Genetic variability of new bone induction in mice

Bone Vol. 25, No. 1 July 1999:25–32

Genetic Variability of New Bone Induction in Mice A. MARUSˇIC´,1 V. KATAVIC´,1 D. GRCˇEVIC´,2 and I. K. LUKIC´1 1 Institute for Brain Research and Basic Medical Sciences and 2Department of Physiology and Immunology, Zagreb University School of Medicine, Zagreb, Croatia

hamper the study of genetic regulation in humans. Animal models are thus required to examine the genetic influences on bone mass. In this respect, inbred mouse strains are particularly important because they offer an unlimited source of genetically identical animals.12,41 Recent quantitative trait locus (QLT) analyses indicate that there is a number of specific genetic loci strongly related to the acquisition of peak bone mineral density (BMD) in the mouse,3,21,32,36,42 and that the differences in both bone formation and resorption may be responsible for the differences in BMD among inbred mouse strains.2,10 To further elucidate the phenomena underlying the genetic determinants of bone metabolism, we investigated the osteoinductive response of inbred mice to implants of demineralized bone matrix. The multistep developmental cascade of the new bone induction by bone matrix in extraskeletal sites is reminiscent of embryonic limb bone development. It consists of mesenchymal progenitor cell chemotaxis and proliferation, cartilage differentiation and hypertrophy, angiogenesis and invasion of bone marrow cells, osteoblast differentiation, and formation of new bone that is finally remodeled into an ossicle filled with hematopoietic marrow.34,43,44 In this study, we show that eight inbred strains had different responses to osteoinductive stimuli, indicating that there are significant genetic influences on newly induced endochondral bone formation.

We studied differences in ectopic osteoinduction in eight mouse inbred strains and an outbred strain. Antigen-extracted autolyzed rat bone gelatin was implanted under hind limb muscle fascia of 12-week-old males, and new bone formation was morphologically assessed on serial sections. Four weeks after implantation, less than half of the implants from CBA/J, A/J, BALB/cJ, and C3Hf/Bu mice showed induction of only cartilage. New cartilage was observed in all, and bone and bone marrow in 80% of the implants from AKR/J, C57BL/6J, DBA/2J, and RFM/Rij mice. Volume of the newly formed tissue ranged from 1.3% of the old matrix in A/J strain to 74.6% in DBA/2J strain. Outbred CD1 mice showed only weak cartilage induction. The “good” responders differed among themselves in the volume and type of newly induced tissue: DBA/2J, RFM/Rij, and AKR/J mice had a similar ratio of new bone and cartilage and abundant bone marrow, whereas the predominant newly induced tissue in C57BL/6J mice was cartilage. The pattern of the expression of BMP-2, -4, and -7, alkaline phosphatase, osteocalcin, interferon-g, and granulocyte-macrophage colony-stimulating factor, measured by reverse transcriptase polymerase chain reaction, did not correlate with the type and the quantity of the newly induced tissue. Our results show that adult mice of inbred strains differ not only in the peak bone mass and morphology, but also ability to form new bone after an osteoinductive stimulus. Ectopic osteoinduction may be a useful in vivo model to investigate genetic determinants of endochondral osteogenesis, especially its immunological component. (Bone 25:25–32; 1999) © 1999 by Elsevier Science Inc. All rights reserved.

Materials and Methods Mice Inbred mouse strains used in this study were purchased from certified Croatian laboratory animal breeders12 and maintained in our research colonies. Twelve-week-old males from eight inbred strains (A/J, AKR/J, BALB/cJ, C3Hf/Bu, C57BL/6J, CBA/J, DBA/2J, and RFM/Rij) and an outbred strain (CD1) were used for the study. Mice were maintained in groups of three to four in polycarbonate cages under conditions of 14-h light and 10-h darkness, ambient temperature of 20 6 2°C, and water and pelleted diet (Pliva, Zagreb, Croatia) ad libitum. Maintenance of animals and experimental procedures followed the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Key Words: Bone; Bone morphogenetic proteins; Cytokines; Genetics; Immunological response; Inbred mouse strains; Osteoinduction. Introduction It has been estimated that up to 70% of the variability in bone mass in humans is genetically determined (for review, see refs. 10 and 21). Genetic heterogeneity of the human population, as well as exogenous differences among different communities,

Implants of Bone Matrix Gelatin Address for correspondence and reprints: Ana Marusˇic´, M.D., Ph.D., Institute for Brain Research, Zagreb University School of Medicine, Sˇalata 11, 10000 Zagreb, Croatia. E-mail: [email protected] Part of this research was presented at the International Conference on Progress in Bone and Mineral Research, Vienna, Austria, April 23–25, 1998. © 1999 by Elsevier Science Inc. All rights reserved.

Bone matrix gelatin was prepared from long bones of 10-weekold female Wistar rats from our research colony, as described by Urist et al.44,45 Briefly, diaphyseal shafts of femurs and tibiae from the hind limbs were thoroughly washed and extracted in the following solutions: chloroform-methanol solution (1:1) at room 25

8756-3282/99/$20.00 PII S8756-3282(99)00095-2

26

A. Marusˇic´ et al. Ectopic osteoinduction in inbred mouse strains

temperature for 1 h; deionized H2O (dH2O) at 2°C for 1 h; 0.6N HCl at 2°C for 24 h; dH2O at 2°C for 1 h; 2M CaCl2 at 2°C for 24 h; dH2O at 2°C for 1 h; 0.5M EDTA at 2°C for 24 h; dH2O for 1 h; 8M LiCl at 2°C for 24 h; and dH2O at 55°C for 12 h. Between the HCl and CaCl2 extraction steps, the diaphyseal shafts were cut longitudinally into strips and then into small pieces measuring 2 3 2 mm. Protease inhibitor (2 mM NaN3) was added to all aqueous solutions to prevent proteolytic degradation. After a final dH2O wash, the bone particles were lyophilized at 220°C. Pieces of bone matrix gelatin were implanted under the muscle fascia of both hind limbs of 5–10 mice under general anesthesia with tribromoethanol (Aldrich, Milwaukee, WI).23 A single rat bone gelatin preparation was used as the source of implant particles in three independent experiments under identical conditions. The implantation was performed on the same day for all the strains, and the sequence of strains during implantation was changed in each subsequent experiment to ensure random order of implantation. Two or 4 weeks after implantation, mice were euthanized with CO2, and the implants were carefully dissected out. The implant from one side was processed for histology and the implant from the other side was used for biochemistry or gene expression analysis. Bone Histology Implants were fixed in 4% buffered formaldehyde at 4°C, dehydrated in increasing alcohol concentrations, and embedded in paraffin. Serial 6-mm-thick sections were cut with a standard microtome (Leica, Nussloch, Germany) and stained with Goldner’s trichrome stain. The volume of the newly formed tissue was measured on serial sections (every 10th section throughout the thickness of the whole specimen) by counting points of a Merck ocular grid over bone, bone marrow space, cartilage, and old matrix.23,24 Biochemistry Implants were homogenized and stored at 220°C until analysis. Alkaline phosphatase activity was assayed using p-nitrophenyl phosphate as a substrate, and expressed as units per gram protein, as previously described.23 Total calcium concentration was determined by atomic absorption spectrometry (AAS; Pye Unicam, Cambridge, MA), and the phosphorus concentration was determined using a Technicon Autoanalyzer (Bayer Diagnostics, Bayer Corp., New York, NY).23 Polymerase Chain Reaction Amplification Total RNA was extracted from a pool of at least 10 implants per strain and time point, using a commercial kit (Tri-Reagent; Molecular Research Center, Cincinnati, OH). RNA was converted to cDNA by reverse transcriptase (RT) (Superscript II; Gibco, Grand Island, NY). An initial reverse transcription mixture of the total RNA (5 mg), random hexamer, and RNAse inhibitors was incubated at 70°C and then quenched on ice before the addition of the RT buffer (50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L KCl, 3 mmol/L MgCl2), dNTPs, DTT, and reverse transcriptase. The final mixture was incubated for 1 h at 37°C, pulsed with RT, and incubated for another 1 h at 37°C. Sonicated salmon sperm DNA was used as a carrier. The first-strand cDNA was extracted with phenol/chloroform, precipitated with ethanol, and resuspended in sterile water. The amount of cDNA corresponding to 0.5 mg of the reversely transcribed RNA was amplified by polymerase chain reaction (PCR) with a hot start

Bone Vol. 25, No. 1 July 1999:25–32

procedure27 by adding taq-polymerase (Amplitaq; Perkin Elmer, Norwalk, CT) to the PCR mixture during the last minute of the 5-min heating at 94°C. PCR was performed in a thermal cycler (GeneAmp PCR System 2400; Perkin Elmer) using the following cycles: denaturation at 94°C for 1 min; primer annealing at 65°C for 2 min; and extension at 72°C for 3 min for 10 cycles. In subsequent cycles, the primer annealing temperature was decreased stepwise down to 45°C by increments of 5°C every five cycles. After the last cycle (total 30 cycles), the mixture was incubated at 72°C for 7 min. Specific amplimer sets for murine bone morphogenetic protein 2 (BMP-2), BMP-4, and BMP-7 antisense and sense were a kind gift from the Genetics Institute (Cambridge, MA). Other amplimer sets were created according to the literature and synthesized by a commercial company (Integrated DNA Technology, Coralville, IA): murine osteocalcin,7 alkaline phosphatase,18 interferon g (IFN-g),3 interleukin 6 (IL-6),48 granulocytemacrophage colony-stimulating factor (GM-CSF),25 and b-actin1 antisense and sense. The size and sequences of PCR primer pairs were as follows: BMP-2, 231 bp (antisense 59ACACCTGGGTTCTCCTCTAA39, sense 59GGGAAACAGTAGTTTCCAGC39); BMP-4, 280 bp (antisense 59ACATCGAAAGTTTCCCACCG, sense 59GAACATCTGGAGAACATCCC39); BMP-7, 173 bp (antisense 59AGGTTGACGAAGCTCATGAC39, sense 59ATGTTCATGTTGGACCTGTA39); osteocalcin, 199 bp (antisense 59AAATAGTGATACCGTAGATGCG39, sense 59TCTGACAAAGCCTTCATGTCC39); alkaline phosphatase, 960 bp (antisense 59TTCCTCCAGCAAGAAGAAGCC39, sense 59GCCTTACCAACTCATTTGTGC39); IFN-g, 228 bp (antisense 59AAAGAGATAATCTGGCTCTGC39, sense 59GCTCTGAGACAATGAACGCT39); IL-6, 638 bp (antisense 59CACTAGGTTTGCCGAGTAGATCTC39, sense 59ATGAAGTTCCTCTCTGCAAGAGACT39); GM-CSF, 367 bp (antisense 59CAAAGGGGATATCAGTCAGAAAGGT39, sense 59TGTGGTCTACAGCCTCTCAGCAC39; and actin, 540 bp (antisense 59CTCTTTGATGTCACGCACGATTTC39, sense 59GTGGGCCGCTCTAGGCACCAA39). PCR primers were chosen to be around 18 –22 bases in length and more than 50% GC in content. They resided in separate exons to inhibit amplification of the genomic sequence or to make the size difference between the mRNA and genomic product easily discernable. The specificity and sensitivity of the PCR protocol was optimal for all primer pairs (data not shown). Negative controls of the reverse transcription and PCR procedures, as well as commercially available positive controls, were always ran in parallel to the experimental samples. For each strain and time point, RT was performed on RNA isolated from two independent experiments, and PCR was performed in duplicate for each cDNA, to insure the reproducibility of the assay. Statistics The values are presented as means 6 standard error of the mean (SEM). The data were first analyzed by analysis of variance (ANOVA) to detect differences among all strains. When ANOVA was significant, individual strain means were compared using the post-hoc Fisher’s LSD test, and the differences were considered statistically significant when p , 0.05. Results In the first experiment, we histologically assessed new bone induction in five inbred strains (BALB/cJ, C3Hf/Bu, A/J, DBA/ 2J, C57BL/6J, and AKR/J; six animals from each strain) 2 weeks after rat bone gelatin implantation (Figures 1 and 2). C57BL/6J, AKR/J, and DBA/2J mice showed abundant cartilage induction

Bone Vol. 25, No. 1 July 1999:25–32

A. Marusˇic´ et al. Ectopic osteoinduction in inbred mouse strains

27

Figure 1. Histological appearance of the rat bone gelatin implants from 12-week-old males of the DBA/2J, C57BL/6J, and AKR/J strains 2 (2 wk) and 4 (4 wk) weeks after implantation. At 2 weeks, newly induced cartilage (C) forms smaller or larger agglomerates in the implanted bone matrix gelatin (G), with infiltration of mesenchymal and inflammatory cells. At 4 weeks, cartilage is calcified in some parts, and new bone (arrowheads) and bone marrow (M) are visible. Bone marrow is especially abundant in implants from DBA/2J and AKR/J strains. Inflammatory cell infiltrate is still abundant at this time point.

in all implants. C3Hf/Bu mice had some cartilage in all implants. A/J mice formed cartilage in an isolated small island in three out of six implants, and BALB/cJ mice had a small island of cartilage in one out of six implants. It is important to emphasize that histological analysis was always performed on serial sections of the implants, allowing us to make conclusions about the total volume of the newly induced tissue. At 4 weeks after bone gelatin implantation, the difference between the reaction of the strains to the osteoinductive stimulus was even more impressive (Table 1, Figures 1 and 2). The volume of the newly induced tissue ranged from 1.3% of the implanted matrix in A/J strain to 74.6% of the implanted matrix in the DBA/2J strain (Table 1). Surprisingly, the CD1 outbred strain, which is genetically heterogenous,20 was the poorest responder, with only 1.2% of the old matrix replaced by cartilage (Table 1). Cartilage was formed in all of the implants from mice of the DBA/2J, RFM/Rij, C57BL/6J, and AKR/J strains; new bone with functional bone marrow was found in 23 out of the total 29 implants from these mice. Mice of the C3Hf/Bu, BALB/

cJ, A/J, and CBA/J inbred strains and the outbred CD1 strain formed cartilage in half or less than a half of the implants, and bone was found in only two out of the total 40 implants from these mice (Table 1). Strains that responded well to the osteoinductive stimulus produced at least three times more cartilage or bone than those with a poor response to the bone gelatin, but they also different in the relative amounts of the newly formed tissues (Table 1). Newly induced bone marrow was especially abundant (almost 50% of the new tissue or more) in DBA/2J, RFM/Rij, and AKR/J strains, whereas cartilage was the predominant tissue (almost 70% of the newly induced tissue) in the C57BL/6 strain (Table 1). Biochemical markers of new bone induction were measured in two good responder (DBA/2J and C57BL/6J) and two poor responder strains (BALB/cJ and A/J). Four weeks after implantation, the levels of alkaline phosphatase (ALP) activity were higher in good responder strains than in poor responder strains (mean U/g protein 6 SEM, n 5 6: DBA/2J, 329.5 6 62.2 and C57BL/6J, 323.8 6 69.8 vs. BALB/cJ, 130.6 6 26.3 and A/J, 55.5 6 15.3; p , 0.05 for DBA/2J and C57BL/6J vs. other

28

A. Marusˇic´ et al. Ectopic osteoinduction in inbred mouse strains

Bone Vol. 25, No. 1 July 1999:25–32

Figure 2. Histological appearance of the rat bone gelatin implants from 12-week-old males of the BALB/cJ, C3Hf/Bu, and A/J strains 2 (2 wk) and 4 (4 wk) weeks after implantation. At 2 weeks after implantation, small islands of cartilage (arrows) are visible in the implanted bone matrix gelatin (G) in A/J and C3Hf/Bu mice. At 4 weeks, cartilage islands are more abundant, and small amounts of new bone (arrowhead) and bone marrow (M) were found in the implants from C3Hf/Bu strain. Inflammatory cell infiltrate was less abundant then in DBA/2J, C57BL/6J, and AKR/J mice.

strains). ALP activity in implant homogenates was similar in DBA/2J and C57BL/6J mice, although implants from DBA/2J mice had more than double newly induced tissue. This can be explained by the large amount of implanted bone matrix gelatin that contributed to the protein content of the implants. Measurement of the DNA content, a more appropriate normalization factor for the ALP activity in this system, did not give reliable results because of small amounts of sample tissue. High protein content and residual mineral in implanted bone matrix gelatin can be the explanation for the lack of difference among the strains in the calcium and phosphorus concentrations in the implant homogenates, except for a significant decrease in the A/J strain (mean mmol/g protein 6 SEM, n 5 6; calcium: DBA/2J, 3.20 6 0.49 and C57BL/6J, 3.28 6 0.66 vs. BALB/cJ, 2.34 6 0.24 and A/J, 1.78 6 0.20; phosphorus: DBA/2J, 0.39 6 0.04 and C57BL/6J, 0.45 6 0.09 vs. BALB/cJ, 0.35 6 0.04 and A/J, 0.27 6 0.01; p , 0.05 for A/J vs. all other groups). To test if a good (C57BL/6J) and a poor (A/J) responder strain from our study would differ in biochemical indices of systemic bone

metabolism, we measured ALP activity in serum and bone extracts in the same way as reported in the study showing differences in bone formation between C3H/HeJ and C57BL/6J mice. The levels of ALP activity in serum and bone in 10-weekold C57BL/6J males were comparable with the published results for females of the same strain10 and were lower, although not significantly, from the levels in A/J males (serum ALP activity (mean U/L 6 SEM, n 5 3): 59.8 6 0.3 in C57BL/6J vs. 86.1 6 15.3 in A/J mice; bone alkaline phosphatase activity (mean U/g protein 6 SEM, n 5 6): 189.0 6 34.2 in C57BL/6J vs. 234.6.0 6 24.4 in A/J mice; p . 0.05, Student’s t-test). We next examined the expression of bone-related markers, ALP, and osteocalcin, and three BMPs in implants from five inbred strains, two with a strong (C57BL/6J and DBA/2J) and three with a poor osteoinductive reaction (BALB/cJ, C3Hf/Bu, and A/J) (Figure 3). At 2 weeks after gelatin implantation, ALP mRNA was expressed in implants from all strains, whereas osteocalcin transcripts were only not detected in the implants from BALB/cJ mice, which had the poorest osteoinductive re-

Bone Vol. 25, No. 1 July 1999:25–32

A. Marusˇic´ et al. Ectopic osteoinduction in inbred mouse strains

29

Table 1. New bone induction by xenogeneic bone matrix gelatin in 12-week-old male inbred strain mice 4 weeks after implantationa

Strain DBA/2J RFM/Rij C57BL/6J AKR/Jc C3Hf/Bu BALB/cJ A/J CD1

New cartilage (No. implants/ total implants)

New bone (No. implants/ implants with induction)

Total

Cartilage

Bone

Bone Marrow

9/9 8/8 8/8 4/4 5/8 3/5 3/9 5/11

8/9 8/8 5/8 2/4 1/5 1/3 0/3 0/5

74.6 6 17.7* 62.1 6 16.1* 23.6 6 6.1* 18.6 6 10.1* 5.5 6 2.1 3.8 6 2.4 1.3 6 0.9 1.2 6 0.7

21.8 6 4.4* 15.2 6 4.2* 16.5 6 3.5* 6.3 6 1.6 4.5 6 2.0 1.9 6 1.1 1.3 6 0.9 1.2 6 0.7

20.3 6 5.1* 12.5 6 3.1* 3.5 6 1.5 3.6 6 2.9 0.5 6 0.3 0.5 6 0.5 0 0

32.8 6 9.3* 36.8 6 8.9* 3.7 6 1.9 8.6 6 6.8 0.5 6 0.5 1.3 6 1.3 0 0

Newly induced tissue (% implanted matrix; mean 6 SEM)b

a The data are from a representative of three experiments with identical results. Asterixes indicate that the strains significantly differed in the measured parameter from other strains in the table but not between themselves (ANOVA and Fisher’s LSD test; p , 0.05). b The results are expressed as volume of the implanted matrix (mean 6 standard error of the mean) replaced by newly induced tissue; histomorphometry was performed on serial sections of the implant (every 10th section throughout the whole implant thickness). c The starting number of mice for this strain was 8, but they died from leukemia during the study period.

action at this time. At 4 weeks after gelatin implantation, ALP mRNA was almost below detectable levels in implants from all strains, whereas the osteocalcin message was expressed in implants from good responder strains (DBA/2J and C57BL/6), as well as from C3Hf/Bu mice (Figure 3), which had the best osteoinductive response among the poor responders (Table 1). Mouse strains differed in the expression of BMP-2, -4, and -7 mRNA (Figure 3). BMP-4 and BMP-7 transcripts were present in implants from all strains at both time points. Two weeks after implantation, BMP-2 mRNA was expressed in implants from C3Hf/Bu, A/J, and C57BL/6J mice. At 4 weeks, BMP-2 transcripts were detected in implants from all strains. Studies in vivo and in vitro have shown that cytokines are involved in the regulation of the formation and turnover of bone.15 We analyzed the expression of GM-CSF, IFN-g, and IL-6 during the osteoinductive cellular cascade (Figure 3). Transcripts for IL-6 could not be detected in implants from any of the five strains (data not shown). IFN-g transcripts were detected in implants from BALB/cJ, C3Hf/Bu, and C57BL/6J mice 2 weeks after implantation. At 4 weeks, IFN-g mRNA was readily detected in strains with a poorer osteoinductive reaction (BALB/cJ, C3Hf/Bu, and A/J). GM-CSF mRNA was expressed in implants from all strains except A/J 2 weeks after implantation, and in all strains, although at almost undetectable levels, 4 weeks after implantation. Discussion The data presented in this report show that normal inbred mouse strains differ remarkably in the capacity to form new bone in response to an osteoinductive stimulus. According to the efficiency of new bone induction and the volume of newly formed cartilage or/and bone, the strains could be classified into “good” responders that consistently reacted to the osteoinductive stimulus and formed a greater volume of new tissue, and “poor” responders that showed induction in less than half of the implants and formed little new tissue. The “good” responders differed among themselves in the volume and type of newly induced tissue. DBA/2J, RFM/Rij, and AKR/J strains had a similar ratio of new bone and cartilage and abundant bone marrow, whereas the predominant newly induced tissue in C57BL/6J mice was cartilage. We used a xenogeneic source of the osteoinductive material for two reasons. First, bone morphogenetic proteins (BMPs) are not abundant in mouse bone matrix and are easily degradable.46

We and others have tried to establish a reproducible and consistent bone induction model by mouse bone matrix preparations but have had variable success.24,46 It appears that mice respond more consistently and with higher levels of activity to xenogeneic whole matrix preparations or to purified or recombinant BMPs.46 Second, although preparations of recombinant human (rh) BMP-2 consistently induce new bone even at very low concentrations,24,46 bone matrix, which contains multiple BMPs, provides a more physiological model that is similar to embryonic limb development or fracture repair in an adult organism,34 where a variety of factors are involved in the response. To reduce the heterogeneity of the stimulus, we used a single bone gelatin preparation in all experiments and randomized the order of implantation into strains. Our preliminary experiments with rhBMP-2 implanted in a good (DBA/2J) and a poor responder (A/J) strain from this study showed that subcutaneous implantation of 2.5 mg of rhBMP-2 in 50 mL of syngeneic blood24 induced new bone in both strains, but the implants were smaller, although not significantly, in A/J compared with DBA/2J mice (our unpublished results). As this dose of rhBMP may still be an extremely powerful stimulus for in vivo new bone formation, which may override the immunological and other biological regulators of new bone formation in mice, we are currently testing if there is the lowest dose of rhBMP-2 that would consistently induce bone in good responders and no or significantly less bone in poor responders. The pattern of strain response to osteoductive stimuli did not correlate with the expression of bone-related makers and cytokines. Nevertheless, RT-PCR data, although only qualitative in nature, showed the temporal expression of bone markers and cytokines during ectopic endochondral bone formation and complement the results from other models, including membranous bone repair and fracture repair, autograft lumbar spine fusion, and distraction osteogenesis.26,28,31,33,37–39 Previous studies have established that the peak BMD is a polygenic trait,3,21,32 with some loci possibly dependent on insulin-like growth factor-I,36 and different loci involved in the regulation of cortical and trabecular bone mass and structure.42 Our results extend these reports to show that adult mice of the inbred strains differ not only in the morphology of their bones but also in the ability to form new bone by endochondral formation. The differences in the osteoinductive response observed in our study do not correlate to the differences in the peak bone mineral density (BMD) published for these strains, where C57BL/6J mice had the lowest, AKR/J, BALBc/J, and DBA/2J

30

A. Marusˇic´ et al. Ectopic osteoinduction in inbred mouse strains

Bone Vol. 25, No. 1 July 1999:25–32

Figure 4. Genealogy of the mouse strains used in the study.20 Haplotypes of the major histocompatibility complex (H-2) are in parentheses.

Figure 3. Patterns of mRNA expression for bone morphogenetic proteins (BMP-2, BMP-4, and BMP-7), alkaline phosphatase (AP), osteocalcin (OC), interferon g (IFN-g), granulocyte-macrophage colony stimulating factor (GM-CSF), and b-actin (ACTIN) assessed by RT-PCR in implants of xenogeneic bone matrix gelatin from 12-week-old males of different mouse inbred strains (BALB/cJ, C3Hf/Bu, A/J, DBA/2J, and C57BL/6J) 2 (2 wk) and 4 (4 wk) weeks after implantation. Dashes indicate negative controls of the RT and PCR assays, respectively. The data are from a representative of two independent experiments with identical results.

mice intermediate, and C3H/HeJ mice (genetically related to the C3Hf/Bu mice from our study)20,41 the highest peak BMD.2 Greater peak BMD in C3H/HeJ mice, compared with C57BL/6J mice, was explained by both decreased bone resorption and increased bone formation.2,10 One of the reasons for the difference between our results on osteoinductive response and those on bone mass may be the gender of the animals: an older study of bone mass showed that age-matched but not weight-matched A/J females had greater bone mass than C57BL/6J females, but that both age- and weight-matched C57BL/6J males (good responders in our study) had greater bone mass than A/J mice (poor responders in our study). Kaye and Kusy19 explained the differences in bone mass between C57BL/6J and A/J strains by different levels of their physical activity and consequent muscle mass. Since the relationship between muscle mass and/or strength and bone mass has been demonstrated in animals and humans,11,19 it was possible

that the observed differences between the strains could be related to the (genetic) differences in their physical activity and subsequent muscle and bone mass. Search of the literature showed that high or low physical activity did not always correlate with the response to osteoinductive stimulus observed in our study. C57BL/6 and AKR strains, good responders in our study, exhibit high open-field activity and/or spontaneous locomotor activity,6,19,30 but not the DBA/2 strain,6 the best responder in our study. The worst and the best among the poor responders (C3H and A strains, respectively), have low open-field activity and/or spontaneous locomotor activity.6,19,30,40 Another poor responder, the BALB/c strain, exhibits high spontaneous locomotor activity,30,40 whereas CBA strain has low locomotor activity when single, but intermediate when grouped,9 as was the case in our study. Analysis of the historical ancestry of the strains showed that all “poor” responder strains had common origin from the 1913 Bagg albino stock of mice (Figure 4).20 They have all been derived from the Mus musculus musculus type of mice.20 RFM and AKR are of the M. m. domesticus origin20 and have origin independent from each other and from other mouse strains (Figure 4). DBA/2 and C57BL/6 strains both belong to the M. m. musculus type but they have been derived independently.20 C57BL/6 strain is genetically atypical of inbred strains of laboratory mice; it carries a Y chromosome of Asian M. m. origin, like the AKR strain,47 and has up to 6.5% of the genome of the M. m. spretus origin.35 Lack of correlation between the levels of serum and bone ALP activity, an indicator of systemic bone homeostasis and the osteoinductive response in our study, indicates that the processes of bone formation in the intact skeleton may differ from the specific processes involved in the induction of new bone formation, such as happens during fracture healing. Ectopic chondroosteogenesis and fracture repair both have an important immunological component. Some degree of immunological/ inflammatory reaction is necessary for the initiation of the osteoinductive cellular cascade after implantation of bone matrix or bone morphogenetic protein(s),8 but excessive inflammatory reaction may delay or prevent normal osteoinductive or bone regeneration process.46 It is highly unlikely that the immunological response to the foreign antigen only could be the explanation for the differences among the inbred strains in their osteoinductive reaction to the preparations of rat bone matrix. It is well known that bone allografts are immunogenic and can elicit cytotoxic response to antigens of the major histocompatibility complex (MHC) expressed on the bone cells.5,14,16,49 However,

Bone Vol. 25, No. 1 July 1999:25–32

the bone matrix preparation we used was the so-called autolyzed and antigen-extracted bone with full osteoinductive properties but highly reduced antigenicity.22,43,44 In a model of teeth allograft transplantation into the mouse tibia, the transplanted teeth can induce new bone formation across both major and minor MHC differences.5 The absence of segregation of MHC haplotypes (H-2 in the mouse) between poor and good responders in our study (Figure 4) also indicates that the immunological reaction to the implanted matrix is not H-2 controlled.20 Although we did not investigate in detail the immunological reaction to the implanted bone gelatin, good responders to osteoinductive stimulus appeared to have a more vigorous inflammatory reaction to the implants, as evidenced by the number and type of cells in the inflammatory infiltrate (our unpublished results). AKR and RFM strains, known for their high incidence of lymphatic leukemia and susceptibility to the induction of myeloid and lymphoid leukemia, respectively,17,29 had especially abundant inflammatory infiltration around the implants and cellular bone marrow in the newly induced bone. The difference in the inflammatory response to the implants, together with the strain-dependent expression of IFN-g, the cytokine specific for the T cell immune response, indicate that, in the in vivo situation, the interactions between immunological and bone cells during new bone formation are very complex and their balance, which determines the type and magnitude of tissue reaction to osteoinductive stimuli, may be different in different genetic backgrounds. Further studies are needed to elucidate the genetic factors other than those involved in the acquisition of peak BMD that determine new cartilage and bone formation in the model of ectopic osteogenesis, especially its immunological aspect. The definition of these factors would be important for understanding clinically important processes such as fracture healing. Particularly relevant tool in this approach will be in vivo studies, in which interactions occur between multiple complex systems and the physiological role of the immune system in skeletal homeostasis is more accurately reflected.

A. Marusˇic´ et al. Ectopic osteoinduction in inbred mouse strains

6. 7.

8.

9.

10.

11. 12. 13.

14. 15. 16. 17.

18.

19. 20. 21.

Acknowledgments: This work is dedicated to Professor Jan Klein, Max Planck Institute for Biology, Tu¨bingen, Germany, who introduced us to the mouse genetics and immunology. The study was supported by funds from the US-Croatian Joint Research Fund, project No. JF199, and the Ministry of Science and Technology of the Republic of Croatia, project No. 108148. We are indebted to the Genetics Institute for the gift of PCR primers for the bone morphogenetic proteins, to Professor Stipan Jonjic´, M.D., Ph.D., from the Rijeka University School of Medicine for constant supply of the animals and critical comments of the manuscript, and Professor Joseph A. Lorenzo, M.D., University of Connecticut Health Center, for his help during the study.

25.

References

26.

1. Alonso, S., Minty, A., Bourlet, Y., and Buckingham, M. Comparison of the three actin-coding sequences in the mouse: evolutionary relationships between the actin genes of warm-blooded vertebrates. J Mol Evol 23:11–22; 1986. 2. Beamer, W. G., Donahue, L. R., Rosen, C. J., and Baylink, D. J. Genetic variability in adult bone density among inbred strains of mice. Bone 18:397– 403; 1996. 3. Beamer, W. G., Rosen, C. J., Donahue, L. R., et al. Location of genes regulating volumetric bone mineral density in C57BL/6J (low) and C3H/HeJ (high) inbred strains of mice [abstract 1056]. J Bone Min Res 23(Suppl. 1):162; 1998. 4. Ben-Amor, A., Leite-de-Moraes, M. C., Lepault, F., et al. In vitro T cell unresponsiveness following low-dose injection of anti-CD3 MoAb. Clin Exp Immunol 103:491– 498; 1996. 5. Barrett, A. P. and Reade, P. A histological investigation of allografts of mature

22.

23.

24.

27. 28.

29.

30.

31.

31

mouse molars to an intrabony and extrabony site. Transplantation 32:116 –120; 1981. Bruell, J. H. Inheritance of behavioural and physiological characters of mice and the problem of heterosis. Am Zool 4:125–138; 1964. Celeste, A. J., Rosen, V., Buecker, J. L., Kriz, R., Wang, E. A., and Wozney, J. M. Isolation of the human gene for bone gla protein utilizing mouse and rat cDNA clones. EMBO J 5:1885–1890; 1986. Cunningham, N. S., Paralkar, V., and Reddi, A. H. Osteogenin and recombinant bone morphogenetic protein 2B are chemotactic for human monocytes and stimulate transforming growth factor b1 mRNA expression. Proc Natl Acad Sci USA 89:11740 –11744; 1992. Davis, W. M., King, W. T., and Rabbini, M. Placebo effect of saline on locomotor activity in several strains of mice. J Pharmaceut Sci 56:1347–1349; 1967. Dimai, H. P., Linkhart, T. A., Likhart, S. G., Donahue, L. R., Beamer, W. G., Rosen, C. J., Farley, J. R., and Baylink, D. J. Alkaline phosphatase levels and osteoprogenitor cell numbers suggest bone formation may contribute to peak bone density differences between two inbred strains of mice. Bone 22:211–216; 1998. Doyle, F., Brown, J., and Lachance, C. Relation between bone mass and muscle weight. Lancet 1:391–393; 1970. Festing, M. International index of laboratory animals. 6th ed. Leicaster: MRC Toxicology Unit, University of Leicaster; 1993. Festing, M. F. W. Inbred strains of mice and their characteristics. Available from The Jackson Laboratory URL: http://www.informatics.jax.org/strains/ mouse/INTRO.html. Friedlander, G. E. Bone allografts: the biological consequences of immunological events. J Bone Joint Surg 66A:107–112; 1991. Goldring, S. R. and Goldring, M. B. Cytokines and skeletal physiology. Clin Orthop 324:13–23; 1996. Horowitz, M. C. and Friedlaender, G. E. Induction of specific T-cell responsiveness to allogeneic bone. J Bone Joint Surg 73:1157–1168; 1991. Huseini, S., Fried, W., Knospe, W. H., and Trobaugh, F. E. Jr. Dynamics of leukaemia and normal stem cells in leukaemic RFM mice. Cancer Res 36: 1784 –1789; 1976. Jeng, Y.-J., Watson, C. S., and Thomas, M. L. Identification of vitamin D-stimulated alkaline phosphatase in IEC-6 cells, a rat small intestine crypt cell line. Exp Cell Res 212:338 –343; 1994. Kaye, M. and Kusy, R. P. Genetic lineage, bone mass, and physical activity in mice. Bone 17:131–135; 1995. Klein, J. Biology of the mouse H-2 complex. Berlin: Springer; 1975. Klein, R. F., Mitchell, S. R., Phillips, T. J., Belknap, J. K., and Orwoll, E. S. Quantitative trait loci affecting peak bone mineral density in mice. J Bone Min Res 13:1648 –1656; 1998. Kuebler, N., Reuther, J., Kirchner, T., Priessnitz, B., and Seabald, W. Osteoinductive, morphologic, and biomechanical properties of autolyzed, antigenextracted, allogeneic human bone. J Oral Maxillofac Surg 51:1346 –1357; 1993. Marusˇic´, A., Djikic´, I., Vukicˇevic´, S., and Marusˇic´, M. New bone formation induced by demineralized bone matrix in immunosuppressed rats. Experientia 48:783–785; 1992. Marusˇic´, A., Katavic´, V., and Grcˇevic´, D. New bone induction by bone matrix and recombinant human bone morphogenetic protein-2 in the mouse. Croatian Med J 37:237–244; 1996. Miyatake, S., Otsuka, T., Yokota, T., Lee, F., and Arai, K. Structure of the chromosomal gene for granulocyte-macrophage colony stimulating factor: comparison of the mouse and human genes. EMBO J 4:2561–2568; 1985. Morone, M. A., Bodes, S. D., Hair, G., Martin Jr., G. J., Racine, M., Titus, L., and Hutton, W. C. Gene expression during autograft lumbar spine fusion and the effects of bone morphogenetic protein 2. Clin Orthop 351:252–265; 1998. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion. PCR Methods Appl 1:1– 4; 1991. Nakase, T., Nomura, S., Yoshikawa, H., Hashimoto, J., Hirota, S., Kitamura, Y., Oikawa, S., Ono, K., and Takaoka, K. Transient and localized expression of bone morphogenetic protein 4 messenger RNA during fracture healing. J Bone Miner Res 9:651– 659; 1994. Nemirovsky, T. and Trainin, N. Leukemia induction in C3H mice following their inoculation with normal AKR lymphoid cells. Int J Cancer 11:172–177; 1973. Nikulina, E. M., Skrinskaya, J. A., and Popova, N. K. Role of genotype and dopamine receptors in behaviour of inbred mice in a forced swimming test. Psychopharmacology 105:525–529; 1991. Onishi, T., Ishidou, Y., Nagamine, T., et al. Distinct and overlapping patterns

32

32.

33.

34. 35.

36.

37.

38.

39.

40.

A. Marusˇic´ et al. Ectopic osteoinduction in inbred mouse strains of localization of bone morphogenetic protein (BMP) family members and a BMP type II receptor during fracture healing in rats. Bone 22:605– 612; 1998. Orwoll, E., Belknap, J., Phillips, T., and Klein, R. Gender differences in bone mass are genetically determined: quantitative train loci analyses [abstract T311]. J Bone Min Res 23(Suppl. 1):275; 1998. Prisell, P. T., Edwall, D., Lindblad, J. B., Levinovitz, A., and Norstedt, G. Expression of insulin-like growth factors during bone induction in rat. Calcif Tissue Int 53:201–205; 1993. Reddi, A. H. Cell biology and biochemistry of endochondral bone development. Coll Rel Res 1:209 –226; 1981. Rikke, B. A., Zhao, Y., Daggett, L. P., Reyes, R., and Hardies, S. C. Mus spretus LINE-1 sequences detected in the Mus musculus inbred strain C57BL/6 using LINE-1 DNA probes. Genetics 139:901–906; 1995. Rosen, C., Beamer, W., and Donahue, L. Assessing IGF-I dependent and independent loci that regulate femoral bone density by development of congenic little mice [abstract 1055]. Bone 23 (Suppl. 1):162; 1998. Sakano, S., Murata, Y., Miura, T., Iwata, H., Sato, K., Matsui, N., and Seo, H. Collagen and alkaline phosphatase gene expression during bone morphogenetic protein (BMP)-induced cartilage and bone differentiation. Clin Orthop 292: 337–344; 1993. Sato, M., Yasui, N., Nakase, T., Kawahata, H., Sugimoto, M., Hirota, S., Kitamura, Y., Nomura, S., and Ochi, T. Expression of bone matrix proteins mRNA during distraction osteogenesis. J Bone Miner Res 13:1221–1231; 1998. Sommer, B., Bickel, M., Hofstetter, W., and Wetterwald, A. Expression of matrix proteins during the development of mineralized tissues. Bone 19:371– 380; 1996. Southwick, C. H. and Clark, L. H. Interstrains differences in aggressive behaviour and exploratory activity of inbred mice. Commun Behav Biol Part A 1:49 –59; 1968.

Bone Vol. 25, No. 1 July 1999:25–32 41. Staats, J. Standardized nomenclature for inbred strains of mice: Eighth listing. Canc Res 43:945–977; 1985. 42. Turner, C. H., Hsieh, Y. F., Muller, R. A., Bouxsein, M. L., Baylink, D. J., Rosen, C. J., Donahue, L. R., and Beamer, W. Differential regulation of cortical and trabecular bone strength and microstructure in inbred strains of mice [abstract T318]. J Bone Min Res 23(Suppl. 1):276 –277; 1998. 43. Urist, M. R. Bone formation by autoinduction. Science 15:893– 899; 1965. 44. Urist, M. R., Iwata, H., Ceccotti, P. L., et al. Bone morphogenesis in implants of insoluble bone gelatin. Proc Natl Acad Sci USA 70:3511–3515; 1973. 45. Urist, M. R. A bone morphogenetic system in residues of bone matrix in the mouse. Clin Orthop 9:210 –220; 1973. 46. Urist, M. R. The search for and the discovery of bone morphogenetic protein (BMP). In: Urist, M. R., O’Conner, B. T., and Burwell, R. G., Eds. Bone Grafts, Derivatives and Substitutes. London: Butterworth Heinemann; 1994;315–362. 47. Tucker, P. K., Lee, B. K., Lundrigan, B. L., and Eicher, E. M. Geographic origin of the Y chromosomes in “old” inbred strains of mice. Mammalian Genome 3:254 –261; 1992. 48. Van Snick, J., Cyaphas, S., Szikora, J. P., Renauld, J. C., Van Roost, E., Boon, T., and Simpson, R. J. cDNA cloning of murine interleukin-HP1: homology with human interleukin 6. Eur J Immunol 18:193–197; 1988. 49. Virolainen, P., Vuorio, E., and Aro, H. T. Different healing rates of bone autografts, syngeneic grafts, and allografts in an experimental rat model. Arch Orthop Trauma Surg 116:486 – 491; 1997.

Date Received: October 12, 1998 Date Revised: January 18, 1999 Date Accepted: March 2, 1999