aim of this study was to detect L1 HPV-16 and HPV-18 gene polymorphisms and analyze intratypic variations. HPV-16 (n = 29) and HPV-18 (n = 5) L1 gene sequences were obtained from cervical samples harvested from Italian women. Phylogenetic trees were constructed using the Neighbor-Joining and the Kimura 2-parameters methods (MEGA software). To estimate selection pressures acting on the L1 gene, codon-specific nonsynonymous (dN) and synonymous (dS) substitutions were inferred using the Nei–Gojobori method and Jukes–Cantor model (MEGA software) and integrated analyses carried out using SLAC, FEL and REL methodologies. All the HPV-16 L1 sequences analyzed fell into the European branch (99.4–99.7% similarity). Thirty-four single nucleotide changes were observed and 18 (52.9%) were non-synonymous mutations (7/18 were identified in sequences encoding an immunodominant loop and one occurred in the sequence encoding the a-4 domain associated with VLP conformation). There was no evidence of positive selection in the sequence alignment of L1 HPV-16 genes (P-value < 0.1). One mutation was identified in a negatively selected codon. HPV-18 L1 analyzed sequences fell into two phylogenetic branches: the HPV18 European branch (99.5–100% similarity) and the HPV-18 African branch (99.8% similarity). Nine single nucleotide changes were observed and 4/9 (44.5%) of these nucleotide mutations were non-synonymous and one was present in a sequence encoding the immunodominant FG loop. There was no evidence of positive selection in the sequence alignment of L1 HPV-18 genes (P-value < 0.1). This study identified polymorphisms of undefined biological activity in HPV-16 and HPV-18 L1 sequences. Information regarding the genetic diversity of HPV-16 and HPV-18 L1 gene sequences may help define the oncogenic potential of respective strains and to better understand immune escape mechanisms. Ó 2011 Elsevier B.V. All rights reserved.
1. Introduction Human papillomaviruses (HPVs) are a heterogeneous group of double-stranded DNA viruses with a genome consisting of up to eight genes classified as either ‘‘early’’ (E1–E2, E4–E7) or ‘‘late’’ (L1 and L2) genes based on temporal expression (Danos et al., 1982). HPV is recognized as the etiological agent of cervical cancer (Bosch et al., 2002). More than 120 distinct HPV genotypes have the potential of infecting mucosal and cutaneous human epithelial cells. The 40 mucosal HPV genotypes are classified into low- and high-risk types, depending on their association with cervical intraepithelial neoplasia and cancer (Bernard et al., 2010). ⇑ Corresponding author at: Dipartimento di Sanità Pubblica-Microbiologia-Virologia, Università degli Studi di Milano, Via C. Pascal 36, 20133 Milan, Italy. Tel.: +39 0250315139; fax: +39 0250315120. E-mail address: [email protected] (E. Tanzi). 1567-1348/$ - see front matter Ó 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.meegid.2011.06.014
Pentamers of the major late protein (L1) can self-assemble into empty capsids, referred as virus like particles (VLPs) (Bishop et al., 2007), which are components used in the design of prophylactic vaccines. The two currently available prophylactic L1 VLPs vaccines are able to effectively induce higher levels of type-specific neutralizing antibodies than those induced within natural infections and cell-mediated immunity, resulting in protection against persistent infection and associated cervical neoplasia attributable to HPV vaccine types (Bishop et al., 2007; Moscicki and Smith, 2008). Despite the ongoing vaccine trials, little is known about the variability of the viral L1 immunodominant epitopes that should be recognized by the neutralizing vaccine-induced antibodies. Crystallographic studies have been used to define specific loop structures present on the surface of assembled capsids (Chen et al., 2000) and have identified five hypervariable immunodominant regions (named BC, DE, EF, FG, and HI loops), each ranging between 10 and 30 amino acids in length and located within
2120
E. Frati et al. / Infection, Genetics and Evolution 11 (2011) 2119–2124
surface-exposed loops (Christensen et al., 1996; Christensen and Kreider, 1990; Olcese et al., 2004; White et al., 1998). HPV L1 loops exhibit considerable polymorphism within and between HPV types (Carter et al., 2006; Christensen et al., 2001; Olcese et al., 2004), resulting in the generation of neutralizing antibodies of different binding affinities (Varsani et al., 2006). L1 polymorphisms likely play a role in mediating escape from neutralization antibody responses since non synonymous variations are localized closely to neutralizing epitopes (Pastrana et al., 2001; Roden et al., 1997). Despite these important observations, there is limited information regarding L1 gene polymorphisms (Gagnon et al., 2007; Icenogle et al., 1995; Raiol et al., 2009; Stewart et al., 1996; Yamada et al., 1995) even though L1 sequence analyses have been used to classify HPV isolates into either genera, species, types, subtypes and variants (de Villiers et al., 2004). The Papillomavirus Nomenclature Committee has established that HPV genomes be classified into molecular variants when they present with more than 98% similarity to the prototype L1 gene sequence (Bernard, 2002; Bernard et al., 2010; de Villiers et al., 2004; Yamada et al., 1995). HPV evolutionary analysis has identified the African origin of the virus (Alvarez-Salas and DiPaolo, 2007) and its dissemination throughout the world. HPV-16 and -18 are the HPV types associated with the highest risk of cervical cancer, accounting for nearly 57% and 16%, respectively, of all cervical cancers reported worldwide (Li et al., 2011). HPV-16 variants can be classified phylogenetically and are distributed differentially within the five continents and within different ethnic groups. These variants include the European (E), the Asian (As), the Asian-American (AA), that also includes the North-American (NA1) variant; the African type 1 (Af1) and type 2 (Af2) variants (Chen et al., 2005; Ho et al., 1998; Wheeler et al., 1997; Yamada et al., 1995). E and As variant branches are closely related, such that As variant can be considered a subclass of the E variant branch (Yamada et al., 1997). For HPV-18, different variants have been defined as Asian-American (AA), the African (Af), the European (E) variants (Chen et al., 2009; Ong et al., 1993). Comparative nucleotide sequence analyses of these viruses have assisted in the elucidation of their respective phylogenetic relationships. In addition, HPV intratype variability analysis has also been used as an important tool in epidemiological studies designed to define viral transmission patterns, viral persistence and progression to clinically relevant cervical lesions. To date, there are little data regarding the functional significance and the molecular epidemiology of HPV variants. The purpose of this study was to identify nucleotide polymorphisms within the L1 gene of HPV-16 and HPV-18 sequences collected in Italy and to analyze intratypic variations. 2. Materials and methods 2.1. Study sequences HPV-16 (n = 29) and HPV-18 (n = 5) sequences obtained from cervical swabs of Italian HPV-infected women were used for molecular characterization by sequence analysis of the L1 gene. 2.2. Nucleic acid extraction and sequencing amplification Nucleic acids were extracted from cervical samples using a NucliSENSÒ miniMAGÒ kit (bioMérieux Clinical Diagnostics, France). Molecular characterization was performed by sequence analysis of a 1,488 bp L1 gene amplicon (nucleotides 5,613–7,101 of HPV-16 European prototype, AF536179) for HPV-16 and a 1,489 bp L1 gene amplicon (nucleotides 5,613–7,101 of HPV-18 European prototype sequence, X05015) for HPV-18.
Partial HPV-16 and HPV-18 L1 gene sequences were amplified using degenerate primer pairs (Table 1). Two partially overlapping fragments for each virus were amplified. The amplification of the fragments was performed using 1 lg extracted DNA as template and reactions carried out in 50 ll reaction volumes containing 5X PCR Buffer, 200 lM dNTPs, 30 pmol of each primer and 1 U Taq (GoTaqÒ DNA Polymerase 5 U/ll Promega, Madison WI). The cycling conditions were as follows: 94 °C for 5 min followed by 40 cycles at 94 °C for 30 sec, 55 °C for 1 min (HPV-16) or 60 °C for 1 min (HPV-18), 72 °C for 1 min and a final 72 °C extension for 7 min. Amplicons were visualized on 2% agarose gels stained with ethidium bromide. Following PCR amplification of the L1 gene, amplicons were purified using NucleoSpinÒ Extract II (Macherey-Nagel GmbH, Germany) and nucleotide sequences were obtained following automated DNA sequencing using an ABI PRISM 3100 genetic analyzer (Applied Biosystem, CA, USA). 2.3. Molecular characterization and phylogenetic analysis Multiple L1 gene nucleotide sequences were aligned using ClustalX, version 2.0. Phylogenetic trees of respective HPV-16 and HPV-18 L1 sequences were constructed using the Neighbor-Joining method (Saitou and Nei, 1987) and the Kimura 2-Parameter model (Kimura, 1980) using the MEGA package, version 4.1 (Tamura et al., 2007). A bootstrap re-sampling analysis was performed (1,000 replicates) to test tree robustness (Felsenstein, 1985). The HPV16 and HPV-18 L1 gene sequences of the viral strains studied were deposited into NCBI GenBank Database [
2121
E. Frati et al. / Infection, Genetics and Evolution 11 (2011) 2119–2124 Table 1 Primers used for the molecular characterization of HPV-16 and HPV-18 L1 gene.
HPV-16 L1 PCR Fragment 1 Fragment 2 HPV-18 L1 PCR Fragment 1 Fragment 2
Primer name
Sequence 50 ? 30
Gene
Amplicon size (bp)
References
L1_16_1F L1_16_1R L1_16_2F L1_16_2R
ATGTCTCTTTGGCTGCCTAG GCATCAGAGGTAACCATAGAAC CTATGGACTTTACTACATTACAGGCTA GTTTAGCAGTTGTAGAGGTAGATGA
L1
911
This study
L1
879
L1_18_1F L1_18_1R L1_18_2F L1_18_2R
ATGGCTWTGTGGCGGCCTAG GAGTCAGAGGTAACAATAGAGC CCAYGGRCTTTAGTACATTGCAAGATA GTTTAGAAGACGTAGYGGCAGATGG
L1
910
L1
869
tions (Table 2S). Of the 18 non synonymous mutations, 7 (38.9%) occurred in sequences encoding immunodominant loops. Specifically, three mutations in the FG loop gene sequence resulted in amino acid substitutions at residues 292 (alanine to threonine), 296 (asparagine to threonine), and 307 (glycine to tryptophan); two mutations present in the DE loop sequence resulted in amino
This study
acid changes at residues 165 (alanine to glutamic acid) and 139 (leucine to serine); and one mutation present in the BC loop sequence resulted in an amino acid change at residue 77 (proline to serine) and one in the HI loop sequence resulted in an amino acid change at residue 378 (threonine to isoleucine) (Fig. 1). Only one amino acid mutation occurred in the sequence encoding the
Fig. 1. Neighbor joining phylogenetic tree generated using nucleotide sequences of L1 HPV-16 gene. Study sequences are labeled in black and major amino acid changes are reported in block letters.
2122
E. Frati et al. / Infection, Genetics and Evolution 11 (2011) 2119–2124
a-4 domain at residue 440 (leucine to valine), an important domain critical to VLP conformation integrity (Bishop et al., 2007). Insertion and deletion events were not identified and there was no evidence of premature stop codons or nucleotide deletions in the L1 HPV-16 sequences analyzed. 3.2. Selective pressure analysis of the L1 HPV-16 gene There was no evidence of positive selection in the sequence alignment of L1 HPV-16 gene (P-value < 0.1). The [dN dS (±S.E.)] value was [0.007 (±0.002)]. The integrative selection analysis (SLAC P-value = 0.1; FEL P-value = 0.1 and REL BF = 50) identified 16 negatively selected codons, none within the immunodominant epitopes. Only one amino acid mutation from glutamic acid to aspartic acid in position 266 observed in sequence MI_518_05 (GenBank Accession number: JF728173) fell into negative selected codon. 3.3. Phylogenetic analysis of L1 HPV-18 sequences LI HPV-18 sequences were determined and analyzed by aligning the L1 1,386 nucleotide sequences from all viral strains (n = 20) (including the reference sequence). HPV-18 L1 sequences fell into two principal phylogenetic branches (Fig. 2). Specifically, 4/5 belonged to the HPV-18 European branch (99.5–100% similarity) and 1/5 belonged to the HPV-18 African branch (99.8% similarity) and nine single nucleotide changes were observed (Table 3S). Of these, six were present in the HPV-18 European branch and three within the African branch. Specifically, 5/9 mutations were synonymous and 4/9 were non synonymous. Only one amino acid mutation was identified within a sequence encoding for an immunodominant loop (loop FG) at residue 338 (isoleucine to leucine). This mutation was found in sequence MI_430_09 (GenBank Accession number: JF728185), HPV-18 European branch. No amino acid changes were observed in the sequences belonging to African branch. Insertion and deletion events were not present and there was no evidence of premature stop codons or nucleotide deletions within the L1 HPV-18 analyzed sequences.
3.4. Selective pressure analysis of the L1 HPV-18 gene There was no evidence of positive selection in the sequence alignment of L1 HPV-18 gene sequences examined (P-value < 0.1). The [dN dS (±S.E.)] value was [0.015 (±0.004)]. In particular, the [dN dS (±S.E.)] value was [0.011 (±0.004)] in European branch sequences and [0.001 (±0.002)] in African branch sequences. 4. Discussion Oncogenic HPV infection is the necessary cause of cervical cancer. Approximately 73% of invasive cervical cancer cases worldwide are associated with either HPV-16 or HPV-18, with HPV-16 being the most common type (57% of cases), followed by HPV-18 (16% of cases). (Li et al., 2011). Several studies have provided evidence demonstrating that specific intratype HPV-16 and HPV-18 genome variations may be relevant to virus infectivity and pathogenicity (Hildesheim et al., 2001; Pista et al., 2007). These variations may influence viral persistence and progression to invasive cancer that partly explains the wide spectrum of pathologies resulting from these infections and the high prevalence rates of cervical cancer in some countries/populations compared to others. Amino acid substitutions resulting from mutations to viral genome sequences may affect viral assembly, carcinogenic potential and host immune responses. Moreover, it is still not known whether immunity to one HPV variant can protect against infection by another. Therefore, identification of HPV genetic diversity in specific clinical settings may be important for the rational design of diagnostic, therapeutic and vaccine strategies (Stewart et al., 1996). Since the HPV L1 protein represents the major HPV capsid protein, we analyzed the genetic variability of HPV-16 and HPV-18 L1 gene region over a span of 1,300 nucleotides encoding both linear and conformational epitopes responsible for eliciting the generation of type-specific, neutralizing, antibody-mediated immune response (Kirnbauer et al., 1992). Specifically, molecular characterization of 29 HPV-16 and 5 HPV-18 L1 sequences was performed. As expected, European HPV-16 and HPV-18 variants were significantly more frequently identified (33/34, 97%). Indeed, HPV-
Fig. 2. Neighbor joining phylogenetic tree generated using nucleotide sequences of L1 HPV-18 gene. Study sequences are labeled in black and major amino acid changes are reported in block letters.
E. Frati et al. / Infection, Genetics and Evolution 11 (2011) 2119–2124
16 L1 sequences in this study showed variation typical of European branch isolates, presenting with 99.4–99.7% similarity. One HPV18 L1 sequence fell into the African branch (99.8% similarity), and all the other sequences belonged to the European branch (99.5–100% similarity). Eighteen amino acid variations (52.9%) within the HPV-16 L1 and four (44.5%) within the HPV-18 L1 gene were identified. Eight mutations were present in sequences encoding the immunodominat epitope loop (seven for HPV-16 and one for HPV-18). Only one amino acid mutation (T378I, loop HI) was previously observed (Pista et al., 2007). Amino acid alterations of L1 and, in particular, in the immunodominant epitope loop could affect infection efficiency or alter viral antigenicity. Furthermore, polymorphisms within hypervariable L1 loops could have been the result of host immune response selective pressure. The average dN dS value of HPV-16 and HPV-18 L1 were less than 1 (0.007 ± 0.002 and 0.011 ± 0.004, respectively), indicating that these sequences are under strong purifying selective pressure. Moreover, the low rate of change could be attributed to the fact that HPV uses the host cell’s DNA replication machinery that is characterized by high fidelity, proofreading capacity and post replication repair mechanisms. In addition, many core functions of HPV-encoded proteins are required for the vegetative viral life cycle. These functions (e.g., viral capsid structure formation) result in selection that limits the actual number of possible evolutionary events. The primary limitation of the present study was the small sample size analyzed. However, to the best of our knowledge, this is the first study examining both HPV-16 and -18 variants in Italy considering nearly the complete sequence of the L1 gene. A larger sample size, in particular for HPV-18, will be required to carry out selective pressure analysis with most appropriate tools.
5. Conclusions This analysis identified partial HPV-16 and HPV-18 L1 gene polymorphisms, however, the biological role of these mutations remains unknown. Currently no indication of how these amino acid substitutions could affect host immune responses is apparent. However, it has been recognized that HPV intratype variations represent a distinct risk factor for developing cervical cancer and these mutations could have affected infection efficacy or viral antigenicity. Particular attention should be paid to assessing whether HPV intratypic variants correlate with different clinical outcomes and how well the L1-virus-like particle-based prophylactic vaccines protect against variants. Diverse and comprehensive research efforts will be required to elucidate the biological nature of HPV intratypic variations and their relative risk in causing disease. New data regarding HPV-16 and HPV-18 L1 gene diversity may help us understand the oncogenic potential of respective viral strains and how these polymorphisms can affect the host response following infection or vaccination. Acknowledgements This work was in part supported by the Italian Ministry of University and Research (MIUR, PRIN-2007. Prot. 20074B5ZBC_002)
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.meegid.2011.06.014.
2123
References Alvarez-Salas, L.M., DiPaolo, J.A., 2007. Molecular approaches to cervical cancer therapy. Curr. Drug. Discov. Technol. 4, 208–219. Bernard, H.U., 2002. Gene expression of genital human papillomaviruses and considerations on potential antiviral approaches. Antivir. Ther. 7, 219–237. Bernard, H.U., Burk, R.D., Chen, Z., van Doorslaer, K., zur Hausen, H., de Villiers, E.M., 2010. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology 401, 70–79. Bishop, B., Dasgupta, J., Klein, M., Garcea, R.L., Christensen, N.D., Zhao, R., Chen, X.S., 2007. Crystal structures of four types of human papillomavirus L1 capsid proteins: understanding the specificity of neutralizing monoclonal antibodies. J. Biol. Chem. 282, 31803–31811. Bosch, F.X., Lorincz, A., Munoz, N., Meijer, C.J., Shah, K.V., 2002. The causal relation between human papillomavirus and cervical cancer. J. Clin. Pathol. 55, 244–265. Carter, J.J., Wipf, G.C., Madeleine, M.M., Schwartz, S.M., Koutsky, L.A., Galloway, D.A., 2006. Identification of human papillomavirus type 16 L1 surface loops required for neutralization by human sera. J. Virol. 80, 4664–4672. Chen, Z., DeSalle, R., Schiffman, M., Herrero, R., Burk, R.D., 2009. Evolutionary dynamics of variant genomes of human papillomavirus types 18, 45, and 97. J. Virol. 83, 1443–1455. Chen, Z., Terai, M., Fu, L., Herrero, R., DeSalle, R., Burk, R.D., 2005. Diversifying selection in human papillomavirus type 16 lineages based on complete genome analyses. J. Virol. 79, 7014–7023. Chen, X.S., Garcea, R.L., Goldberg, I., Casini, G., Harrison, S.C., 2000. Structure of small virus-like particles assembled from the L1 protein of human papillomavirus 16. Mol. Cell. 5, 557–567. Christensen, N.D., Cladel, N.M., Reed, C.A., Budgeon, L.R., Embers, M.E., Skulsky, D.M., McClements, W.L., Ludmerer, S.W., Jansen, K.U., 2001. Hybrid papillomavirus L1 molecules assemble into virus-like particles that reconstitute conformational epitopes and induce neutralizing antibodies to distinct HPV types. Virology 291, 324–334. Christensen, N.D., Dillner, J., Eklund, C., Carter, J.J., Wipf, G.C., Reed, C.A., Cladel, N.M., Galloway, D.A., 1996. Surface conformational and linear epitopes on HPV-16 and HPV-18 L1 virus-like particles as defined by monoclonal antibodies. Virology 223, 174–184. Christensen, N.D., Kreider, J.W., 1990. Antibody-mediated neutralization in vivo of infectious papillomaviruses. J. Virol. 64, 3151–3156. Danos, O., Katinka, M., Yaniv, M., 1982. Human papillomavirus 1a complete DNA sequence. a novel type of genome organization among papovaviridae. Embo J. 1, 231–236. de Villiers, E.M., Fauquet, C., Broker, T.R., Bernard, H.U., zur Hausen, H., 2004. Classification of papillomaviruses. Virology 324, 17–27. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Gagnon, S., Hankins, C., Money, D., Pourreaux, K., Franco, E., Coutlee, F., 2007. Polymorphism of the L1 capsid gene and persistence of human papillomavirus type 52 infection in women at high risk or infected by HIV. J. Acquir. Immune Defic. Syndr. 44, 61–65. Hildesheim, A., Schiffman, M., Bromley, C., Wacholder, S., Herrero, R., Rodriguez, A., Bratti, M.C., Sherman, M.E., Scarpidis, U., Lin, Q.Q., Terai, M., Bromley, R.L., Buetow, K., Apple, R.J., Burk, R.D., 2001. Human papillomavirus type 16 variants and risk of cervical cancer. J. Natl. Cancer Inst. 93, 315–318. Ho, G.Y., Bierman, R., Beardsley, L., Chang, C.J., Burk, R.D., 1998. Natural history of cervicovaginal papillomavirus infection in young women. N. Engl. J. Med. 338, 423–428. Icenogle, J.P., Clancy, K.A., Lin, S.Y., 1995. Sequence variation in the capsid protein genes of human papillomavirus type 16 and type 31. Virology 214, 664–669. Jukes, T.H., Cantor, C.R., 1969. Evolution of protein molecules. In: Munro, H.N. (Ed.), Mammalian Protein Metabolism. Academic Press, New York, pp. 21–132. Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Kirnbauer, R., Booy, F., Cheng, N., Lowy, D.R., Schiller, J.T., 1992. Papillomavirus L1 major capsid protein self-assembles into virus-like particles that are highly immunogenic. Proc. Natl. Acad. Sci. USA 89, 12180–12184. Li, N., Franceschi, S., Howell-Jones, R., Snijders, P.J.F., Clifford, G.M., 2011. Human papillomavirus type distribution in 30,848 invasive cervical cancers worldwide: variation by geographical region, histological type and year of publication. Int. J. Cancer 128, 927–935. Moscicki, A.B., Smith, J.S., 2008. Issues in human papillomavirus vaccination in adolescents. J. Adolesc. Health 43, S1–4. Nei, M., Gojobori, T., 1986. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3, 418–426. Olcese, V.A., Chen, Y., Schlegel, R., Yuan, H., 2004. Characterization of HPV16 L1 loop domains in the formation of a type-specific, conformational epitope. BMC Microbiol. 4, 29. Ong, C.K., Chan, S.Y., Campo, M.S., Fujinaga, K., Mavromara-Nazos, P., Labropoulou, V., Pfister, H., Tay, S.K., ter Meulen, J., Villa, L.L., et al., 1993. Evolution of human papillomavirus type 18: an ancient phylogenetic root in Africa and intratype diversity reflect coevolution with human ethnic groups. J. Virol. 67, 6424–6431. Pastrana, D.V., Vass, W.C., Lowy, D.R., Schiller, J.T., 2001. NHPV16 VLP vaccine induces human antibodies that neutralize divergent variants of HPV16. Virology 279, 361–369.
2124
E. Frati et al. / Infection, Genetics and Evolution 11 (2011) 2119–2124
Pista, A., Oliveira, A., Barateiro, A., Costa, H., Verdasca, N., Paixao, M.T., 2007. Molecular variants of human papillomavirus type 16 and 18 and risk for cervical neoplasia in Portugal. J. Med. Virol. 79, 1889–1897. Raiol, T., Wyant, P.S., de Amorim, R.M., Cerqueira, D.M., Milanezi, N.G., Brigido Mde, M., Sichero, L., Martins, C.R., 2009. Genetic variability and phylogeny of the high-risk HPV-31, -33, -35, -52, and -58 in central Brazil. J. Med. Virol. 81, 685– 692. Roden, R.B., Armstrong, A., Haderer, P., Christensen, N.D., Hubbert, N.L., Lowy, D.R., Schiller, J.T., Kirnbauer, R., 1997. Characterization of a human papillomavirus type 16 variant-dependent neutralizing epitope. J. Virol. 71, 6247–6252. Saitou, N., Nei, M., 1987. The Neighbor-Joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Stewart, A.C., Eriksson, A.M., Manos, M.M., Munoz, N., Bosch, F.X., Peto, J., Wheeler, C.M., 1996. Intratype variation in 12 human papillomavirus types: a worldwide perspective. J. Virol. 70, 3127–3136. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.
Varsani, A., Williamson, A.L., Jaffer, M.A., Rybicki, E.P., 2006. A deletion and point mutation study of the human papillomavirus type 16 major capsid gene. Virus Res. 122, 154–163. Wheeler, C.M., Yamada, T., Hildesheim, A., Jenison, S.A., 1997. Human papillomavirus type 16 sequence variants: identification by E6 and L1 lineage-specific hybridization. J. Clin. Microbiol. 35, 11–19. White, W.I., Wilson, S.D., Bonnez, W., Rose, R.C., Koenig, S., Suzich, J.A., 1998. In vitro infection and type-restricted antibody-mediated neutralization of authentic human papillomavirus type 16. J. Virol. 72, 959–964. Yamada, T., Manos, M.M., Peto, J., Greer, C.E., Munoz, N., Bosch, F.X., Wheeler, C.M., 1997. Human papillomavirus type 16 sequence variation in cervical cancers: a worldwide perspective. J. Virol. 71, 2463–2472. Yamada, T., Wheeler, C.M., Halpern, A.L., Stewart, A.C., Hildesheim, A., Jenison, S.A., 1995. Human papillomavirus type 16 variant lineages in United States populations characterized by nucleotide sequence analysis of the E6, L2, and L1 coding segments. J. Virol. 69, 7743–7753.