- Email: [email protected]
Genetic Variations and Haplotypes of UGT1A4 in a Japanese Population
Drug Metab. Pharmacokinet. 20 (2): SNP13 (144)SNP20 (151) (2005).
SNP Communication Genetic Variations and Haplotypes of UGT1A4 in a Japanese Population Mayumi SAEKI1, Yoshiro SAITO1,2,*, Hideto JINNO1,3, Kimie SAI1,4, Akiko HACHISUKA2, Nahoko KANIWA1,5, Shogo OZAWA1,6, Manabu KAWAMOTO7, Naoyuki KAMATANI7, Kuniaki SHIRAO8, Hironobu MINAMI9, Atsushi OHTSU10, Teruhiko YOSHIDA11, Nagahiro SAIJO12, Kazuo KOMAMURA13,14, Takeshi KOTAKE15, Hideki MORISHITA15, Shiro KAMAKURA13, Masafumi KITAKAZE13, Hitonobu TOMOIKE13 and Junichi SAWADA1,2 1Project
Team for Pharmacogenetics, 2Division of Biochemistry and Immunochemistry, of Environmental Chemistry, 4Division of Xenobiotic Metabolism and Disposition, 5Division of Medicinal Safety Science, 6Division of Pharmacology, National Institute of Health Sciences, Tokyo, Japan 7Division of Genomic Medicine, Department of Advanced Biomedical Engineering and Science, Tokyo Women's Medical University, Tokyo, Japan 8Division of Internal Medicine, National Cancer Center Hospital, 11Genetics Division, National Cancer Center Research Institute, National Cancer Center, Tokyo, Japan 9Division of Oncology W Hematology, 10Division of GI OncologyW Digestive Endoscopy, 12Deputy Director, National Cancer Center Hospital East, Chiba, Japan 13Division of Cardiology, 14Department of Cardiovascular Dynamics Research Institute, 15Department of Pharmacy, National Cardiovascular Center, Osaka, Japan 3Division
Full text of this paper is available at http://www.jssx.org
Summary: Nineteen genetic variations, including 11 novel ones, were found in exon 1 and its anking region of the UDPglucuronosyltransferase (UGT) 1A4 gene from 256 Japanese subjects, consisting of 60 healthy volunteers, 88 cancer patients and 108 arrhythmic patients. These variations include |217TÀG and |36GÀA in the 5?anking region, 30GÀA (P10P), 127delA (43fsX22; frameshift from codon 43 resulting in the termination at the 22nd codon, codon 65), 175delG (59fsX6), 271CÀT (R91C), 325AÀG (R109G), and 357TÀC (N119N) in exon 1, and IVS1{1GÀT, IVS1{98AÀG and IVS1{101GÀT in the following intron. Among them, 127delA and 175delG can confer early termina tion of translation, resulting in an immature protein that probably lacks enzymatic activity. Variation IVS1{1GÀT is located at a splice donor site and thus may lead to aberrant splicing. Since we did not nd any signicant dierences in the frequencies of all the variations among the three subject groups, the data were analyzed as one group. The allele frequencies of the novel variations were 0.006 for IVS1{ 101GÀT, 0.004 for 30GÀA (P10P) and 357TÀC (N119N), and 0.002 for the 8 other variations. In addition, the two known nonsynonymous single nucleotide polymorphisms (SNPs), 31CÀT (R11W) and 142TÀG (L48V), were found at 0.012 and 0.129 frequencies, respectively. The SNP 70CÀA (P24T), mostly linked with 142TÀG (L48V) in German Caucasians, was not detected in this study. Sixteen haplotypes were identied or inferred, and some haplotypes were conrmed by cloning and sequencing. It was shown that most of 142TÀG (L48V) was linked with |219CÀT, |163GÀA, 448TÀC (L150L), 804GÀA (P268P), and IVS1{43CÀT, comprising haplotype *3a; haplotype *4a harbors 31CÀT (R11W); 127delA (43fsX22) and 142TÀG (L48V) were linked (haplotype *5a); 175delG (59fsX6) was linked with 325AÀG (R109G) (*6a haplotype); and |219CÀT, |163GÀA, 142TÀG (L48V), 271CÀT (R91C), 448TÀC (L150L), 804GÀA (P268P), and IVS1{43CÀT comprised haplotype *7a. Our results provide fundamental and useful information for genotyping UGT1A4 in the Japanese and probably Asian populations. Key words: UGT1A4; amino acid alteration; frameshift; splice donor site; drug metabolism
Received; December 6, 2004, Accepted; February 17, 2005 To whom correspondence should be addressed : Yoshiro SAITO, Ph.D., Project Team for Pharmacogenetics, National Institute of Health Sciences, 1181 Kamiyoga, Setagayaku, Tokyo 1588501, Japan. Tel. {81337009453, Fax. {81337076950, Email: yoshironihs.go.jp
SNP13 (144)
Genetic Variations and Haplotypes of UGT1A4 Table 1.
SNP14 (145)
Primers utilized for UGT1A4 amplication and sequencing
Direction
Primer Name
Sequences
Locationa
Amplication
forward reverse
UGT1A41stF UGT1A41stR
TTAACAAAGTAGAAGGCAGTG TGAAAACTTGAAATACACTAGGC
135092 136460
Sequencing
forward forward forward reverse reverse reverse
UGT1A41stF UGT1A4seqF2 UGT1A4seqF3 UGT1A4seqR12 UGT1A4seqR2 UGT1A41stR
TTAACAAAGTAGAAGGCAGTG GGGCTGAGAGTGGAAAGGT TCCTTCCTCCTATATTCCTAAGTT ATCAAATTCCTTCTGGGTCC AAGGGGCAGAAAAAGTATGG TGAAAACTTGAAATACACTAGGC
135092 135502 135995 135698 136119 136460
a
The 5?end of each primer on AF297093.1.
On December 2, 2004, these variations were not found on the UDP Glucuronosyltransferase home page (http: WW som.inders.edu.au W FUSA W ClinPharm W UGT W ), the Japanese Single Nucleotide Polymor phisms (JSNP) (http: WW snp.ims.utokyo.ac.jp W ), dbSNP in the National Center for Biotechnology Information (http: WW www.ncbi. nlm.nih.gov W SNP W ), or PharmGKB (http: WW www.pharmgkb.org W do W ) databases. This study was supported by the Program for the Promotion of Fundamental Studies in Health Sciences (MPJ1, 3, and 6) of the Pharmaceuticals and Medical Devices Agency (PMDA) of Japan, and the program for the Promotion of Studies in Health Scrences of the Ministry of Health, Labor and Welfare of Japan.
Introduction As phase II enzymes, the UDPglucuronosyltran sferase enzymes (UGTs) play crucial roles in the detox ication and elimination of a large number of en dogenous and exogenous compounds.1) Of the UGT1 and UGT2 subfamilies expressed in humans, the genes encoding UGT1As have a unique genetic structure consisting of at least 13 dierent exon 1?s, including four inactive ones, and the common exons 2 to 5 clustered on chromosome 2q37.2) One of the exon 1?s can be spliced on to the common exons. The Nterminal domains (encoded by the exon 1?s) of the UGT1A proteins determine their substratebinding specicity, and the common Cterminal domain (encoded by exons 2 to 5) is important for UDPglucuronic acid binding.3) UGT1A4 is expressed in the liver, bile ducts, colon, small intestine, and pancreas.1,4,5) UGT1A4 catalyzes the conjugation of exogenous amines and alcohols, includ ing nicotine, sapogenins, imipramine, triuoperazine, and tamoxifen.1,69) In addition, many androgens and progestins are reported as endogenous substrates of UGT1A4.6) Several genetic polymorphisms of UGT1A4 were reported in the public databases. Among them, two nonsynonymous single nucleotide polymorphisms (SNPs), 70CÀA (P24T) and 142TÀG (L48V), were found in German Caucasians, and they were shown to be closely associated.10) The variant enzymes (24T and
48V) had reduced in vitro activities for bnaphtylamine, benzidine, transandrosterone, and dihydrotestosterone in a substratespecic manner.10) In spite of the clinical importance of UGT1A4, there is no report on the comprehensive sequencing analysis for the genetic polymorphisms of UGT1A4 in Asian populations, including the Japanese. In the present study, UGT1A4 exon 1 was sequenced from 256 Japanese subjects. Eleven novel genetic variations were identied, including 4 nonsynonymous ones. Materials and Methods Human genomic DNA samples: DNA was obtained from the blood leukocytes of 88 Japanese cancer patients and 108 Japanese arrhythmic patients. Written informed consent was obtained from all participating patients. DNA was also extracted from EpsteinBarr virustransformed lymphoblastoid cells, for which blood samples were collected from 60 healthy Japanese volunteers at the Tokyo Women's Medical University under the auspices of the Pharma SNP Consortium (Tokyo, Japan). Informed consent was also obtained from all healthy subjects. The ethical review boards of all the participating organizations approved this study. PCR conditions for DNA sequencing: First, exon 1 of UGT1A4 was amplied from genomic DNA (100 ng) using 0.625 units of ExTaq (Takara Bio. Inc., Shiga, Japan) with 0.2 mM of amplication primers designed in the introns (Table 1). The PCR conditions were 949C for 5 min, followed by 30 cycles of 949 C for 30 sec, 559 C for 1 min, and 729 C for 2 min, and then a nal extension at 729 C for 7 min. These PCR products were then treated with a PCR Product PreSequencing Kit (USB Co., Cleveland, OH, USA) and were directly sequenced on both strands using an ABI Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) (see Table 1 for sequencing primers). The excess dye was removed by a DyeEx96 kit (Qiagen, Hilden, Germany). The eluates were analyzed on an ABI Prism 3700 DNA Analyzer (Applied Biosystems). All variations were conrmed by repeating
SNP15 (146)
Table 2.
Summary of UGT1A4 polymorphisms detected in a Japanese population
SNP ID
This Study
a
Pharm GKB atabaseb
dbSNP NCBI database
JSNP database
rs3732219
IMSJST085729
O
rs3732218
IMSJST085728
O
rs3892221
O
rs2011425
O
rs12468274 rs2011404 rs3732217
IMSJST085727
O O O
rs2011219
IMSJST085726
O
AF297093.1
From the translational initiation site or from the end of exon 1 (IVS1{)
135210 135212 135266 135393 135458 135459 135555 135570 135603 135699 135753 135785 135876 135899 136232 136296 136338 136393 136396
|219 |217 |163 |36 30 31 127 142 175 271 325 357 448 471 804 IVS1{1 IVS1{43 IVS1{98 IVS1{101
Location
5?anking 5?anking 5?anking 5?anking Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Intron 1 Intron 1 Intron 1 Intron 1
Novel variations detected in this study. The SNPs included in the PharmGKB database was shown as ``O''. c T in the reference sequence. b
Number of subjects
Nucleotide change and anking sequences (5? to 3?)
GGGTCAGATGAGCWTTTTTCAAGATAG GTCAGATGAGCTT WGTTCAAGATAGGC TAACGAAAGGCAG W ATTATAGATTAAT CAGGCACAGCGTG WAGGGTGGACAGTC GGTTCCCCTGCCG WACGGCTGGCCACA GTTCCCCTGCCGC WTGGCTGGCCACAG AGCCCCTGGCTCA WGCATGCGGGAGG ATGCGGGAGGCCTWGTGCGGGAGCTCC GGCCACCAGGCGG WTGGTCCTCACCC AAGGAATTTGATC WTGCGTTACGCTGG CATCTTCTGAAGA WGGATATTCTAGAA AATTATGAACAAT WCGTATCTTTGGCC TTTGATGTGGTTT WCTAACAGACCCCG CGTTAACCTCTGC WTcGGGGCGGTGCTG CTACCCCAGGCCG WAATCATGCCCAAC CCACTATCTCAGG WTTCTGTATTGGTG TTCCAGGCAAAAC W TACTTTTTAAAAA ACTTATCTTTCCA WGAAGATTTTATTT TATCTTTCCAAAG WTATTTTATTTTGG
Amino acid change
P10P R11W 43fsX22 L48V 59fsX6 R91C R109G N119N L150L C157C P268P
Frequency
Wild type
Hetero zygote
Homo zygote
Total (n256)
Healthy volunteers (n60)
Cancer patients (n88)
Arrhythmic patients (n108)
195 255 195 255 254 250 255 197 255 255 255 254 195 251 195 255 195 255 253
54 1 54 1 2 6 1 52 1 1 1 2 54 5 54 1 54 1 3
7 0 7 0 0 0 0 7 0 0 0 0 7 0 7 0 7 0 0
0.133 0.002 0.133 0.002 0.004 0.012 0.002 0.129 0.002 0.002 0.002 0.004 0.133 0.010 0.133 0.002 0.133 0.002 0.006
0.133 0.000 0.133 0.000 0.000 0.025 0.000 0.133 0.000 0.000 0.000 0.008 0.133 0.008 0.133 0.000 0.133 0.000 0.008
0.142 0.000 0.142 0.006 0.000 0.011 0.000 0.148 0.000 0.000 0.000 0.006 0.142 0.011 0.142 0.000 0.142 0.006 0.006
0.125 0.005 0.125 0.000 0.009 0.005 0.005 0.111 0.005 0.005 0.005 0.000 0.125 0.009 0.125 0.005 0.125 0.000 0.005
Mayumi SAEKI, et al.
MPJ6äU1A081 MPJ6äU1A082a MPJ6äU1A083 MPJ6äU1A084a MPJ6äU1A085a MPJ6äU1A086 MPJ6äU1A087a MPJ6äU1A088 MPJ6äU1A089a MPJ6äU1A090a MPJ6äU1A091a MPJ6äU1A092a MPJ6äU1A093 MPJ6äU1A094 MPJ6äU1A095 MPJ6äU1A096a MPJ6äU1A097 MPJ6äU1A098a MPJ6äU1A099a
Position
Genetic Variations and Haplotypes of UGT1A4
Fig. 1
SNP16 (147)
SNP17 (148)
Mayumi SAEKI, et al.
Fig. 1. The 4 novel genetic variations with amino acid substitutions and 1 splice donor site variation of human UGT1A4. (A) MPJ6äU1A087 (wildtype, 127A W A; variant, 127A W ). (B) MPJ6äU1A089 (wildtype, 175G W G; variant, 175G W ). (C) MPJ6äU1A090 (wildtype, 271C W C; variant, 271C W T). (D) MPJ6äU1A091 (wildtype, 325A W A; variant, 325A W G). (E) MPJ6äU1A096 (wildtype, IVS1{1G W G; variant, IVS1{1G W T). Arrows indicate the positions of the nucleotide changes.
the PCR on genomic DNA and sequencing the newly generated PCR products. Furthermore, the rare variations found in only one subject were conrmed by sequencing the PCR fragments produced by amplica tion with a high delity DNA polymerase KODPlus (TOYOBO, Tokyo, Japan). Linkage disequilibrium (LD) and haplotype analysis: HardyWeinberg equilibrium analysis and LD analysis were performed by SNPAlyze software (Dynacom Co., Yokohama, Japan). Pairwise LDs were shown in rho square (r 2) values. Some of the haplotypes were unam biguous from the subjects with homozygous SNPs at all sites or a heterozygous SNP at only one site. Separately, the diplotype congurations (a combination of haplo types) were inferred by LDSUPPORT software, which
determines the posterior probability distribution of the diplotype conguration for each subject based on the estimated haplotype frequencies.11) The haplotypes were described as a number plus a small alphabetical letter. Results and Discussion UGT1A4 exon 1 and its anking regions (from |286 bases upstream of the translational start site to 112 bases downstream of the end of exon 1) were sequenced from 256 Japanese subjects. Genbank accession number AF297093.1 was utilized for the reference sequence. Nineteen polymorphisms were detected, including 11 novel ones (2 were in the 5?anking region, 6 in exon 1, and 3 in the following intron) (Table 2). All of the allelic frequencies were in HardyWeinberg equilibrium ( p
b
A of the translational start codon of UGT1A4 is numbered 1. AF297093.1 was used as the reference sequence. The haplotypes were described as a number plus a small alphabetical letter.
SNP18 (149)
a
Table 3.
0.13 or over). Since we did not nd any signicant dierences in the frequencies of all the variations among three subject groups ( pÀ0.25 by x 2 test) and between two of the three groups ( pÀ0.13 by x 2 test or Fisher's exact test), the data for all subjects were analyzed as one group. We found two novel nonsynonymous variations, 271CÀT (R91C) and 325AÀG (R109G), and two novel deletions, 127delA (43fsX22) and 175delG (59fsX6), as individual heterozygotes at a 0.002 frequency. Among them, 127delA (43fsX22) and 175delG (59fsX6) are the frameshift variations starting from codon 43 and 59, respectively, resulting in early stop codons at the 22nd ( i.e. codon 65) and the 6th ( i.e. codon 65) codons, respectively. It is most likely that these variations generate an immature protein that probably has null activity. The functional signicance of 271CÀT (R91C) and 325AÀG (R109G) is currently unknown. Addition ally, IVS1{1GÀT, which was found at a frequency of 0.002, was located at a splice donor site and thus may lead to aberrant splicing (Fig. 1). We also detected two known nonsynonymous SNPs, 31CÀT (R11W) and 142TÀG (L48V), at 0.012 and 0.129 frequencies, respectively. The frequency of 142TÀG (L48V) was almost comparable to that of German Caucasians (0.09).10) L48V was reported to lead to a partial decrease in glucuronidation of bnaphthyla mine and benzidine, a marked decrease in the activity to transandrosterone, and no activity toward di hydrotestosterone in vitro.10) The functional signicance of SNP 31CÀT (R11W) has not been reported yet. High linkage disequilibrium ( r 2»0.89) was observed among |219CÀT, |163GÀA, 142TÀG (L48V), 448TÀC (L150L), 804GÀA (P268P), and IVS1{ 43CÀT. A perfect linkage ( r 21) was found between 175delG and 325AÀG (R109G), but found in only one subject. The r 2 values were below 0.014 between the other pairs of polymorphisms. The SNP 70CÀA (P24T), mostly linked with 142TÀG (L48V) in German Caucasians,10) was not detected in this study. Thus, it must be claried whether the dierences in the linkage of those SNPs may lead to the ethnic dierences in the enzymatic activities of UGT1A4. A similar kind of ethnic dierence has been found in the *IB haplotype, which harbors the three linked SNPs in the 3?untransla ted region of UGT1A common exon 5 found in a Japanese population.12) In Caucasian and African American populations, this linkage of the 3 SNPs was not complete, especially in AfricanAmericans.13) Using the detected SNPs, haplotype analysis was then performed (Table 3). Since UGT1A4*2 [70CÀA (P24T)] and *3 [142TÀG (L48V)] were dened in AF465196 and AF465197 (Genbank accession num bers), respectively, the novel haplotypes with amino acid changes, frameshift variations, or splice donor site
UGT1A4 haplotypes in a Japanese population
Genetic Variations and Haplotypes of UGT1A4
SNP19 (150)
Mayumi SAEKI, et al.
variation, were assigned as haplotypes *4 to *8. Several haplotypes were rst unambiguously assigned by homozygous SNPs at all sites (*1a and *3a) or a heterozygous SNP at only one site (*1b, *1d*1i, *3b, *4a, and *8a). Separately, we estimated the diplotype conguration (a combination of haplotypes) for each subject by LDSUPPORT software. The diplotype congurations of 256 subjects were inferred with probabilities (certainty) of 0.9998 or over, except for one subject. The additionally inferred haplotypes were *1c, *5a, *6a, and *7a. As for one subject with a low probability (who had heterozygous SNPs of |219CÀT, |163 GÀA, 31CÀT, 142TÀG, 448TÀC, 804GÀA, and IVS1{43CÀT), the diplotype was determined by the cloning and sequencing of DNA fragments. One chromosome had haplotype *3a (consisting of |219CÀT, |163 GÀA, 142TÀG, 448TÀC, 804GÀA, and IVS1{43CÀT) and the other had haplotype *4a (31CÀT). Moreover, the data obtained by cloning and sequencing analysis conrmed the presence of haplotypes *5a [127delA (43fsX22) and 142TÀG (L48V)], *6a [175delG (59fsX6) and 325AÀG (R109G)], and *7a [|219CÀT, |163GÀA, 142TÀG (L48V), 271CÀT (R91C), 448TÀC (L150L), 804GÀA (P268P), and IVS1{43CÀT] (Table 3). The most frequent haplotype was *1a (frequency: 0.818), followed by *3a (0.123), *4a (0.012) and *1b (0.010). The frequencies of the other haplotypes were less than 0.01. Since 325AÀG (R109G) was linked with 175delG (59fsX6), the enzymatic activity of this haplotype (*6a) is probably null. The other SNP, 271CÀT confers the R91C substitution. In human UGT1A4, eight cysteine residues were located in the lumenal domain.3,14) Though the disuldebond formation and its sig nicance are not clear in the UGT1A4, it has been reported that the reduction of disuldebonds of rat UGT1A6 with dithiothreitol increases its enzymatic activity in the liver microsomes.15) On the other hand, the alterations of several lumenal cysteines into serine residues seem to reduce the UGT1A6 activity when the mutant enzymes were expressed in COS cells.15) The eect of additional cysteine residue at codon 91 in the UGT1A4 should be determined in the future. In conclusion, we detected 19 polymorphisms, including 11 novel ones, in UGT1A4 from a Japanese population. Using the detected polymorphisms, 16 haplotypes were identied. Our results provide fun damental and useful information for genotyping UGT1A4 in the Japanese, and probably Asian popula tions.
References 1)
2)
3)
4)
5)
6)
7)
8)
9)
10)
11)
Acknowledgments: We thank Ms. Chie Knudsen for her secretarial assistance. 12)
Tukey, R. H. and Strassburg, C. P.: Human UDP glucuronosyltransferase: Metabolism, Expression, and Disease. Annu. Rev. Pharmacol. Toxicol., 40: 581616 (2000). Mackenzie, P. I., Owens, I. S., Burchell, B., Bock, K. W., Bairoch, A., Belanger, A., FournelGigleux, S., Green, M., Hum, D. W., Iyanagi, T., Lancet, D., Louisot, P., Magdalou, J., Chowdhury, J. R., Ritter, J. K., Schachter, H., Tephly, T. R., Tipton, K. F. and Nebert, D. W.: The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence. Pharmacogenetics, 7: 255269 (1997). RadominskaPandya, A., Czernik, P. J. and Little, J. M.: Structural and functional studies of UDP glucuronosyltransferases. Drug Metab. Rev., 31: 817899 (1999). Strassburg, C. P., Kneip, S., Topp, J., Obermayer Straub, P., Barut, A., Tukey, R. H. and Manns, M. P.: Polymorphic gene regulation and interindividual variation of UDPglucuronosyltransferase activity in human small intestine. J. Biol. Chem., 275: 3616436171 (2000). Ockenga, J., Vogel, A., Teich, N., Keim, V., Manns, M. P. and Strassburg, C. P.: UDP glucuronosyltransferase (UGT1A7) gene polymorphisms increase the risk of chronic pancreatitis and pancreatic cancer. Gastroen terology, 124: 18021808 (2003). Green, M. D. and Tephly, T. R.: Glucuronidation of amines and hydroxylated xenobiotics and endobiotics catalyzed by expressed human UGT1.4 protein. Drug Metab. Dispos., 24: 356363 (1996). Nakajima, M., Tanaka, E., Kobayashi, T., Ohashi, N., Kume, T. and Yokoi, T.: Imipramine Nglucuronidation in human liver microsomes: biphasic kinetics and charac terization of UDPglucuronosyltransferase isoforms. Drug Metab. Dispos., 30: 636642 (2002). Nakajima, M., Tanaka, E., Kwon, J. T. and Yokoi, T.: Characterization of nicotine and cotinine Nglucuroni dations in human liver microsomes. Drug Metab. Dispos., 30: 14841490 (2002). Kaku, T., Ogura, K., Nishiyama, T., Ohnuma, T., Muro, K. and Hiratsuka, A.: Quaternary ammonium linked glucuronidation of tamoxifen by human liver microsomes and UDPglucuronosyltransferase 1A4. Biochem. Pharmacol., 67: 20932102 (2004). Ehmer, U., Vogel, A., Schutte, J. K., Krone, B., Manns, M. P. and Strassburg, C. P.: Variation of hepatic glucuronidation: Novel functional polymorphisms of the UDPglucuronosyltransferase UGT1A4. Hepatology, 39: 970977 (2004). Kitamura, Y., Moriguchi, M., Kaneko, H., Morisaki, H., Morisaki, T., Toyama, K. and Kamatani, N.: Determination of probability distribution of diplotype conguration (diplotype distribution) for each subject from genotypic data using the EM algorithm. Ann. Hum. Genet., 66: 183193 (2002). Sai, K., Saeki, M., Saito, Y., Ozawa, S., Katori, N.,
Genetic Variations and Haplotypes of UGT1A4
13)
Jinno, H., Hasegawa, R., Kaniwa, N., Sawada, J., Komamura, K., Ueno, K., Kamakura, S., Kitakaze, M., Kitamura, Y., Kamatani, N., Minami, H., Ohtsu, A., Shirao, K., Yoshida, T. and Saijo, N.: UGT1A1 haplotypes associated with reduced glucuronidation and increased serum bilirubin in irinotecanadministered Japanese patients with cancer. Clin. Pharmacol. Ther., 75: 501515 (2004). Kaniwa, N., Kurose, K., Jinno, H., TanakaKagawa, T., Saito, Y., Saeki, M., Sawada, J., Tohkin, M. and Hasegawa, R.: Racial variability in haplotype frequen
14)
15)
SNP20 (151)
cies of UGT1A1 and glucuronidation activity of a novel SNP 686CÀT (P229L) found in an AfricanAmerican. Drug Metab. Dispos., in press. Ritter, J. K., Crawford, J. M. and Owens, I. S.: Cloning of two human liver bilirubin UDPglucuronosyltran sferase cDNAs with expression in COS1 cells. J. Biol. Chem., 266: 10431047 (1991). Ikushiro, S., Emi, Y. and Iyanagi, T.: Activation of glucuronidation through reduction of a disulde bond in rat UDPglucuronosyltransferase 1A6. Biochemistry, 41: 1281312820 (2002).
SNP Communication Genetic Variations and Haplotypes of UGT1A4 in a Japanese Population Mayumi SAEKI1, Yoshiro SAITO1,2,*, Hideto JINNO1,3, Kimie SAI1,4, Akiko HACHISUKA2, Nahoko KANIWA1,5, Shogo OZAWA1,6, Manabu KAWAMOTO7, Naoyuki KAMATANI7, Kuniaki SHIRAO8, Hironobu MINAMI9, Atsushi OHTSU10, Teruhiko YOSHIDA11, Nagahiro SAIJO12, Kazuo KOMAMURA13,14, Takeshi KOTAKE15, Hideki MORISHITA15, Shiro KAMAKURA13, Masafumi KITAKAZE13, Hitonobu TOMOIKE13 and Junichi SAWADA1,2 1Project
Team for Pharmacogenetics, 2Division of Biochemistry and Immunochemistry, of Environmental Chemistry, 4Division of Xenobiotic Metabolism and Disposition, 5Division of Medicinal Safety Science, 6Division of Pharmacology, National Institute of Health Sciences, Tokyo, Japan 7Division of Genomic Medicine, Department of Advanced Biomedical Engineering and Science, Tokyo Women's Medical University, Tokyo, Japan 8Division of Internal Medicine, National Cancer Center Hospital, 11Genetics Division, National Cancer Center Research Institute, National Cancer Center, Tokyo, Japan 9Division of Oncology W Hematology, 10Division of GI OncologyW Digestive Endoscopy, 12Deputy Director, National Cancer Center Hospital East, Chiba, Japan 13Division of Cardiology, 14Department of Cardiovascular Dynamics Research Institute, 15Department of Pharmacy, National Cardiovascular Center, Osaka, Japan 3Division
Full text of this paper is available at http://www.jssx.org
Summary: Nineteen genetic variations, including 11 novel ones, were found in exon 1 and its anking region of the UDPglucuronosyltransferase (UGT) 1A4 gene from 256 Japanese subjects, consisting of 60 healthy volunteers, 88 cancer patients and 108 arrhythmic patients. These variations include |217TÀG and |36GÀA in the 5?anking region, 30GÀA (P10P), 127delA (43fsX22; frameshift from codon 43 resulting in the termination at the 22nd codon, codon 65), 175delG (59fsX6), 271CÀT (R91C), 325AÀG (R109G), and 357TÀC (N119N) in exon 1, and IVS1{1GÀT, IVS1{98AÀG and IVS1{101GÀT in the following intron. Among them, 127delA and 175delG can confer early termina tion of translation, resulting in an immature protein that probably lacks enzymatic activity. Variation IVS1{1GÀT is located at a splice donor site and thus may lead to aberrant splicing. Since we did not nd any signicant dierences in the frequencies of all the variations among the three subject groups, the data were analyzed as one group. The allele frequencies of the novel variations were 0.006 for IVS1{ 101GÀT, 0.004 for 30GÀA (P10P) and 357TÀC (N119N), and 0.002 for the 8 other variations. In addition, the two known nonsynonymous single nucleotide polymorphisms (SNPs), 31CÀT (R11W) and 142TÀG (L48V), were found at 0.012 and 0.129 frequencies, respectively. The SNP 70CÀA (P24T), mostly linked with 142TÀG (L48V) in German Caucasians, was not detected in this study. Sixteen haplotypes were identied or inferred, and some haplotypes were conrmed by cloning and sequencing. It was shown that most of 142TÀG (L48V) was linked with |219CÀT, |163GÀA, 448TÀC (L150L), 804GÀA (P268P), and IVS1{43CÀT, comprising haplotype *3a; haplotype *4a harbors 31CÀT (R11W); 127delA (43fsX22) and 142TÀG (L48V) were linked (haplotype *5a); 175delG (59fsX6) was linked with 325AÀG (R109G) (*6a haplotype); and |219CÀT, |163GÀA, 142TÀG (L48V), 271CÀT (R91C), 448TÀC (L150L), 804GÀA (P268P), and IVS1{43CÀT comprised haplotype *7a. Our results provide fundamental and useful information for genotyping UGT1A4 in the Japanese and probably Asian populations. Key words: UGT1A4; amino acid alteration; frameshift; splice donor site; drug metabolism
Received; December 6, 2004, Accepted; February 17, 2005 To whom correspondence should be addressed : Yoshiro SAITO, Ph.D., Project Team for Pharmacogenetics, National Institute of Health Sciences, 1181 Kamiyoga, Setagayaku, Tokyo 1588501, Japan. Tel. {81337009453, Fax. {81337076950, Email: yoshironihs.go.jp
SNP13 (144)
Genetic Variations and Haplotypes of UGT1A4 Table 1.
SNP14 (145)
Primers utilized for UGT1A4 amplication and sequencing
Direction
Primer Name
Sequences
Locationa
Amplication
forward reverse
UGT1A41stF UGT1A41stR
TTAACAAAGTAGAAGGCAGTG TGAAAACTTGAAATACACTAGGC
135092 136460
Sequencing
forward forward forward reverse reverse reverse
UGT1A41stF UGT1A4seqF2 UGT1A4seqF3 UGT1A4seqR12 UGT1A4seqR2 UGT1A41stR
TTAACAAAGTAGAAGGCAGTG GGGCTGAGAGTGGAAAGGT TCCTTCCTCCTATATTCCTAAGTT ATCAAATTCCTTCTGGGTCC AAGGGGCAGAAAAAGTATGG TGAAAACTTGAAATACACTAGGC
135092 135502 135995 135698 136119 136460
a
The 5?end of each primer on AF297093.1.
On December 2, 2004, these variations were not found on the UDP Glucuronosyltransferase home page (http: WW som.inders.edu.au W FUSA W ClinPharm W UGT W ), the Japanese Single Nucleotide Polymor phisms (JSNP) (http: WW snp.ims.utokyo.ac.jp W ), dbSNP in the National Center for Biotechnology Information (http: WW www.ncbi. nlm.nih.gov W SNP W ), or PharmGKB (http: WW www.pharmgkb.org W do W ) databases. This study was supported by the Program for the Promotion of Fundamental Studies in Health Sciences (MPJ1, 3, and 6) of the Pharmaceuticals and Medical Devices Agency (PMDA) of Japan, and the program for the Promotion of Studies in Health Scrences of the Ministry of Health, Labor and Welfare of Japan.
Introduction As phase II enzymes, the UDPglucuronosyltran sferase enzymes (UGTs) play crucial roles in the detox ication and elimination of a large number of en dogenous and exogenous compounds.1) Of the UGT1 and UGT2 subfamilies expressed in humans, the genes encoding UGT1As have a unique genetic structure consisting of at least 13 dierent exon 1?s, including four inactive ones, and the common exons 2 to 5 clustered on chromosome 2q37.2) One of the exon 1?s can be spliced on to the common exons. The Nterminal domains (encoded by the exon 1?s) of the UGT1A proteins determine their substratebinding specicity, and the common Cterminal domain (encoded by exons 2 to 5) is important for UDPglucuronic acid binding.3) UGT1A4 is expressed in the liver, bile ducts, colon, small intestine, and pancreas.1,4,5) UGT1A4 catalyzes the conjugation of exogenous amines and alcohols, includ ing nicotine, sapogenins, imipramine, triuoperazine, and tamoxifen.1,69) In addition, many androgens and progestins are reported as endogenous substrates of UGT1A4.6) Several genetic polymorphisms of UGT1A4 were reported in the public databases. Among them, two nonsynonymous single nucleotide polymorphisms (SNPs), 70CÀA (P24T) and 142TÀG (L48V), were found in German Caucasians, and they were shown to be closely associated.10) The variant enzymes (24T and
48V) had reduced in vitro activities for bnaphtylamine, benzidine, transandrosterone, and dihydrotestosterone in a substratespecic manner.10) In spite of the clinical importance of UGT1A4, there is no report on the comprehensive sequencing analysis for the genetic polymorphisms of UGT1A4 in Asian populations, including the Japanese. In the present study, UGT1A4 exon 1 was sequenced from 256 Japanese subjects. Eleven novel genetic variations were identied, including 4 nonsynonymous ones. Materials and Methods Human genomic DNA samples: DNA was obtained from the blood leukocytes of 88 Japanese cancer patients and 108 Japanese arrhythmic patients. Written informed consent was obtained from all participating patients. DNA was also extracted from EpsteinBarr virustransformed lymphoblastoid cells, for which blood samples were collected from 60 healthy Japanese volunteers at the Tokyo Women's Medical University under the auspices of the Pharma SNP Consortium (Tokyo, Japan). Informed consent was also obtained from all healthy subjects. The ethical review boards of all the participating organizations approved this study. PCR conditions for DNA sequencing: First, exon 1 of UGT1A4 was amplied from genomic DNA (100 ng) using 0.625 units of ExTaq (Takara Bio. Inc., Shiga, Japan) with 0.2 mM of amplication primers designed in the introns (Table 1). The PCR conditions were 949C for 5 min, followed by 30 cycles of 949 C for 30 sec, 559 C for 1 min, and 729 C for 2 min, and then a nal extension at 729 C for 7 min. These PCR products were then treated with a PCR Product PreSequencing Kit (USB Co., Cleveland, OH, USA) and were directly sequenced on both strands using an ABI Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) (see Table 1 for sequencing primers). The excess dye was removed by a DyeEx96 kit (Qiagen, Hilden, Germany). The eluates were analyzed on an ABI Prism 3700 DNA Analyzer (Applied Biosystems). All variations were conrmed by repeating
SNP15 (146)
Table 2.
Summary of UGT1A4 polymorphisms detected in a Japanese population
SNP ID
This Study
a
Pharm GKB atabaseb
dbSNP NCBI database
JSNP database
rs3732219
IMSJST085729
O
rs3732218
IMSJST085728
O
rs3892221
O
rs2011425
O
rs12468274 rs2011404 rs3732217
IMSJST085727
O O O
rs2011219
IMSJST085726
O
AF297093.1
From the translational initiation site or from the end of exon 1 (IVS1{)
135210 135212 135266 135393 135458 135459 135555 135570 135603 135699 135753 135785 135876 135899 136232 136296 136338 136393 136396
|219 |217 |163 |36 30 31 127 142 175 271 325 357 448 471 804 IVS1{1 IVS1{43 IVS1{98 IVS1{101
Location
5?anking 5?anking 5?anking 5?anking Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Exon 1 Intron 1 Intron 1 Intron 1 Intron 1
Novel variations detected in this study. The SNPs included in the PharmGKB database was shown as ``O''. c T in the reference sequence. b
Number of subjects
Nucleotide change and anking sequences (5? to 3?)
GGGTCAGATGAGCWTTTTTCAAGATAG GTCAGATGAGCTT WGTTCAAGATAGGC TAACGAAAGGCAG W ATTATAGATTAAT CAGGCACAGCGTG WAGGGTGGACAGTC GGTTCCCCTGCCG WACGGCTGGCCACA GTTCCCCTGCCGC WTGGCTGGCCACAG AGCCCCTGGCTCA WGCATGCGGGAGG ATGCGGGAGGCCTWGTGCGGGAGCTCC GGCCACCAGGCGG WTGGTCCTCACCC AAGGAATTTGATC WTGCGTTACGCTGG CATCTTCTGAAGA WGGATATTCTAGAA AATTATGAACAAT WCGTATCTTTGGCC TTTGATGTGGTTT WCTAACAGACCCCG CGTTAACCTCTGC WTcGGGGCGGTGCTG CTACCCCAGGCCG WAATCATGCCCAAC CCACTATCTCAGG WTTCTGTATTGGTG TTCCAGGCAAAAC W TACTTTTTAAAAA ACTTATCTTTCCA WGAAGATTTTATTT TATCTTTCCAAAG WTATTTTATTTTGG
Amino acid change
P10P R11W 43fsX22 L48V 59fsX6 R91C R109G N119N L150L C157C P268P
Frequency
Wild type
Hetero zygote
Homo zygote
Total (n256)
Healthy volunteers (n60)
Cancer patients (n88)
Arrhythmic patients (n108)
195 255 195 255 254 250 255 197 255 255 255 254 195 251 195 255 195 255 253
54 1 54 1 2 6 1 52 1 1 1 2 54 5 54 1 54 1 3
7 0 7 0 0 0 0 7 0 0 0 0 7 0 7 0 7 0 0
0.133 0.002 0.133 0.002 0.004 0.012 0.002 0.129 0.002 0.002 0.002 0.004 0.133 0.010 0.133 0.002 0.133 0.002 0.006
0.133 0.000 0.133 0.000 0.000 0.025 0.000 0.133 0.000 0.000 0.000 0.008 0.133 0.008 0.133 0.000 0.133 0.000 0.008
0.142 0.000 0.142 0.006 0.000 0.011 0.000 0.148 0.000 0.000 0.000 0.006 0.142 0.011 0.142 0.000 0.142 0.006 0.006
0.125 0.005 0.125 0.000 0.009 0.005 0.005 0.111 0.005 0.005 0.005 0.000 0.125 0.009 0.125 0.005 0.125 0.000 0.005
Mayumi SAEKI, et al.
MPJ6äU1A081 MPJ6äU1A082a MPJ6äU1A083 MPJ6äU1A084a MPJ6äU1A085a MPJ6äU1A086 MPJ6äU1A087a MPJ6äU1A088 MPJ6äU1A089a MPJ6äU1A090a MPJ6äU1A091a MPJ6äU1A092a MPJ6äU1A093 MPJ6äU1A094 MPJ6äU1A095 MPJ6äU1A096a MPJ6äU1A097 MPJ6äU1A098a MPJ6äU1A099a
Position
Genetic Variations and Haplotypes of UGT1A4
Fig. 1
SNP16 (147)
SNP17 (148)
Mayumi SAEKI, et al.
Fig. 1. The 4 novel genetic variations with amino acid substitutions and 1 splice donor site variation of human UGT1A4. (A) MPJ6äU1A087 (wildtype, 127A W A; variant, 127A W ). (B) MPJ6äU1A089 (wildtype, 175G W G; variant, 175G W ). (C) MPJ6äU1A090 (wildtype, 271C W C; variant, 271C W T). (D) MPJ6äU1A091 (wildtype, 325A W A; variant, 325A W G). (E) MPJ6äU1A096 (wildtype, IVS1{1G W G; variant, IVS1{1G W T). Arrows indicate the positions of the nucleotide changes.
the PCR on genomic DNA and sequencing the newly generated PCR products. Furthermore, the rare variations found in only one subject were conrmed by sequencing the PCR fragments produced by amplica tion with a high delity DNA polymerase KODPlus (TOYOBO, Tokyo, Japan). Linkage disequilibrium (LD) and haplotype analysis: HardyWeinberg equilibrium analysis and LD analysis were performed by SNPAlyze software (Dynacom Co., Yokohama, Japan). Pairwise LDs were shown in rho square (r 2) values. Some of the haplotypes were unam biguous from the subjects with homozygous SNPs at all sites or a heterozygous SNP at only one site. Separately, the diplotype congurations (a combination of haplo types) were inferred by LDSUPPORT software, which
determines the posterior probability distribution of the diplotype conguration for each subject based on the estimated haplotype frequencies.11) The haplotypes were described as a number plus a small alphabetical letter. Results and Discussion UGT1A4 exon 1 and its anking regions (from |286 bases upstream of the translational start site to 112 bases downstream of the end of exon 1) were sequenced from 256 Japanese subjects. Genbank accession number AF297093.1 was utilized for the reference sequence. Nineteen polymorphisms were detected, including 11 novel ones (2 were in the 5?anking region, 6 in exon 1, and 3 in the following intron) (Table 2). All of the allelic frequencies were in HardyWeinberg equilibrium ( p
b
A of the translational start codon of UGT1A4 is numbered 1. AF297093.1 was used as the reference sequence. The haplotypes were described as a number plus a small alphabetical letter.
SNP18 (149)
a
Table 3.
0.13 or over). Since we did not nd any signicant dierences in the frequencies of all the variations among three subject groups ( pÀ0.25 by x 2 test) and between two of the three groups ( pÀ0.13 by x 2 test or Fisher's exact test), the data for all subjects were analyzed as one group. We found two novel nonsynonymous variations, 271CÀT (R91C) and 325AÀG (R109G), and two novel deletions, 127delA (43fsX22) and 175delG (59fsX6), as individual heterozygotes at a 0.002 frequency. Among them, 127delA (43fsX22) and 175delG (59fsX6) are the frameshift variations starting from codon 43 and 59, respectively, resulting in early stop codons at the 22nd ( i.e. codon 65) and the 6th ( i.e. codon 65) codons, respectively. It is most likely that these variations generate an immature protein that probably has null activity. The functional signicance of 271CÀT (R91C) and 325AÀG (R109G) is currently unknown. Addition ally, IVS1{1GÀT, which was found at a frequency of 0.002, was located at a splice donor site and thus may lead to aberrant splicing (Fig. 1). We also detected two known nonsynonymous SNPs, 31CÀT (R11W) and 142TÀG (L48V), at 0.012 and 0.129 frequencies, respectively. The frequency of 142TÀG (L48V) was almost comparable to that of German Caucasians (0.09).10) L48V was reported to lead to a partial decrease in glucuronidation of bnaphthyla mine and benzidine, a marked decrease in the activity to transandrosterone, and no activity toward di hydrotestosterone in vitro.10) The functional signicance of SNP 31CÀT (R11W) has not been reported yet. High linkage disequilibrium ( r 2»0.89) was observed among |219CÀT, |163GÀA, 142TÀG (L48V), 448TÀC (L150L), 804GÀA (P268P), and IVS1{ 43CÀT. A perfect linkage ( r 21) was found between 175delG and 325AÀG (R109G), but found in only one subject. The r 2 values were below 0.014 between the other pairs of polymorphisms. The SNP 70CÀA (P24T), mostly linked with 142TÀG (L48V) in German Caucasians,10) was not detected in this study. Thus, it must be claried whether the dierences in the linkage of those SNPs may lead to the ethnic dierences in the enzymatic activities of UGT1A4. A similar kind of ethnic dierence has been found in the *IB haplotype, which harbors the three linked SNPs in the 3?untransla ted region of UGT1A common exon 5 found in a Japanese population.12) In Caucasian and African American populations, this linkage of the 3 SNPs was not complete, especially in AfricanAmericans.13) Using the detected SNPs, haplotype analysis was then performed (Table 3). Since UGT1A4*2 [70CÀA (P24T)] and *3 [142TÀG (L48V)] were dened in AF465196 and AF465197 (Genbank accession num bers), respectively, the novel haplotypes with amino acid changes, frameshift variations, or splice donor site
UGT1A4 haplotypes in a Japanese population
Genetic Variations and Haplotypes of UGT1A4
SNP19 (150)
Mayumi SAEKI, et al.
variation, were assigned as haplotypes *4 to *8. Several haplotypes were rst unambiguously assigned by homozygous SNPs at all sites (*1a and *3a) or a heterozygous SNP at only one site (*1b, *1d*1i, *3b, *4a, and *8a). Separately, we estimated the diplotype conguration (a combination of haplotypes) for each subject by LDSUPPORT software. The diplotype congurations of 256 subjects were inferred with probabilities (certainty) of 0.9998 or over, except for one subject. The additionally inferred haplotypes were *1c, *5a, *6a, and *7a. As for one subject with a low probability (who had heterozygous SNPs of |219CÀT, |163 GÀA, 31CÀT, 142TÀG, 448TÀC, 804GÀA, and IVS1{43CÀT), the diplotype was determined by the cloning and sequencing of DNA fragments. One chromosome had haplotype *3a (consisting of |219CÀT, |163 GÀA, 142TÀG, 448TÀC, 804GÀA, and IVS1{43CÀT) and the other had haplotype *4a (31CÀT). Moreover, the data obtained by cloning and sequencing analysis conrmed the presence of haplotypes *5a [127delA (43fsX22) and 142TÀG (L48V)], *6a [175delG (59fsX6) and 325AÀG (R109G)], and *7a [|219CÀT, |163GÀA, 142TÀG (L48V), 271CÀT (R91C), 448TÀC (L150L), 804GÀA (P268P), and IVS1{43CÀT] (Table 3). The most frequent haplotype was *1a (frequency: 0.818), followed by *3a (0.123), *4a (0.012) and *1b (0.010). The frequencies of the other haplotypes were less than 0.01. Since 325AÀG (R109G) was linked with 175delG (59fsX6), the enzymatic activity of this haplotype (*6a) is probably null. The other SNP, 271CÀT confers the R91C substitution. In human UGT1A4, eight cysteine residues were located in the lumenal domain.3,14) Though the disuldebond formation and its sig nicance are not clear in the UGT1A4, it has been reported that the reduction of disuldebonds of rat UGT1A6 with dithiothreitol increases its enzymatic activity in the liver microsomes.15) On the other hand, the alterations of several lumenal cysteines into serine residues seem to reduce the UGT1A6 activity when the mutant enzymes were expressed in COS cells.15) The eect of additional cysteine residue at codon 91 in the UGT1A4 should be determined in the future. In conclusion, we detected 19 polymorphisms, including 11 novel ones, in UGT1A4 from a Japanese population. Using the detected polymorphisms, 16 haplotypes were identied. Our results provide fun damental and useful information for genotyping UGT1A4 in the Japanese, and probably Asian popula tions.
References 1)
2)
3)
4)
5)
6)
7)
8)
9)
10)
11)
Acknowledgments: We thank Ms. Chie Knudsen for her secretarial assistance. 12)
Tukey, R. H. and Strassburg, C. P.: Human UDP glucuronosyltransferase: Metabolism, Expression, and Disease. Annu. Rev. Pharmacol. Toxicol., 40: 581616 (2000). Mackenzie, P. I., Owens, I. S., Burchell, B., Bock, K. W., Bairoch, A., Belanger, A., FournelGigleux, S., Green, M., Hum, D. W., Iyanagi, T., Lancet, D., Louisot, P., Magdalou, J., Chowdhury, J. R., Ritter, J. K., Schachter, H., Tephly, T. R., Tipton, K. F. and Nebert, D. W.: The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence. Pharmacogenetics, 7: 255269 (1997). RadominskaPandya, A., Czernik, P. J. and Little, J. M.: Structural and functional studies of UDP glucuronosyltransferases. Drug Metab. Rev., 31: 817899 (1999). Strassburg, C. P., Kneip, S., Topp, J., Obermayer Straub, P., Barut, A., Tukey, R. H. and Manns, M. P.: Polymorphic gene regulation and interindividual variation of UDPglucuronosyltransferase activity in human small intestine. J. Biol. Chem., 275: 3616436171 (2000). Ockenga, J., Vogel, A., Teich, N., Keim, V., Manns, M. P. and Strassburg, C. P.: UDP glucuronosyltransferase (UGT1A7) gene polymorphisms increase the risk of chronic pancreatitis and pancreatic cancer. Gastroen terology, 124: 18021808 (2003). Green, M. D. and Tephly, T. R.: Glucuronidation of amines and hydroxylated xenobiotics and endobiotics catalyzed by expressed human UGT1.4 protein. Drug Metab. Dispos., 24: 356363 (1996). Nakajima, M., Tanaka, E., Kobayashi, T., Ohashi, N., Kume, T. and Yokoi, T.: Imipramine Nglucuronidation in human liver microsomes: biphasic kinetics and charac terization of UDPglucuronosyltransferase isoforms. Drug Metab. Dispos., 30: 636642 (2002). Nakajima, M., Tanaka, E., Kwon, J. T. and Yokoi, T.: Characterization of nicotine and cotinine Nglucuroni dations in human liver microsomes. Drug Metab. Dispos., 30: 14841490 (2002). Kaku, T., Ogura, K., Nishiyama, T., Ohnuma, T., Muro, K. and Hiratsuka, A.: Quaternary ammonium linked glucuronidation of tamoxifen by human liver microsomes and UDPglucuronosyltransferase 1A4. Biochem. Pharmacol., 67: 20932102 (2004). Ehmer, U., Vogel, A., Schutte, J. K., Krone, B., Manns, M. P. and Strassburg, C. P.: Variation of hepatic glucuronidation: Novel functional polymorphisms of the UDPglucuronosyltransferase UGT1A4. Hepatology, 39: 970977 (2004). Kitamura, Y., Moriguchi, M., Kaneko, H., Morisaki, H., Morisaki, T., Toyama, K. and Kamatani, N.: Determination of probability distribution of diplotype conguration (diplotype distribution) for each subject from genotypic data using the EM algorithm. Ann. Hum. Genet., 66: 183193 (2002). Sai, K., Saeki, M., Saito, Y., Ozawa, S., Katori, N.,
Genetic Variations and Haplotypes of UGT1A4
13)
Jinno, H., Hasegawa, R., Kaniwa, N., Sawada, J., Komamura, K., Ueno, K., Kamakura, S., Kitakaze, M., Kitamura, Y., Kamatani, N., Minami, H., Ohtsu, A., Shirao, K., Yoshida, T. and Saijo, N.: UGT1A1 haplotypes associated with reduced glucuronidation and increased serum bilirubin in irinotecanadministered Japanese patients with cancer. Clin. Pharmacol. Ther., 75: 501515 (2004). Kaniwa, N., Kurose, K., Jinno, H., TanakaKagawa, T., Saito, Y., Saeki, M., Sawada, J., Tohkin, M. and Hasegawa, R.: Racial variability in haplotype frequen
14)
15)
SNP20 (151)
cies of UGT1A1 and glucuronidation activity of a novel SNP 686CÀT (P229L) found in an AfricanAmerican. Drug Metab. Dispos., in press. Ritter, J. K., Crawford, J. M. and Owens, I. S.: Cloning of two human liver bilirubin UDPglucuronosyltran sferase cDNAs with expression in COS1 cells. J. Biol. Chem., 266: 10431047 (1991). Ikushiro, S., Emi, Y. and Iyanagi, T.: Activation of glucuronidation through reduction of a disulde bond in rat UDPglucuronosyltransferase 1A6. Biochemistry, 41: 1281312820 (2002).