- Email: [email protected]
Genetic Variations of the MCT4 (SLC16A3) Gene in the Chinese and Indian Populations of Singapore
Drug Metab. Pharmacokinet. 27 (4): 456464 (2012).
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
Short Communication Genetic Variations of the MCT4 (SLC16A3) Gene in the Chinese and Indian Populations of Singapore Choo Bee L EAN and Edmund Jon Deoon L EE * Department of Pharmacology, Yong Loo Lin School of Medicine, National University of Singapore, Singapore, Singapore
Full text of this paper is available at http://www.jstage.jst.go.jp/browse/dmpk Summary: MCT4 (SLC16A3) is the third member of the monocarboxylate transporter (MCT) family and is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study aimed to identify genetic variations of the SLC16A3 gene that may be present in the ethnic Chinese (n = 95) and Indian (n = 96) groups of the Singaporean population. The genetic variations in the promoter, coding region and exon-intron junctions of the SLC16A3 gene encoding the MCT4 transporter were screened by DNA sequencing. A total of 46 genetic variants were detected in the SLC16A3 gene, of which 33 are novel. Of these variants, 22 are located in the promoter regions, 2 in the 5¤ untranslated region (UTR), 10 in the coding exons (5 nonsynonymous and 5 synonymous variations), 6 in 3¤UTR and 6 in the intron. Of the 5 nonsynonymous variants, only 44C>T (Ala15Val) was predicted by PolyPhen and SIFT as having a potentially damaging effect on protein function, whereas 55G>A (Gly19Ser), 574G>A (Val192Met) and 916G>A (Gly306Ser) had conflicting results between the SIFT and PolyPhen algorithms. Finally, 641C>T (Ser214Phe) was predicted to be a tolerated variant. Keywords: MCT1; pharmacogenetics; single nucleotide polymorphism; lactate transport
of lactic acid into different muscle fibre types. MCT1 expression is the most predominant isoform in oxidative red fibres, whereas MCT4 expression is high in glycolytic white fibres.12,13¥ As glycolytic white fibres are the primary source of lactate formation via anaerobic glycolysis, MCT4 may work as an efflux transporter to mediate the transport of lactic acid out into the interstitial fluid, to be taken up by red oxidative fibres that express primarily MCT1.2,8,9,11,12,14¥ Characterization of MCT4 transport in the Xenopus occyte system revealed MCT4 has lower affinities for both MCT substrates and inhibitors than MCT1.8,9¥ For example, the Km for L-lactate were 3.5 mM and 28 mM for MCT1 and MCT4, respectively.9¥ The properties of MCT4 are suitable for its proposed role in lactic acid efflux from muscle. The very low affinity of MCT4 for L-lactate may slow down the transport of lactic acid from the muscle and thus result in lactic acid accumulation during exercise. The drop of pH in myocytes inhibits the muscle contractile machinery and glycolysis and probably plays an important role in the development of muscle fatigue.9¥ Although such accumu-
Introduction Transport of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies, is mediated by a family of monocarboxylate transporters ¤MCTs¥.1®3¥ The family currently comprises 14 members, of which the first four proteins ¤MCT1®MCT4¥ are involved in the transportation of metabolically important monocarboxylates in a proton-uniport manner.3,4¥ MCT1 is ubiquitously expressed but its expression is prominent in heart and red muscle fibres where it is upregulated in response to exercise, suggesting an important role in lactic acid oxidation.5®7¥ In contrast, the MCT4 member of this family is strongly expressed in tissues that have a high glycolytic activity such as white skeletal muscle fibres, astrocytes, white blood cells, chondrocytes and placenta, suggesting a critical role in lactic acid efflux.3,7®10¥ MCT1 and MCT4 have been reported to be the major MCT isoforms expressed in skeletal muscle2,8,11,12¥ and this appears to be correlated with either the influx or efflux
Received September 2, 2011; Accepted December 28, 2011 J-STAGE Advance Published Date: January 13, 2012, doi:10.2133/dmpk.DMPK-11-SH-104 *To whom correspondence should be addressed: Edmund Jon Deoon LEE, M.D., Ph.D., Department of Pharmacology, National University of Singapore, Block MD11, Clinical Research Centre, Level 5, #05-09, 10 Medical Drive, Singapore 117597, Singapore. Tel. +65-65168437, Fax: +65-67742270, E-mail: [email protected] 456
Population Genetic Variations of MCT4 ¤SLC16A3¥ Gene
lation of lactic acid within myocytes and consequent impairment of glycolysis may impair exercise performance, it serves as a feedback loop to limit the lactic acid production by muscle under extreme exercise conditions and thus prevents the risk of lactic acidosis occurence.9¥ MCTs may be involved in the transport of pharmacologically active compounds across plasma membranes.15¥ These include cholesterol-lowering agents ¤such as lovastatin, simvastatin and atorvastatin¥, È-hydroxybutyrate ¤GHB¥, salicylic acid and valproic acid.16®20¥ As more than one MCT isoform is expressed in the cell-lines that are being used to study transporter kinetics, the involvement of the exact MCT isoform¤s¥ that mediate the transportation of pharmacological compounds cannot be elucidated. Nonetheless, these studies demonstrated the roles of the MCT system in peripheral tissue distribution of drugs. Therefore, a better understanding of the role of MCT transporters in pharmacology is important in more accurately predicting drug efficacy and toxicity. Mutations in MCT transporters may provide an explanation for some pathophysiological conditions. The defects in MCT1 were associated with lactate transport deficiency in human erythrocytes and muscle tissues by Fishbein back in 1986.21¥ To date, there have been no reports on association of impaired MCT4 function with pathophysiological conditions. However, in view of its role in enabling the efflux of lactic acid from glycolytic tissues into blood, any delay in exporting lactic acid may have far-reaching consequences. The main objectives of this study were therefore to: 1¥ describe the single nucleotide polymorphisms in the promoter, exons and exon-intron junctions of SLC16A3 encoding MCT4 that may be present in the ethnic Chinese and Indian groups of the Singapore population and 2¥ predict the effects of SNPs reported in this study using bioinformatics tools. To our knowledge, this is the first report on the comprehensive analysis of the SLC16A3 gene in any population. Materials and Methods Human genomic DNA samples: Genetic materials used in this study were randomly selected from a previouslydeveloped cell repository from healthy volunteers of Chinese and Indian descent. The fully anonymized white cell lines developed from 192 individuals of the ethnic Chinese and Indian of the Singaporean population were screened in this study ¤Chinese, n © 96; Indian, n © 96¥. However, the DNA sample of one Chinese individual was not sufficient for the screening of the entire gene. Hence this subject has been excluded from the study and only 95 ethnic Chinese individuals were involved in this study. All donors had been recruited previously in accordance with requirements of the ethical review board of the National University Hospital, Singapore, and provided written informed consent. The mean age is 24.0 + 5.2 ¤18®48¥ and 21.4 + 3.4 ¤15®43¥ for Chinese and Indians respectively. The male:female sex ratio
457
is 48:47 for Chinese and 57:39 for Indians. Ethnicity was defined through self-declaration by the donors of similar ethnicity through three generations. Genomic DNA was extracted from the immortalized lymphocytes by standard methods. PCR and sequence analysis: The promoter and exonic fragments for the SLC16A3 gene were generated using self-designed primer sequences. These primers were designed using Primer3 software. The regions between bases %1534 and ¦159 of the SLC16A3 transcript variant 2 ¤GenBank accession: NMð001042422.2¥, %531 and ¦14 of SLC16A3 transcript variant 3 ¤GenBank accession: NMð004207.3¥ and %1685 and ¦87 of SLC16A3 transcript variant 4 ¤GenBank accession: NMð001042423.2¥ were screened for SLC16A3 promoter regions. The amplifications were performed in a total volume of 30 µl containing 1' Master Mix ¤Promega, Madison, WI, USA¥, 0.4 µM of each primer ¤Sigma Proligo, Singapore¥ and 60 ng of DNA. The PCR conditions were pre-denaturation at 95ôC for 5 min, followed by 35 cycles of denaturation at 95ôC for 1 min, annealing for 1 min, and extension at 72ôC for 1 min, and then a final extension at 72ôC for 10 min. The annealing temperatures for the promoters and exonic fragments of the SLC16A3 gene are summarized in Table 1. Mutational analysis: Mutational analysis of the candidate genes was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit and run on the automated ABI Prism Model 3100 Avant Genetic Analyzer ¤Applied Biosystems, Foster City, CA, USA¥. In this study, all PCR products were subjected to DNA sequencing. The sequences were analyzed with Mutation Surveyor v2.61 ¤Softgenetics, State College, PA, USA¥ and Chromas ¤Techelysium software¥. PCR was repeated and bidirectional sequencing performed on all detected variants to rule out PCR-induced mutations and sequencing artifacts. The PolyPhen ¤http://genetics.bwh.harvard.edu/pph/¥ and SIFT ¤http://sift.jcvi.org/¥ programs were used to predict the possible impact of amino acid substitution on structure and functions of a human protein. Putative transcription factor binding sites were identified using the MatInspector licensed software ¤Library version: Matrix Library 8.0¥. Results and Discussion Sequence analysis of SLC16A3 from 191 Asian subjects resulted in the identification of 46 genetic variations, of which 33 are novel mutations ¤Tables 2 and 3¥. Of these variants, 22 are located in the promoter regions, 2 in the 5$ untranslated region ¤UTR¥, 10 in the coding exons ¤5 nonsynonymous and 5 synonymous variations¥, 6 in 3$UTR and 6 in the intron. The electropherograms of the five novel nonsynonymous variants of the SLC16A3 gene are shown in Figure 1. The SLC16A3 gene spans approximately 11 kb and is mapped onto chromosome band 17q25.3 in humans. Previously, three transcript variants were described for this
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
458
Choo Bee LEAN and Edmund Jon Deoon LEE
Transcript Variant 4
Transcript Variant 2
Table 1. Primer sequences and PCR conditions used for the analysis of promoter, 5′-UTR, coding and 3′-UTR regions of transcript variants of the SLC16A3 gene Amplified or sequenced region
Forward primer ¤5$ to 3$¥
Promoter 1a Promoter 1b Promoter 1c Promoter 1d Exon 1 Promoter Promoter Promoter Promoter Exon 1 Exon 2 Exon 3 Exon 4a Exon 4b Exon 4c Exon 5a Exon 5b Exon 5c
3a 3b 3c 3d
Reverse primer ¤5$ to 3$¥
Amplified regiona
Length ¤bp¥
Annealing temperature ¤ôC¥
CTCCTTTGTGTGTGAAGGCA GCACGGGCCAACTAAGTAGA CAGGCTCTCTGGCTCTGTCT TCCTCTGGGTAACAACCTGG CATGTTGCAAATGAGAGAAAACA
ACATCCTCCCTCTCTGAGGC GTCTAGTTGTCAGGGCCACC CCCAAACATCAAGATGAGGG ACCGAGACACCTTCCACATC AGGTCCCAACGTCCTCCAG
400006®400558 399670®400123 399253®399779 398866®399358 427045®427519
493 527 454 553 475
60 58 60 58 60
GTCTGCGGGGGTCAGAG CCTCCCGGTCTTCACCTT GCCCTGTGGCTTCGAG AGTGACCCTTATGCCAGGCT GAAACGAATTACCCTTTTCCTG CCACCAGACACCAGGTCAG GTTCCTGAAAAGGTGGCTGTT AGATGAGGGTCTCGGGCTTT GTAGCCCTGTCTTCCTGTGTG CTGGGCTTCATTGACATCTTC CACAAGCTCAGAGGCAGACAG GAGCATTTCCTGAAGGCTGAG CAAGGTTACAAGGCATCCTCAC
GTCTGCGGGGGTCAGAG AAGGAAGGAGCAGTGAGCAA CCTCCACCCTAAAGCCAGT GGACGCTACCGTAATTGCC GGGACCTCTCCAGAAACCTC TTGCTGAGCCCAGCTACAC AAAGCCCGAGACCCTCATCT GAAGACGCTCAGGTCTAGCAG AACATGGAGAAGCTGAAGAGGTAG CCAGCTCTGAGTCCCACACT GAGCCAGTCCAGTTTGTAAAATAAA CATTAAAGTCACGTTGTCTCGAAG GACAGAGCCACGGTAGGAAC
430685®431181 430203®430826 429804®430333 429410®429898 430980®431279 407812®408295 408478®409077 409058®409422 409217®409661 409561®409994 410560®411043 410891®411285 411171®411558
497 624 522 489 300 484 600 365 445 434 484 395 388
60 60 60 60 54 60 63 60 60 60 60 60 67
a
The reference sequence is NTð010663.15.
gene. However, the database has recently been updated and an additional three transcript variants have been deposited ¤http://www.ncbi.nlm.nih.gov/gene/9123; Fig. 2¥. The six transcript variants are created by alternative promoter usage and alternative splicing at the 5$ end of the gene, therefore the protein products for all six transcript variants are identical. As this project was performed prior to the update of the SLC16A3 gene sequence, we intended to screen the promoter regions associated with transcript variant 2, 3 and 4 of the SLC16A3 gene. However, we were unable to sequence the promoter region of transcript variant 3 because of the GC-rich content of this region. The amplification was unsuccessful despite several primer pairs having been designed and a commercial PCR kit having been utilized to amplify this region. Therefore, the genotype information of the promoter region of transcript variant 3 is not included in this report. Sequence analysis revealed 13 and 7 variants in the promoter regions of transcript variant 2 and 4 of the SLC16A3 gene, respectively ¤Table 2¥. The predictive effects of SNPs on the transcriptional regulation of SLC16A3 are summarized in Table 4. The MCT4 protein product is predicted to have 465 amino acids. The MCTs are generally predicted to have twelve transmembrane domains, with both the N- and Ctermini located within the cytoplasm.22¥ It has been proposed that the two halves of the monocarboxylate molecule ¤TM helices 1®6 and 7®12¥ have different functional roles. The N-terminal domains may be involved in energy coupling, correct structure maintenance, and membrane insertion, whereas the C-terminus may be important for the determination of substrate specificity.7¥ Among the novel non-
synonymous variations, 44ChT ¤Ala15Val¥ is located at the intracellular N-terminal of MCT4 protein. Therefore, this mutation is likely to affect transporter function in term of energy coupling. This is consistent with the results obtained using the PolyPhen and SIFT sequence homology-based tools to predict whether the amino acid substitution affects protein function based on sequence homology and the physical properties of the amino acid. The 44ChT ¤Ala15Val¥ variant was predicted by both programs to be probably damaging. The 55GhA ¤Gly19Ser¥ variant is also located at the intracellular N-terminal of the molecule. This variant was only present heterozygously in one Indian subject and was not found in the Chinese population. Although the PolyPhen program predicted that this substitution is benign, it was inconsistent with the results obtained using the SIFT program, which predicted this mutation to be intolerant. Meredith and Christian have aligned all 14 members of human MCT protein sequences using the DIALIGN sequence alignment program; the 55GhA ¤Gly19Ser¥ is located at the consensus region of the molecule.3¥ Therefore, a substitution of nonpolar amino acid glycine to hydrophilic serine is likely to have a significant effect on protein function. Similarly, both 574GhA ¤Val192Met¥ and 916GhA ¤Gly306Ser¥ variants yielded conflicting results between the SIFT and PolyPhen algorithms. Lastly, 641ChT ¤Ser214Phe¥ was predicted to have mildest effect on the protein function by both algorithms. This is also in agreement with the fact that the 641ChT ¤Ser214Phe¥ variant is located at the large intracellular loop between TM segments 6 and 7, which is least conserved among family members. Thus,
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
Table 2. Summary of SLC16A3 variations detected in the promoter and 5′-UTR regions of two transcript variants SNP ID
Transcript variant 2
Allele frequency
This study
Name
dbSNP ¤NCBI¥
Location
PGLðMCT4ð001 PGLðMCT4ð002 PGLðMCT4ð003 PGLðMCT4ð004 PGLðMCT4ð005 PGLðMCT4ð006
%139®1374ChG %139®1281GhA %139®1105ChT %139®845GhA %139®804ChT %139del¤%727®795¥/ %139del¤%727®773¥
Novel Novel rs11077983 Novel rs12453976 rs10704992
Promoter Promoter Promoter Promoter Promoter Promoter
%139®1374a %128®1281a %139®1105a %139®845a %139®804a %139¤%727®795¥/ ¤%727®773¥a
PGLðMCT4ð007 PGLðMCT4ð008 PGLðMCT4ð009 PGLðMCT4ð010 PGLðMCT4ð011 PGLðMCT4ð012 PGLðMCT4ð013 PGLðMCT4ð014 PGLðMCT4ð015
%139®540ChT %139®518GhA %139®477GhT %139®304ChT %139®246ChG %139®45GhT %139®40ChG %41GhA IVS¦100ChT
Novel Novel Novel Novel rs75888222 Novel Novel Novel Novel
Promoter Promoter Promoter Promoter Promoter Promoter Promoter 5$UTR Intron 1
%139®540a %139®518a %139®477a %139®304a %139®246a %139®45a %139®40a %41 E1¦100
CCCCTCCCCTC/GTGAGGGCAGG AGGCCTGGGG/AGTCAGAACCA TGCTGCTCTAC/TGGTGGGGGTT AGGAAGATGGG/AAGCACCACCT CTGCCCTGGGC/TGGGAGCACCA GCGGGAGCACdel¤cacctgccctgggcgggagcaccacctgccctgggcgggagcaccacctgccctgggcgggagcagcac¥ GGGCCAACTAA/GCGGGAGCACdel¤cacctgccctgggcgggagcaccacctgccctgggcgggagcagcac¥GGGCCAACTAA GGGCTTGTAAC/TATTACATAGA AGAACAGGCGG/ACCTTACTGGA GGCTGCAGATG/TGAGAGCCAAG TTCCTGTGGCC/TCTGGCAGGG AGGCCTTACTC/GCCTGGAGCCA GGCTGGAGTCG/TGTGGCTTTGT GAGTCGGTGGC/GTTTGTAGGGC CACCGGGACCG/AGAGAGGAAGC GCGCGCACCTC/TCCCACCAAAG
PGLðMCT4ð016 PGLðMCT4ð017 PGLðMCT4ð018 PGLðMCT4ð019 PGLðMCT4ð020 PGLðMCT4ð021 PGLðMCT4ð022 PGLðMCT4ð023 PGLðMCT4ð024 PGLðMCT4ð025 PGLðMCT4ð026 PGLðMCT4ð007
%118®115GhA %118®130AhC %118®249ChT %118®331GhA %118del¤%436®437¥ %118®502AhG %118®554AhT %118®1131ChA %118®1416ChT %86 AhG IVS1¦21GhC %139®540ChT
Novel Novel rs79034755 rs60910743 rs58263941 rs12450761 rs56043453 Novel Novel rs3176827 Novel Novel
Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter 5$UTR Intron 1 Promoter
%118®115b %118®130b %118®249b %118®331b %118¤%436®437¥b %118®502b %118®554b %118®1131b %118®1416b %86 E1¦21 %139®540a
TCCAGGAAGG/AAAACGAATTA CAGGCAGCTCA/CTGGGATCCAG ACAGGGGCTGC/TGGGGGAAGAA TGCAAGCTCGG/ACCCCGACACC GCGGACACAGdel¤ag¥CGGCAGGGCA GGAGTGGCCAA/GTCCGCAAATG GCCCAGCCCCA/TCTTGGGGCA CCCCACGTCCC/AGCGGCTGGCG TGGGCCACGCC/TGGGCAGCCGC ACGGGCTGACA/GGTCCAGCAGA TGCAGGTCCAG/CACGCCTGAGG GGGCTTGTAAC/TATTACATAGA
Nucleotide change
Chinese ¤n © 190¥
Indians ¤n © 192¥
0.005 ¯ 0.916 ¯ 0.853 0.921c
¯ 0.083 0.875 0.005 0.673 0.833
0.005 ¯ 0.011 ¯ ¯ 0.005 0.005 ¯ ¯
¯ 0.005 ¯ 0.005 0.094 ¯ ¯ 0.005 0.005
0.005 0.937 0.079 0.163 0.105 ¯ 0.926 ¯ ¯ 0.926 0.005 0.005
¯ 0.875 0.156 0.161 0.146 0.146 0.875 0.005 0.01 0.875 ¯ ¯
Population Genetic Variations of MCT4 ¤SLC16A3¥ Gene
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
Transcript variant 4
Position From the translational initiation site or from the end of the nearest exon
a
The transcription initiation site is designated as %139 as it is 139 bases upstream of the translation start site. The nucleotide upstream of the transcription initiation site is designated as %139%n accordingly. n © number of nucleotide ¤NMð001042422.2 was used as the reference sequence¥. The transcription initiation site is designated as %118 as it is 118 bases upstream of the translation start site. The nucleotide upstream of the transcription initiation site is designated as %118%n accordingly. n © number of nucleotide ¤NMð001042423.2 was used as the reference sequence¥. c One of the heterogeneous deletions is deleted from 726 to 773 bp upstream of the transcription initiation start site. This variant is named %139del¤%727®773¥ and it is a novel variant. Search completed: August 2010. b
459
460
Table 3. Summary of SLC16A3 variations detected in the coding and 3′-UTR regions Position
This study
Name
dbSNP ¤NCBI¥
Location
From the translational initiation site or from the end of the nearest exon
PGLðMCT4ð027 PGLðMCT4ð028 PGLðMCT4ð029 PGLðMCT4ð030 PGLðMCT4ð031 PGLðMCT4ð032 PGLðMCT4ð033 PGLðMCT4ð034 PGLðMCT4ð035 PGLðMCT4ð036 PGLðMCT4ð037 PGLðMCT4ð038 PGLðMCT4ð039 PGLðMCT4ð040 PGLðMCT4ð041 PGLðMCT4ð042 PGLðMCT4ð043 PGLðMCT4ð044 PGLðMCT4ð045 PGLðMCT4ð046
21ChT 44ChT 55GhA 117ChT IVS2%149GhT IVS2%114ChT IVS2%52GhA IVS3¦29GhA 574GhA 609GhA 641ChT 831GhA 916GhA 1176GhA 1494ChT 1512ChT 1594ChT 1608ChT 1713GhA 1899GhA
Novel Novel Novel Novel Novel rs72634335 Novel rs7215409 Novel Novel Novel Novel Novel Novel Novel rs78825758 Novel Novel Novel Novel
Exon 2 Exon 2 Exon 2 Exon 2 Intron 2 Intron 2 Intron 2 Intron 3 Exon 4 Exon 4 Exon 4 Exon 4 Exon 4 Exon 5 3$UTR 3$UTR 3$UTR 3$UTR 3$UTR 3$UTR
21 44 55 117 E3%149 E3%114 E3%52 E3¦29 574 609 641 831 916 1176 1494 1512 ¤114¥ 1594 ¤196¥ 1608 ¤210¥ 1713 ¤315¥ 1899 ¤501¥
Allele frequency Nucleotide change
CCGTGGTGGAC/TGAGGGCCCCA GGCGTCAAGGC/TCCCTGACGGC CCCTGACGGCG/AGCTGGGGCTG ACGCCTTCCCC/TAAGGCCGTCAG GCCTGCGCTCG/TGGGAGCCTGC TGGTGCCCCGC/TGGGGGGAGGG GAGCTCAGTCG/AGCTGGCGGGG TGGGCCGCACG/ATGCCAGGAGG CAACTGCTGCG/ATGTGTGCCGC TGGTGGTCACG/AGCCCAGCCGGG CCGCGACCCTC/TCCGGCGCCTG ACATCTTCGCG/ACGGCCGGCCG GTTCTTCAACG/AGCCTCGCGGA TCCTGGCGGGG/AGCCGAGGTGC GGCAGGGCCAC/TGGCTGGGCTC CTCCAGCTGCC/TGGCCCAGCGG AGTGGATCTGC/TGGTGAAGCCA GAAGCCAAGCC/TGCAAGGTTAC TCGAGACAACG/ATGACTTTAAT TGGAGTGTTAG/AGACCAACGGT
úAû of the translation initiation codon ATG is numbered 1 ¤NMð001042422.2 was used as the reference sequence¥. Search completed: August 2010.
Amino acid change
PolyPhen
SIFT
Ala15Val Gly19Ser
Probably damaging Benign
Intolerant Intolerant
Val192Met
Benign
Intolerant
Ser214Phe
Benign
Tolerant
Gly306Ser
Benign
Intolerant
Chinese ¤n © 190¥
Indians ¤n © 192¥
¯ 0.011 ¯ ¯ 0.021 0.095 0.005 0.005 ¯ ¯ 0.005 ¯ 0.005 0.005 ¯ 0.005 0.058 ¯ ¯ 0.016
0.005 0.042 0.005 0.005 ¯ ¯ ¯ 0.042 0.005 0.005 0.005 0.031 ¯ ¯ 0.005 ¯ 0.005 0.005 0.005 ¯
Choo Bee LEAN and Edmund Jon Deoon LEE
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
SNP ID
Population Genetic Variations of MCT4 ¤SLC16A3¥ Gene
Fig. 1. The electropherograms of the five novel nonsynonymous SNPs of SLC16A3 detected in this study (A ¦ green, T ¦ red, C ¦ blue, and G ¦ black)
461
it is likely that substitution may not result in fundamental change. The SIFT algorithm uses sequence homology among related genes and domain across species to predict the impact of all 20 possible amino acids at a given position. SIFT relies solely on sequence for prediction; therefore it has the potential to analyze a larger number of non-synonymous SNPs than tools that use structures.23®27¥ PolyPhen, on the other hand, uses a set of empirical rules based on sequence, phylogenetic, and structural information characterizing a particular variant.28,29¥ One of the possible explanations as to why PolyPhen and SIFT have conflicting results could be that PolyPhen incorporates structural information about the protein to determine if a genetic polymorphism may have an effect on protein function.27¥ SNPs detected in the promoter regions of transcript variant 2 and transcript variant 4 were input into SNP analysis software, SNPAnalyser, to estimate haplotype statistically. The haplotypes and the relative frequencies of the 3 commonest SNPs in both promoter regions are summarized in Tables 5 and 6. In the promoter region of transcript variant 2, haplotype TTDeletion is the commonest in both populations, and it accounts for 84% and 67% of all haplotyes in the Chinese and Indian population, respectively. In the promoter region of transcript variant 4, haplotype TCG is the commonest in both populations. This haplotype accounts for 92% and 86% of all haplotypes in Chinese and Indian populations, respectively. It is uncertain if haplotype TTDeletion and TCG represent the commonest haplotype globally since these have never been reported. In conclusion, a total of 46 genetic variants were detected in the SLC16A3 gene, of which 33 are novel. Of the 5 nonsynonymous variants, only 44ChT ¤Ala15Val¥ was predicted by PolyPhen and SIFT as having a potentially damaging effect on protein function, whereas 55GhA ¤Gly19Ser¥, 574GhA ¤Val192Met¥ and 916GhA ¤Gly306Ser¥
Fig. 2. Monocarboxylate transporter exists in three protein isoforms created by alternative promoter usage and alternative splicing at the 5′ end of the gene Six transcripts have been described for the SLC16A3 gene. All transcript variants are created by alternative promoter usage and alternative splicing at the 5′ end of the gene; therefore the protein products for all six transcript variants are identical. Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
462
Choo Bee LEAN and Edmund Jon Deoon LEE Table 4. The predictive effects of SNP on the transcription factor binding sites of SLC16A3
Transcript Variant 2
Name
New family matrix
%139®1374ChG
Olfactory neuron-specific factor
%139®1281GhA
Glial cells missing homolog 1
PAX6 paired domain and homeodomain are required for binding to this site
%139®1105ChT
X-box binding protein RFX1
Wilms Tumor suppressor
%139®845GhA
MEL1 ¤MDS1/EVI1-like gene 1¥ DNA-binding domain 2 Myogenic bHLH protein myogenin ¤myf4¥
Transcription factor yin yang 2 c-Rel Egr-2/Krox-20 early growth response gene product
%139®804ChT
Stimulating protein 1 Carbohydrate response element binding protein ¤CHREBP¥ and Max-like protein X ¤Mlx¥ bind as heterodimers to glucose-responsive promoters Doublesex and mab-3 related transcription factor 4
Special AT-rich sequence-binding protein 1, predominantly expressed in thymocytes, binds to matrix attachment regions ¤MARs¥
%139®540ChT
Albumin D-box binding protein %139®518GhA
Binding sites for homodimers of large Maf-proteins
%139®477GhT
Neurogenin 1 and 3 ¤ngn1/3¥ binding sites
%139®304ChT %139®246ChG
Wilms Tumor suppressor
¯ Meis homeobox 1
¯
¯ ¯
Olfactory neuron-specific factor
%139®45GhT
¯
%139®40ChG
¯
Spermatogenic Zip 1 transcription factor
%41GhA
¯
Neuron-restrictive silencer factor ¤11 bp spacer between half sites¥
%118®115GhA %118®130AhC %118®249ChT %118®331GhA Transcript Variant 4
Lost family/matrix Insulator protein CTCF ¤CCCTC-binding factor¥ Myeloid zinc finger protein MZF1 Myeloid zinc finger protein MZF1 Glial cells missing homolog 1 B-cell-specific activator protein
¯
Interferon regulatory factor 7 ¤IRF-7¥ LIM homeobox 4, Gsh4 Homeobox and leucine zipper encoding transcription factor
Nuclear factor of activated T-cells 5 ¯
¯
Human zinc finger protein ZNF35
Myeloid zinc finger protein MZF1
¯
¯
%118®502AhG
Autoimmune regulator Transcriptional repressor CDP Nuclear factor Y ¤Y-box binding factor¥ FAST-1 SMAD interacting protein
%118®554AhT
H6 homeodomain HMX3/Nkx5.1 transcription factor
Kruppel-like factor 6
bHLH-PAS type transcription factors NXF/ARNT heterodimer
Activator protein 4
Hypoxia-induced factor-1 ¤HIF-1¥
Myf5 myogenic bHLH protein
%118®1131ChA %118®1416ChT %86AhG
¯
¯ ¯
¯ cAMP-responsive element binding protein Tax/CREB complex
For each SNP allele the transcription factor binding sites were either deleted or generated by the nucleotide exchange. Information on the family matrix can be retrieved from the Genomatrix website ¤http://www.genomatix.de/en/index.html¥.
had conflicting results between the SIFT and PolyPhen algorithms. Finally, 641ChT ¤Ser214Phe¥ was predicted to be a tolerated variant. Most of the novel SNPs detected in this study were only found as heterozygotes in one individual. Therefore, a further study should be performed in a larger population to reflect their frequencies more accurately. Prediction of the effect of SNPs on the variant
protein based on computational modeling location and the physiochemical properties of the amino acids can only be speculative at this moment. The true role of SNPs may only be clarified through functional assays. Nevertheless, the findings of the present study may provide fundamental information for conducting further study on MCT4 transporters.
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
Population Genetic Variations of MCT4 ¤SLC16A3¥ Gene Table 5. Haplotype structure defined by 3 commonest SNPs in the SLC16A3 5′ flanking promoter region of transcript variant 2 in a Singapore population
Haplotype No.
1 2 3 4 5 6
Estimated haplotype frequencies
Polymorphisms
%139® %139® %139del Chinese Indian 1105ChT 804ChT ¤%727®795¥ ¤n © 190¥ ¤n © 192¥ T T C T C T
T C C C T T
Deletion Deletion Wildtype Wildtype Wildtype Wildtype
0.836 0.080 0.062 0.000 0.017 0.000
0.674 0.154 0.120 0.034 0.000 0.013
Total
0.995
0.995
Û2 p-value value
8¥
14.01 4.87 3.68 7.06
9¥
0.000* 0.027* 0.055 0.008*
Haplotype structures were constructed and frequencies estimated using SNPAnalyser software. The haplotypes listed here account for 99.5% of all chromosomes. Observed frequencies for haplotypes 5 and 6 are too small to be considered for the Û2 statistical test of independence. *p g 0.05.
Table 6. Haplotype structure defined by 3 commonest SNPs in the SLC16A3 5′ flanking promoter region of transcript variant 4 in a Singapore population
Haplotype No.
1 2 3 4 5
Estimated haplotype frequencies
Polymorphisms %118® %118® 554AhT 130AhC T A T T T
C A C A A
%86AhG
Chinese Indian ¤n © 190¥ ¤n © 192¥
G A A G A
0.9155 0.0420 0.0160 0.0108 0.0103
0.8646 0.1198 0.0000 0.0052 0.0000
Total
0.995
0.990
7¥
10¥
11¥ 12¥
13¥ 14¥
2
Û p-value value
15¥ 2.56 0.110 7.73 0.005*
Haplotype structures were constructed and frequencies estimated using SNPAnalyser software. The haplotypes listed here account for h99% of all chromosomes. Observed frequencies for haplotypes 3, 4 and 5 are too small to be considered for the Û2 statistical test of independence. *p g 0.05.
16¥
17¥
18¥
References 19¥ 1¥ Halestrap, A. P. and Price, N. T.: The proton-linked monocarboxylate transporter ¤MCT¥ family: structure, function and regulation. Biochem. J., 343¤2¥: 281®299 ¤1999¥. 2¥ Halestrap, A. P. and Meredith, D.: The SLC16 gene family-from monocarboxylate transporters ¤MCTs¥ to aromatic amino acid transporters and beyond. Pflugers Arch., 447: 619®628 ¤2004¥. 3¥ Meredith, D. and Christian, H. C.: The SLC16 monocaboxylate transporter family. Xenobiotica, 38: 1072®1106 ¤2008¥. 4¥ Merezhinskaya, N. and Fishbein, W. N.: Monocarboxylate transporters: past, present, and future. Histol. Histopathol., 24: 243®264 ¤2009¥. 5¥ McCullagh, K. J., Poole, R. C., Halestrap, A. P., Tipton, K. F., OöBrien, M. and Bonen, A.: Chronic electrical stimulation increases MCT1 and lactate uptake in red and white skeletal muscle. Am. J. Physiol., 273: E239®E246 ¤1997¥. 6¥ Pilegaard, H., Domino, K., Noland, T., Juel, C., Hellsten, Y., Halestrap, A. P. and Bangsbo, J.: Effect of high-intensity exercise
20¥
21¥ 22¥ 23¥ 24¥
463
training on lactate/H¦ transport capacity in human skeletal muscle. Am. J. Physiol., 276: E255®E261 ¤1999¥. Juel, C. and Halestrap, A. P.: Lactate transport in skeletal muscle¯role and regulation of the monocarboxylate transporter. J. Physiol., 517¤3¥: 633®642 ¤1999¥. Dimmer, K. S., Friedrich, B., Lang, F., Deitmer, J. W. and Broer, S.: The low-affinity monocarboxylate transporter MCT4 is adapted to the export of lactate in highly glycolytic cells. Biochem. J., 350¤1¥: 219®227 ¤2000¥. Manning Fox, J. E., Meredith, D. and Halestrap, A. P.: Characterisation of human monocarboxylate transporter 4 substantiates its role in lactic acid efflux from skeletal muscle. J. Physiol., 529¤2¥: 285®293 ¤2000¥. Wilson, M. C., Jackson, V. N., Heddle, C., Price, N. T., Pilegaard, H., Juel, C., Bonen, A., Montgomery, I., Hutter, O. F. and Halestrap, A. P.: Lactic acid efflux from white skeletal muscle is catalyzed by the monocarboxylate transporter isoform MCT3. J. Biol. Chem., 273: 15920®15926 ¤1998¥. Bonen, A.: The expression of lactate transporters ¤MCT1 and MCT4¥ in heart and muscle. Eur. J. Appl. Physiol., 86: 6®11 ¤2001¥. Fishbein, W. N., Merezhinskaya, N. and Foellmer, J. W.: Relative distribution of three major lactate transporters in frozen human tissues and their localization in unfixed skeletal muscle. Muscle Nerve, 26: 101®112 ¤2002¥. Pilegaard, H., Terzis, G., Halestrap, A. and Juel, C.: Distribution of the lactate/H¦ transporter isoforms MCT1 and MCT4 in human skeletal muscle. Am. J. Physiol., 276: E843®E848 ¤1999¥. Kobayashi, M., Fujita, I., Itagaki, S., Hirano, T. and Iseki, K.: Transport mechanism for L-lactic acid in human myocytes using human prototypic embryonal rhabdomyosarcoma cell line ¤RD cells¥. Biol. Pharm. Bull., 28: 1197®1201 ¤2005¥. Enerson, B. E. and Drewes, L. R.: Molecular features, regulation, and function of monocarboxylate transporters: implications for drug delivery. J. Pharm. Sci., 92: 1531®1544 ¤2003¥. Nagasawa, K., Nagai, K., Sumitani, Y., Moriya, Y., Muraki, Y., Takara, K., Ohnishi, N., Yokoyama, T. and Fujimoto, S.: Monocarboxylate transporter mediates uptake of lovastatin acid in rat cultured mesangial cells. J. Pharm. Sci., 91: 2605®2613 ¤2002¥. Nagasawa, K., Nagai, K., Ishimoto, A. and Fujimoto, S.: Transport mechanism for lovastatin acid in bovine kidney NBL-1 cells: kinetic evidences imply involvement of monocarboxylate transporter 4. Int. J. Pharm., 262: 63®73 ¤2003¥. Tsuji, A., Saheki, A., Tamai, I. and Terasaki, T.: Transport mechanism of 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors at the blood-brain barrier. J. Pharmacol. Exp. Ther., 267: 1085®1090 ¤1993¥. Wu, X., Whitfield, L. R. and Stewart, B. H.: Atorvastatin transport in the Caco-2 cell model: contributions of P-glycoprotein and the proton-monocarboxylic acid co-transporter. Pharm. Res., 17: 209®215 ¤2000¥. Hosoya, K., Kondo, T., Tomi, M., Takanaga, H., Ohtsuki, S. and Terasaki, T.: MCT1-mediated transport of L-lactic acid at the inner blood-retinal barrier: a possible route for delivery of monocarboxylic acid drugs to the retina. Pharm. Res., 18: 1669® 1676 ¤2001¥. Fishbein, W. N.: Lactate transporter defect: a new disease of muscle. Science, 234: 1254®1256 ¤1986¥. Poole, R. C., Sansom, C. E. and Halestrap, A. P.: Studies of the membrane topology of the rat erythrocyte H¦/lactate cotransporter ¤MCT1¥. Biochem. J., 320¤Pt 3¥: 817®824 ¤1996¥. Ng, P. C. and Henikoff, S.: Accounting for human polymorphisms predicted to affect protein function. Genome Res., 12: 436®446 ¤2002¥. Sunyaev, S., Ramensky, V., Koch, I., Lathe, W., 3rd, Kondrashov,
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
464
Choo Bee LEAN and Edmund Jon Deoon LEE
A. S. and Bork, P.: Prediction of deleterious human alleles. Hum. Mol. Genet., 10: 591®597 ¤2001¥. 25¥ Chasman, D. and Adams, R. M.: Predicting the functional consequences of non-synonymous single nucleotide polymorphisms: structure-based assessment of amino acid variation. J. Mol. Biol., 307: 683®706 ¤2001¥. 26¥ Saunders, C. T. and Baker, D.: Evaluation of structural and evolutionary contributions to deleterious mutation prediction. J. Mol. Biol., 322: 891®901 ¤2002¥. 27¥ Johnson, M. M., Houck, J. and Chen, C.: Screening for deleterious
nonsynonymous single-nucleotide polymorphisms in genes involved in steroid hormone metabolism and response. Cancer Epidemiol. Biomarkers Prev., 14: 1326®1329 ¤2005¥. 28¥ Ramensky, V., Bork, P. and Sunyaev, S.: Human non-synonymous SNPs: server and survey. Nucleic Acids Res., 30: 3894®3900 ¤2002¥. 29¥ Xi, T., Jones, I. M. and Mohrenweiser, H. W.: Many amino acid substitution variants identified in DNA repair genes during human population screenings are predicted to impact protein function. Genomics, 83: 970®979 ¤2004¥.
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
Short Communication Genetic Variations of the MCT4 (SLC16A3) Gene in the Chinese and Indian Populations of Singapore Choo Bee L EAN and Edmund Jon Deoon L EE * Department of Pharmacology, Yong Loo Lin School of Medicine, National University of Singapore, Singapore, Singapore
Full text of this paper is available at http://www.jstage.jst.go.jp/browse/dmpk Summary: MCT4 (SLC16A3) is the third member of the monocarboxylate transporter (MCT) family and is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study aimed to identify genetic variations of the SLC16A3 gene that may be present in the ethnic Chinese (n = 95) and Indian (n = 96) groups of the Singaporean population. The genetic variations in the promoter, coding region and exon-intron junctions of the SLC16A3 gene encoding the MCT4 transporter were screened by DNA sequencing. A total of 46 genetic variants were detected in the SLC16A3 gene, of which 33 are novel. Of these variants, 22 are located in the promoter regions, 2 in the 5¤ untranslated region (UTR), 10 in the coding exons (5 nonsynonymous and 5 synonymous variations), 6 in 3¤UTR and 6 in the intron. Of the 5 nonsynonymous variants, only 44C>T (Ala15Val) was predicted by PolyPhen and SIFT as having a potentially damaging effect on protein function, whereas 55G>A (Gly19Ser), 574G>A (Val192Met) and 916G>A (Gly306Ser) had conflicting results between the SIFT and PolyPhen algorithms. Finally, 641C>T (Ser214Phe) was predicted to be a tolerated variant. Keywords: MCT1; pharmacogenetics; single nucleotide polymorphism; lactate transport
of lactic acid into different muscle fibre types. MCT1 expression is the most predominant isoform in oxidative red fibres, whereas MCT4 expression is high in glycolytic white fibres.12,13¥ As glycolytic white fibres are the primary source of lactate formation via anaerobic glycolysis, MCT4 may work as an efflux transporter to mediate the transport of lactic acid out into the interstitial fluid, to be taken up by red oxidative fibres that express primarily MCT1.2,8,9,11,12,14¥ Characterization of MCT4 transport in the Xenopus occyte system revealed MCT4 has lower affinities for both MCT substrates and inhibitors than MCT1.8,9¥ For example, the Km for L-lactate were 3.5 mM and 28 mM for MCT1 and MCT4, respectively.9¥ The properties of MCT4 are suitable for its proposed role in lactic acid efflux from muscle. The very low affinity of MCT4 for L-lactate may slow down the transport of lactic acid from the muscle and thus result in lactic acid accumulation during exercise. The drop of pH in myocytes inhibits the muscle contractile machinery and glycolysis and probably plays an important role in the development of muscle fatigue.9¥ Although such accumu-
Introduction Transport of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies, is mediated by a family of monocarboxylate transporters ¤MCTs¥.1®3¥ The family currently comprises 14 members, of which the first four proteins ¤MCT1®MCT4¥ are involved in the transportation of metabolically important monocarboxylates in a proton-uniport manner.3,4¥ MCT1 is ubiquitously expressed but its expression is prominent in heart and red muscle fibres where it is upregulated in response to exercise, suggesting an important role in lactic acid oxidation.5®7¥ In contrast, the MCT4 member of this family is strongly expressed in tissues that have a high glycolytic activity such as white skeletal muscle fibres, astrocytes, white blood cells, chondrocytes and placenta, suggesting a critical role in lactic acid efflux.3,7®10¥ MCT1 and MCT4 have been reported to be the major MCT isoforms expressed in skeletal muscle2,8,11,12¥ and this appears to be correlated with either the influx or efflux
Received September 2, 2011; Accepted December 28, 2011 J-STAGE Advance Published Date: January 13, 2012, doi:10.2133/dmpk.DMPK-11-SH-104 *To whom correspondence should be addressed: Edmund Jon Deoon LEE, M.D., Ph.D., Department of Pharmacology, National University of Singapore, Block MD11, Clinical Research Centre, Level 5, #05-09, 10 Medical Drive, Singapore 117597, Singapore. Tel. +65-65168437, Fax: +65-67742270, E-mail: [email protected] 456
Population Genetic Variations of MCT4 ¤SLC16A3¥ Gene
lation of lactic acid within myocytes and consequent impairment of glycolysis may impair exercise performance, it serves as a feedback loop to limit the lactic acid production by muscle under extreme exercise conditions and thus prevents the risk of lactic acidosis occurence.9¥ MCTs may be involved in the transport of pharmacologically active compounds across plasma membranes.15¥ These include cholesterol-lowering agents ¤such as lovastatin, simvastatin and atorvastatin¥, È-hydroxybutyrate ¤GHB¥, salicylic acid and valproic acid.16®20¥ As more than one MCT isoform is expressed in the cell-lines that are being used to study transporter kinetics, the involvement of the exact MCT isoform¤s¥ that mediate the transportation of pharmacological compounds cannot be elucidated. Nonetheless, these studies demonstrated the roles of the MCT system in peripheral tissue distribution of drugs. Therefore, a better understanding of the role of MCT transporters in pharmacology is important in more accurately predicting drug efficacy and toxicity. Mutations in MCT transporters may provide an explanation for some pathophysiological conditions. The defects in MCT1 were associated with lactate transport deficiency in human erythrocytes and muscle tissues by Fishbein back in 1986.21¥ To date, there have been no reports on association of impaired MCT4 function with pathophysiological conditions. However, in view of its role in enabling the efflux of lactic acid from glycolytic tissues into blood, any delay in exporting lactic acid may have far-reaching consequences. The main objectives of this study were therefore to: 1¥ describe the single nucleotide polymorphisms in the promoter, exons and exon-intron junctions of SLC16A3 encoding MCT4 that may be present in the ethnic Chinese and Indian groups of the Singapore population and 2¥ predict the effects of SNPs reported in this study using bioinformatics tools. To our knowledge, this is the first report on the comprehensive analysis of the SLC16A3 gene in any population. Materials and Methods Human genomic DNA samples: Genetic materials used in this study were randomly selected from a previouslydeveloped cell repository from healthy volunteers of Chinese and Indian descent. The fully anonymized white cell lines developed from 192 individuals of the ethnic Chinese and Indian of the Singaporean population were screened in this study ¤Chinese, n © 96; Indian, n © 96¥. However, the DNA sample of one Chinese individual was not sufficient for the screening of the entire gene. Hence this subject has been excluded from the study and only 95 ethnic Chinese individuals were involved in this study. All donors had been recruited previously in accordance with requirements of the ethical review board of the National University Hospital, Singapore, and provided written informed consent. The mean age is 24.0 + 5.2 ¤18®48¥ and 21.4 + 3.4 ¤15®43¥ for Chinese and Indians respectively. The male:female sex ratio
457
is 48:47 for Chinese and 57:39 for Indians. Ethnicity was defined through self-declaration by the donors of similar ethnicity through three generations. Genomic DNA was extracted from the immortalized lymphocytes by standard methods. PCR and sequence analysis: The promoter and exonic fragments for the SLC16A3 gene were generated using self-designed primer sequences. These primers were designed using Primer3 software. The regions between bases %1534 and ¦159 of the SLC16A3 transcript variant 2 ¤GenBank accession: NMð001042422.2¥, %531 and ¦14 of SLC16A3 transcript variant 3 ¤GenBank accession: NMð004207.3¥ and %1685 and ¦87 of SLC16A3 transcript variant 4 ¤GenBank accession: NMð001042423.2¥ were screened for SLC16A3 promoter regions. The amplifications were performed in a total volume of 30 µl containing 1' Master Mix ¤Promega, Madison, WI, USA¥, 0.4 µM of each primer ¤Sigma Proligo, Singapore¥ and 60 ng of DNA. The PCR conditions were pre-denaturation at 95ôC for 5 min, followed by 35 cycles of denaturation at 95ôC for 1 min, annealing for 1 min, and extension at 72ôC for 1 min, and then a final extension at 72ôC for 10 min. The annealing temperatures for the promoters and exonic fragments of the SLC16A3 gene are summarized in Table 1. Mutational analysis: Mutational analysis of the candidate genes was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit and run on the automated ABI Prism Model 3100 Avant Genetic Analyzer ¤Applied Biosystems, Foster City, CA, USA¥. In this study, all PCR products were subjected to DNA sequencing. The sequences were analyzed with Mutation Surveyor v2.61 ¤Softgenetics, State College, PA, USA¥ and Chromas ¤Techelysium software¥. PCR was repeated and bidirectional sequencing performed on all detected variants to rule out PCR-induced mutations and sequencing artifacts. The PolyPhen ¤http://genetics.bwh.harvard.edu/pph/¥ and SIFT ¤http://sift.jcvi.org/¥ programs were used to predict the possible impact of amino acid substitution on structure and functions of a human protein. Putative transcription factor binding sites were identified using the MatInspector licensed software ¤Library version: Matrix Library 8.0¥. Results and Discussion Sequence analysis of SLC16A3 from 191 Asian subjects resulted in the identification of 46 genetic variations, of which 33 are novel mutations ¤Tables 2 and 3¥. Of these variants, 22 are located in the promoter regions, 2 in the 5$ untranslated region ¤UTR¥, 10 in the coding exons ¤5 nonsynonymous and 5 synonymous variations¥, 6 in 3$UTR and 6 in the intron. The electropherograms of the five novel nonsynonymous variants of the SLC16A3 gene are shown in Figure 1. The SLC16A3 gene spans approximately 11 kb and is mapped onto chromosome band 17q25.3 in humans. Previously, three transcript variants were described for this
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
458
Choo Bee LEAN and Edmund Jon Deoon LEE
Transcript Variant 4
Transcript Variant 2
Table 1. Primer sequences and PCR conditions used for the analysis of promoter, 5′-UTR, coding and 3′-UTR regions of transcript variants of the SLC16A3 gene Amplified or sequenced region
Forward primer ¤5$ to 3$¥
Promoter 1a Promoter 1b Promoter 1c Promoter 1d Exon 1 Promoter Promoter Promoter Promoter Exon 1 Exon 2 Exon 3 Exon 4a Exon 4b Exon 4c Exon 5a Exon 5b Exon 5c
3a 3b 3c 3d
Reverse primer ¤5$ to 3$¥
Amplified regiona
Length ¤bp¥
Annealing temperature ¤ôC¥
CTCCTTTGTGTGTGAAGGCA GCACGGGCCAACTAAGTAGA CAGGCTCTCTGGCTCTGTCT TCCTCTGGGTAACAACCTGG CATGTTGCAAATGAGAGAAAACA
ACATCCTCCCTCTCTGAGGC GTCTAGTTGTCAGGGCCACC CCCAAACATCAAGATGAGGG ACCGAGACACCTTCCACATC AGGTCCCAACGTCCTCCAG
400006®400558 399670®400123 399253®399779 398866®399358 427045®427519
493 527 454 553 475
60 58 60 58 60
GTCTGCGGGGGTCAGAG CCTCCCGGTCTTCACCTT GCCCTGTGGCTTCGAG AGTGACCCTTATGCCAGGCT GAAACGAATTACCCTTTTCCTG CCACCAGACACCAGGTCAG GTTCCTGAAAAGGTGGCTGTT AGATGAGGGTCTCGGGCTTT GTAGCCCTGTCTTCCTGTGTG CTGGGCTTCATTGACATCTTC CACAAGCTCAGAGGCAGACAG GAGCATTTCCTGAAGGCTGAG CAAGGTTACAAGGCATCCTCAC
GTCTGCGGGGGTCAGAG AAGGAAGGAGCAGTGAGCAA CCTCCACCCTAAAGCCAGT GGACGCTACCGTAATTGCC GGGACCTCTCCAGAAACCTC TTGCTGAGCCCAGCTACAC AAAGCCCGAGACCCTCATCT GAAGACGCTCAGGTCTAGCAG AACATGGAGAAGCTGAAGAGGTAG CCAGCTCTGAGTCCCACACT GAGCCAGTCCAGTTTGTAAAATAAA CATTAAAGTCACGTTGTCTCGAAG GACAGAGCCACGGTAGGAAC
430685®431181 430203®430826 429804®430333 429410®429898 430980®431279 407812®408295 408478®409077 409058®409422 409217®409661 409561®409994 410560®411043 410891®411285 411171®411558
497 624 522 489 300 484 600 365 445 434 484 395 388
60 60 60 60 54 60 63 60 60 60 60 60 67
a
The reference sequence is NTð010663.15.
gene. However, the database has recently been updated and an additional three transcript variants have been deposited ¤http://www.ncbi.nlm.nih.gov/gene/9123; Fig. 2¥. The six transcript variants are created by alternative promoter usage and alternative splicing at the 5$ end of the gene, therefore the protein products for all six transcript variants are identical. As this project was performed prior to the update of the SLC16A3 gene sequence, we intended to screen the promoter regions associated with transcript variant 2, 3 and 4 of the SLC16A3 gene. However, we were unable to sequence the promoter region of transcript variant 3 because of the GC-rich content of this region. The amplification was unsuccessful despite several primer pairs having been designed and a commercial PCR kit having been utilized to amplify this region. Therefore, the genotype information of the promoter region of transcript variant 3 is not included in this report. Sequence analysis revealed 13 and 7 variants in the promoter regions of transcript variant 2 and 4 of the SLC16A3 gene, respectively ¤Table 2¥. The predictive effects of SNPs on the transcriptional regulation of SLC16A3 are summarized in Table 4. The MCT4 protein product is predicted to have 465 amino acids. The MCTs are generally predicted to have twelve transmembrane domains, with both the N- and Ctermini located within the cytoplasm.22¥ It has been proposed that the two halves of the monocarboxylate molecule ¤TM helices 1®6 and 7®12¥ have different functional roles. The N-terminal domains may be involved in energy coupling, correct structure maintenance, and membrane insertion, whereas the C-terminus may be important for the determination of substrate specificity.7¥ Among the novel non-
synonymous variations, 44ChT ¤Ala15Val¥ is located at the intracellular N-terminal of MCT4 protein. Therefore, this mutation is likely to affect transporter function in term of energy coupling. This is consistent with the results obtained using the PolyPhen and SIFT sequence homology-based tools to predict whether the amino acid substitution affects protein function based on sequence homology and the physical properties of the amino acid. The 44ChT ¤Ala15Val¥ variant was predicted by both programs to be probably damaging. The 55GhA ¤Gly19Ser¥ variant is also located at the intracellular N-terminal of the molecule. This variant was only present heterozygously in one Indian subject and was not found in the Chinese population. Although the PolyPhen program predicted that this substitution is benign, it was inconsistent with the results obtained using the SIFT program, which predicted this mutation to be intolerant. Meredith and Christian have aligned all 14 members of human MCT protein sequences using the DIALIGN sequence alignment program; the 55GhA ¤Gly19Ser¥ is located at the consensus region of the molecule.3¥ Therefore, a substitution of nonpolar amino acid glycine to hydrophilic serine is likely to have a significant effect on protein function. Similarly, both 574GhA ¤Val192Met¥ and 916GhA ¤Gly306Ser¥ variants yielded conflicting results between the SIFT and PolyPhen algorithms. Lastly, 641ChT ¤Ser214Phe¥ was predicted to have mildest effect on the protein function by both algorithms. This is also in agreement with the fact that the 641ChT ¤Ser214Phe¥ variant is located at the large intracellular loop between TM segments 6 and 7, which is least conserved among family members. Thus,
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
Table 2. Summary of SLC16A3 variations detected in the promoter and 5′-UTR regions of two transcript variants SNP ID
Transcript variant 2
Allele frequency
This study
Name
dbSNP ¤NCBI¥
Location
PGLðMCT4ð001 PGLðMCT4ð002 PGLðMCT4ð003 PGLðMCT4ð004 PGLðMCT4ð005 PGLðMCT4ð006
%139®1374ChG %139®1281GhA %139®1105ChT %139®845GhA %139®804ChT %139del¤%727®795¥/ %139del¤%727®773¥
Novel Novel rs11077983 Novel rs12453976 rs10704992
Promoter Promoter Promoter Promoter Promoter Promoter
%139®1374a %128®1281a %139®1105a %139®845a %139®804a %139¤%727®795¥/ ¤%727®773¥a
PGLðMCT4ð007 PGLðMCT4ð008 PGLðMCT4ð009 PGLðMCT4ð010 PGLðMCT4ð011 PGLðMCT4ð012 PGLðMCT4ð013 PGLðMCT4ð014 PGLðMCT4ð015
%139®540ChT %139®518GhA %139®477GhT %139®304ChT %139®246ChG %139®45GhT %139®40ChG %41GhA IVS¦100ChT
Novel Novel Novel Novel rs75888222 Novel Novel Novel Novel
Promoter Promoter Promoter Promoter Promoter Promoter Promoter 5$UTR Intron 1
%139®540a %139®518a %139®477a %139®304a %139®246a %139®45a %139®40a %41 E1¦100
CCCCTCCCCTC/GTGAGGGCAGG AGGCCTGGGG/AGTCAGAACCA TGCTGCTCTAC/TGGTGGGGGTT AGGAAGATGGG/AAGCACCACCT CTGCCCTGGGC/TGGGAGCACCA GCGGGAGCACdel¤cacctgccctgggcgggagcaccacctgccctgggcgggagcaccacctgccctgggcgggagcagcac¥ GGGCCAACTAA/GCGGGAGCACdel¤cacctgccctgggcgggagcaccacctgccctgggcgggagcagcac¥GGGCCAACTAA GGGCTTGTAAC/TATTACATAGA AGAACAGGCGG/ACCTTACTGGA GGCTGCAGATG/TGAGAGCCAAG TTCCTGTGGCC/TCTGGCAGGG AGGCCTTACTC/GCCTGGAGCCA GGCTGGAGTCG/TGTGGCTTTGT GAGTCGGTGGC/GTTTGTAGGGC CACCGGGACCG/AGAGAGGAAGC GCGCGCACCTC/TCCCACCAAAG
PGLðMCT4ð016 PGLðMCT4ð017 PGLðMCT4ð018 PGLðMCT4ð019 PGLðMCT4ð020 PGLðMCT4ð021 PGLðMCT4ð022 PGLðMCT4ð023 PGLðMCT4ð024 PGLðMCT4ð025 PGLðMCT4ð026 PGLðMCT4ð007
%118®115GhA %118®130AhC %118®249ChT %118®331GhA %118del¤%436®437¥ %118®502AhG %118®554AhT %118®1131ChA %118®1416ChT %86 AhG IVS1¦21GhC %139®540ChT
Novel Novel rs79034755 rs60910743 rs58263941 rs12450761 rs56043453 Novel Novel rs3176827 Novel Novel
Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter 5$UTR Intron 1 Promoter
%118®115b %118®130b %118®249b %118®331b %118¤%436®437¥b %118®502b %118®554b %118®1131b %118®1416b %86 E1¦21 %139®540a
TCCAGGAAGG/AAAACGAATTA CAGGCAGCTCA/CTGGGATCCAG ACAGGGGCTGC/TGGGGGAAGAA TGCAAGCTCGG/ACCCCGACACC GCGGACACAGdel¤ag¥CGGCAGGGCA GGAGTGGCCAA/GTCCGCAAATG GCCCAGCCCCA/TCTTGGGGCA CCCCACGTCCC/AGCGGCTGGCG TGGGCCACGCC/TGGGCAGCCGC ACGGGCTGACA/GGTCCAGCAGA TGCAGGTCCAG/CACGCCTGAGG GGGCTTGTAAC/TATTACATAGA
Nucleotide change
Chinese ¤n © 190¥
Indians ¤n © 192¥
0.005 ¯ 0.916 ¯ 0.853 0.921c
¯ 0.083 0.875 0.005 0.673 0.833
0.005 ¯ 0.011 ¯ ¯ 0.005 0.005 ¯ ¯
¯ 0.005 ¯ 0.005 0.094 ¯ ¯ 0.005 0.005
0.005 0.937 0.079 0.163 0.105 ¯ 0.926 ¯ ¯ 0.926 0.005 0.005
¯ 0.875 0.156 0.161 0.146 0.146 0.875 0.005 0.01 0.875 ¯ ¯
Population Genetic Variations of MCT4 ¤SLC16A3¥ Gene
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
Transcript variant 4
Position From the translational initiation site or from the end of the nearest exon
a
The transcription initiation site is designated as %139 as it is 139 bases upstream of the translation start site. The nucleotide upstream of the transcription initiation site is designated as %139%n accordingly. n © number of nucleotide ¤NMð001042422.2 was used as the reference sequence¥. The transcription initiation site is designated as %118 as it is 118 bases upstream of the translation start site. The nucleotide upstream of the transcription initiation site is designated as %118%n accordingly. n © number of nucleotide ¤NMð001042423.2 was used as the reference sequence¥. c One of the heterogeneous deletions is deleted from 726 to 773 bp upstream of the transcription initiation start site. This variant is named %139del¤%727®773¥ and it is a novel variant. Search completed: August 2010. b
459
460
Table 3. Summary of SLC16A3 variations detected in the coding and 3′-UTR regions Position
This study
Name
dbSNP ¤NCBI¥
Location
From the translational initiation site or from the end of the nearest exon
PGLðMCT4ð027 PGLðMCT4ð028 PGLðMCT4ð029 PGLðMCT4ð030 PGLðMCT4ð031 PGLðMCT4ð032 PGLðMCT4ð033 PGLðMCT4ð034 PGLðMCT4ð035 PGLðMCT4ð036 PGLðMCT4ð037 PGLðMCT4ð038 PGLðMCT4ð039 PGLðMCT4ð040 PGLðMCT4ð041 PGLðMCT4ð042 PGLðMCT4ð043 PGLðMCT4ð044 PGLðMCT4ð045 PGLðMCT4ð046
21ChT 44ChT 55GhA 117ChT IVS2%149GhT IVS2%114ChT IVS2%52GhA IVS3¦29GhA 574GhA 609GhA 641ChT 831GhA 916GhA 1176GhA 1494ChT 1512ChT 1594ChT 1608ChT 1713GhA 1899GhA
Novel Novel Novel Novel Novel rs72634335 Novel rs7215409 Novel Novel Novel Novel Novel Novel Novel rs78825758 Novel Novel Novel Novel
Exon 2 Exon 2 Exon 2 Exon 2 Intron 2 Intron 2 Intron 2 Intron 3 Exon 4 Exon 4 Exon 4 Exon 4 Exon 4 Exon 5 3$UTR 3$UTR 3$UTR 3$UTR 3$UTR 3$UTR
21 44 55 117 E3%149 E3%114 E3%52 E3¦29 574 609 641 831 916 1176 1494 1512 ¤114¥ 1594 ¤196¥ 1608 ¤210¥ 1713 ¤315¥ 1899 ¤501¥
Allele frequency Nucleotide change
CCGTGGTGGAC/TGAGGGCCCCA GGCGTCAAGGC/TCCCTGACGGC CCCTGACGGCG/AGCTGGGGCTG ACGCCTTCCCC/TAAGGCCGTCAG GCCTGCGCTCG/TGGGAGCCTGC TGGTGCCCCGC/TGGGGGGAGGG GAGCTCAGTCG/AGCTGGCGGGG TGGGCCGCACG/ATGCCAGGAGG CAACTGCTGCG/ATGTGTGCCGC TGGTGGTCACG/AGCCCAGCCGGG CCGCGACCCTC/TCCGGCGCCTG ACATCTTCGCG/ACGGCCGGCCG GTTCTTCAACG/AGCCTCGCGGA TCCTGGCGGGG/AGCCGAGGTGC GGCAGGGCCAC/TGGCTGGGCTC CTCCAGCTGCC/TGGCCCAGCGG AGTGGATCTGC/TGGTGAAGCCA GAAGCCAAGCC/TGCAAGGTTAC TCGAGACAACG/ATGACTTTAAT TGGAGTGTTAG/AGACCAACGGT
úAû of the translation initiation codon ATG is numbered 1 ¤NMð001042422.2 was used as the reference sequence¥. Search completed: August 2010.
Amino acid change
PolyPhen
SIFT
Ala15Val Gly19Ser
Probably damaging Benign
Intolerant Intolerant
Val192Met
Benign
Intolerant
Ser214Phe
Benign
Tolerant
Gly306Ser
Benign
Intolerant
Chinese ¤n © 190¥
Indians ¤n © 192¥
¯ 0.011 ¯ ¯ 0.021 0.095 0.005 0.005 ¯ ¯ 0.005 ¯ 0.005 0.005 ¯ 0.005 0.058 ¯ ¯ 0.016
0.005 0.042 0.005 0.005 ¯ ¯ ¯ 0.042 0.005 0.005 0.005 0.031 ¯ ¯ 0.005 ¯ 0.005 0.005 0.005 ¯
Choo Bee LEAN and Edmund Jon Deoon LEE
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
SNP ID
Population Genetic Variations of MCT4 ¤SLC16A3¥ Gene
Fig. 1. The electropherograms of the five novel nonsynonymous SNPs of SLC16A3 detected in this study (A ¦ green, T ¦ red, C ¦ blue, and G ¦ black)
461
it is likely that substitution may not result in fundamental change. The SIFT algorithm uses sequence homology among related genes and domain across species to predict the impact of all 20 possible amino acids at a given position. SIFT relies solely on sequence for prediction; therefore it has the potential to analyze a larger number of non-synonymous SNPs than tools that use structures.23®27¥ PolyPhen, on the other hand, uses a set of empirical rules based on sequence, phylogenetic, and structural information characterizing a particular variant.28,29¥ One of the possible explanations as to why PolyPhen and SIFT have conflicting results could be that PolyPhen incorporates structural information about the protein to determine if a genetic polymorphism may have an effect on protein function.27¥ SNPs detected in the promoter regions of transcript variant 2 and transcript variant 4 were input into SNP analysis software, SNPAnalyser, to estimate haplotype statistically. The haplotypes and the relative frequencies of the 3 commonest SNPs in both promoter regions are summarized in Tables 5 and 6. In the promoter region of transcript variant 2, haplotype TTDeletion is the commonest in both populations, and it accounts for 84% and 67% of all haplotyes in the Chinese and Indian population, respectively. In the promoter region of transcript variant 4, haplotype TCG is the commonest in both populations. This haplotype accounts for 92% and 86% of all haplotypes in Chinese and Indian populations, respectively. It is uncertain if haplotype TTDeletion and TCG represent the commonest haplotype globally since these have never been reported. In conclusion, a total of 46 genetic variants were detected in the SLC16A3 gene, of which 33 are novel. Of the 5 nonsynonymous variants, only 44ChT ¤Ala15Val¥ was predicted by PolyPhen and SIFT as having a potentially damaging effect on protein function, whereas 55GhA ¤Gly19Ser¥, 574GhA ¤Val192Met¥ and 916GhA ¤Gly306Ser¥
Fig. 2. Monocarboxylate transporter exists in three protein isoforms created by alternative promoter usage and alternative splicing at the 5′ end of the gene Six transcripts have been described for the SLC16A3 gene. All transcript variants are created by alternative promoter usage and alternative splicing at the 5′ end of the gene; therefore the protein products for all six transcript variants are identical. Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
462
Choo Bee LEAN and Edmund Jon Deoon LEE Table 4. The predictive effects of SNP on the transcription factor binding sites of SLC16A3
Transcript Variant 2
Name
New family matrix
%139®1374ChG
Olfactory neuron-specific factor
%139®1281GhA
Glial cells missing homolog 1
PAX6 paired domain and homeodomain are required for binding to this site
%139®1105ChT
X-box binding protein RFX1
Wilms Tumor suppressor
%139®845GhA
MEL1 ¤MDS1/EVI1-like gene 1¥ DNA-binding domain 2 Myogenic bHLH protein myogenin ¤myf4¥
Transcription factor yin yang 2 c-Rel Egr-2/Krox-20 early growth response gene product
%139®804ChT
Stimulating protein 1 Carbohydrate response element binding protein ¤CHREBP¥ and Max-like protein X ¤Mlx¥ bind as heterodimers to glucose-responsive promoters Doublesex and mab-3 related transcription factor 4
Special AT-rich sequence-binding protein 1, predominantly expressed in thymocytes, binds to matrix attachment regions ¤MARs¥
%139®540ChT
Albumin D-box binding protein %139®518GhA
Binding sites for homodimers of large Maf-proteins
%139®477GhT
Neurogenin 1 and 3 ¤ngn1/3¥ binding sites
%139®304ChT %139®246ChG
Wilms Tumor suppressor
¯ Meis homeobox 1
¯
¯ ¯
Olfactory neuron-specific factor
%139®45GhT
¯
%139®40ChG
¯
Spermatogenic Zip 1 transcription factor
%41GhA
¯
Neuron-restrictive silencer factor ¤11 bp spacer between half sites¥
%118®115GhA %118®130AhC %118®249ChT %118®331GhA Transcript Variant 4
Lost family/matrix Insulator protein CTCF ¤CCCTC-binding factor¥ Myeloid zinc finger protein MZF1 Myeloid zinc finger protein MZF1 Glial cells missing homolog 1 B-cell-specific activator protein
¯
Interferon regulatory factor 7 ¤IRF-7¥ LIM homeobox 4, Gsh4 Homeobox and leucine zipper encoding transcription factor
Nuclear factor of activated T-cells 5 ¯
¯
Human zinc finger protein ZNF35
Myeloid zinc finger protein MZF1
¯
¯
%118®502AhG
Autoimmune regulator Transcriptional repressor CDP Nuclear factor Y ¤Y-box binding factor¥ FAST-1 SMAD interacting protein
%118®554AhT
H6 homeodomain HMX3/Nkx5.1 transcription factor
Kruppel-like factor 6
bHLH-PAS type transcription factors NXF/ARNT heterodimer
Activator protein 4
Hypoxia-induced factor-1 ¤HIF-1¥
Myf5 myogenic bHLH protein
%118®1131ChA %118®1416ChT %86AhG
¯
¯ ¯
¯ cAMP-responsive element binding protein Tax/CREB complex
For each SNP allele the transcription factor binding sites were either deleted or generated by the nucleotide exchange. Information on the family matrix can be retrieved from the Genomatrix website ¤http://www.genomatix.de/en/index.html¥.
had conflicting results between the SIFT and PolyPhen algorithms. Finally, 641ChT ¤Ser214Phe¥ was predicted to be a tolerated variant. Most of the novel SNPs detected in this study were only found as heterozygotes in one individual. Therefore, a further study should be performed in a larger population to reflect their frequencies more accurately. Prediction of the effect of SNPs on the variant
protein based on computational modeling location and the physiochemical properties of the amino acids can only be speculative at this moment. The true role of SNPs may only be clarified through functional assays. Nevertheless, the findings of the present study may provide fundamental information for conducting further study on MCT4 transporters.
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
Population Genetic Variations of MCT4 ¤SLC16A3¥ Gene Table 5. Haplotype structure defined by 3 commonest SNPs in the SLC16A3 5′ flanking promoter region of transcript variant 2 in a Singapore population
Haplotype No.
1 2 3 4 5 6
Estimated haplotype frequencies
Polymorphisms
%139® %139® %139del Chinese Indian 1105ChT 804ChT ¤%727®795¥ ¤n © 190¥ ¤n © 192¥ T T C T C T
T C C C T T
Deletion Deletion Wildtype Wildtype Wildtype Wildtype
0.836 0.080 0.062 0.000 0.017 0.000
0.674 0.154 0.120 0.034 0.000 0.013
Total
0.995
0.995
Û2 p-value value
8¥
14.01 4.87 3.68 7.06
9¥
0.000* 0.027* 0.055 0.008*
Haplotype structures were constructed and frequencies estimated using SNPAnalyser software. The haplotypes listed here account for 99.5% of all chromosomes. Observed frequencies for haplotypes 5 and 6 are too small to be considered for the Û2 statistical test of independence. *p g 0.05.
Table 6. Haplotype structure defined by 3 commonest SNPs in the SLC16A3 5′ flanking promoter region of transcript variant 4 in a Singapore population
Haplotype No.
1 2 3 4 5
Estimated haplotype frequencies
Polymorphisms %118® %118® 554AhT 130AhC T A T T T
C A C A A
%86AhG
Chinese Indian ¤n © 190¥ ¤n © 192¥
G A A G A
0.9155 0.0420 0.0160 0.0108 0.0103
0.8646 0.1198 0.0000 0.0052 0.0000
Total
0.995
0.990
7¥
10¥
11¥ 12¥
13¥ 14¥
2
Û p-value value
15¥ 2.56 0.110 7.73 0.005*
Haplotype structures were constructed and frequencies estimated using SNPAnalyser software. The haplotypes listed here account for h99% of all chromosomes. Observed frequencies for haplotypes 3, 4 and 5 are too small to be considered for the Û2 statistical test of independence. *p g 0.05.
16¥
17¥
18¥
References 19¥ 1¥ Halestrap, A. P. and Price, N. T.: The proton-linked monocarboxylate transporter ¤MCT¥ family: structure, function and regulation. Biochem. J., 343¤2¥: 281®299 ¤1999¥. 2¥ Halestrap, A. P. and Meredith, D.: The SLC16 gene family-from monocarboxylate transporters ¤MCTs¥ to aromatic amino acid transporters and beyond. Pflugers Arch., 447: 619®628 ¤2004¥. 3¥ Meredith, D. and Christian, H. C.: The SLC16 monocaboxylate transporter family. Xenobiotica, 38: 1072®1106 ¤2008¥. 4¥ Merezhinskaya, N. and Fishbein, W. N.: Monocarboxylate transporters: past, present, and future. Histol. Histopathol., 24: 243®264 ¤2009¥. 5¥ McCullagh, K. J., Poole, R. C., Halestrap, A. P., Tipton, K. F., OöBrien, M. and Bonen, A.: Chronic electrical stimulation increases MCT1 and lactate uptake in red and white skeletal muscle. Am. J. Physiol., 273: E239®E246 ¤1997¥. 6¥ Pilegaard, H., Domino, K., Noland, T., Juel, C., Hellsten, Y., Halestrap, A. P. and Bangsbo, J.: Effect of high-intensity exercise
20¥
21¥ 22¥ 23¥ 24¥
463
training on lactate/H¦ transport capacity in human skeletal muscle. Am. J. Physiol., 276: E255®E261 ¤1999¥. Juel, C. and Halestrap, A. P.: Lactate transport in skeletal muscle¯role and regulation of the monocarboxylate transporter. J. Physiol., 517¤3¥: 633®642 ¤1999¥. Dimmer, K. S., Friedrich, B., Lang, F., Deitmer, J. W. and Broer, S.: The low-affinity monocarboxylate transporter MCT4 is adapted to the export of lactate in highly glycolytic cells. Biochem. J., 350¤1¥: 219®227 ¤2000¥. Manning Fox, J. E., Meredith, D. and Halestrap, A. P.: Characterisation of human monocarboxylate transporter 4 substantiates its role in lactic acid efflux from skeletal muscle. J. Physiol., 529¤2¥: 285®293 ¤2000¥. Wilson, M. C., Jackson, V. N., Heddle, C., Price, N. T., Pilegaard, H., Juel, C., Bonen, A., Montgomery, I., Hutter, O. F. and Halestrap, A. P.: Lactic acid efflux from white skeletal muscle is catalyzed by the monocarboxylate transporter isoform MCT3. J. Biol. Chem., 273: 15920®15926 ¤1998¥. Bonen, A.: The expression of lactate transporters ¤MCT1 and MCT4¥ in heart and muscle. Eur. J. Appl. Physiol., 86: 6®11 ¤2001¥. Fishbein, W. N., Merezhinskaya, N. and Foellmer, J. W.: Relative distribution of three major lactate transporters in frozen human tissues and their localization in unfixed skeletal muscle. Muscle Nerve, 26: 101®112 ¤2002¥. Pilegaard, H., Terzis, G., Halestrap, A. and Juel, C.: Distribution of the lactate/H¦ transporter isoforms MCT1 and MCT4 in human skeletal muscle. Am. J. Physiol., 276: E843®E848 ¤1999¥. Kobayashi, M., Fujita, I., Itagaki, S., Hirano, T. and Iseki, K.: Transport mechanism for L-lactic acid in human myocytes using human prototypic embryonal rhabdomyosarcoma cell line ¤RD cells¥. Biol. Pharm. Bull., 28: 1197®1201 ¤2005¥. Enerson, B. E. and Drewes, L. R.: Molecular features, regulation, and function of monocarboxylate transporters: implications for drug delivery. J. Pharm. Sci., 92: 1531®1544 ¤2003¥. Nagasawa, K., Nagai, K., Sumitani, Y., Moriya, Y., Muraki, Y., Takara, K., Ohnishi, N., Yokoyama, T. and Fujimoto, S.: Monocarboxylate transporter mediates uptake of lovastatin acid in rat cultured mesangial cells. J. Pharm. Sci., 91: 2605®2613 ¤2002¥. Nagasawa, K., Nagai, K., Ishimoto, A. and Fujimoto, S.: Transport mechanism for lovastatin acid in bovine kidney NBL-1 cells: kinetic evidences imply involvement of monocarboxylate transporter 4. Int. J. Pharm., 262: 63®73 ¤2003¥. Tsuji, A., Saheki, A., Tamai, I. and Terasaki, T.: Transport mechanism of 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors at the blood-brain barrier. J. Pharmacol. Exp. Ther., 267: 1085®1090 ¤1993¥. Wu, X., Whitfield, L. R. and Stewart, B. H.: Atorvastatin transport in the Caco-2 cell model: contributions of P-glycoprotein and the proton-monocarboxylic acid co-transporter. Pharm. Res., 17: 209®215 ¤2000¥. Hosoya, K., Kondo, T., Tomi, M., Takanaga, H., Ohtsuki, S. and Terasaki, T.: MCT1-mediated transport of L-lactic acid at the inner blood-retinal barrier: a possible route for delivery of monocarboxylic acid drugs to the retina. Pharm. Res., 18: 1669® 1676 ¤2001¥. Fishbein, W. N.: Lactate transporter defect: a new disease of muscle. Science, 234: 1254®1256 ¤1986¥. Poole, R. C., Sansom, C. E. and Halestrap, A. P.: Studies of the membrane topology of the rat erythrocyte H¦/lactate cotransporter ¤MCT1¥. Biochem. J., 320¤Pt 3¥: 817®824 ¤1996¥. Ng, P. C. and Henikoff, S.: Accounting for human polymorphisms predicted to affect protein function. Genome Res., 12: 436®446 ¤2002¥. Sunyaev, S., Ramensky, V., Koch, I., Lathe, W., 3rd, Kondrashov,
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)
464
Choo Bee LEAN and Edmund Jon Deoon LEE
A. S. and Bork, P.: Prediction of deleterious human alleles. Hum. Mol. Genet., 10: 591®597 ¤2001¥. 25¥ Chasman, D. and Adams, R. M.: Predicting the functional consequences of non-synonymous single nucleotide polymorphisms: structure-based assessment of amino acid variation. J. Mol. Biol., 307: 683®706 ¤2001¥. 26¥ Saunders, C. T. and Baker, D.: Evaluation of structural and evolutionary contributions to deleterious mutation prediction. J. Mol. Biol., 322: 891®901 ¤2002¥. 27¥ Johnson, M. M., Houck, J. and Chen, C.: Screening for deleterious
nonsynonymous single-nucleotide polymorphisms in genes involved in steroid hormone metabolism and response. Cancer Epidemiol. Biomarkers Prev., 14: 1326®1329 ¤2005¥. 28¥ Ramensky, V., Bork, P. and Sunyaev, S.: Human non-synonymous SNPs: server and survey. Nucleic Acids Res., 30: 3894®3900 ¤2002¥. 29¥ Xi, T., Jones, I. M. and Mohrenweiser, H. W.: Many amino acid substitution variants identified in DNA repair genes during human population screenings are predicted to impact protein function. Genomics, 83: 970®979 ¤2004¥.
Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX)