Genistein antagonizes inflammatory damage induced by β-amyloid peptide in microglia through TLR4 and NF-κB

Nutrition 30 (2014) 90–95

Contents lists available at ScienceDirect

Nutrition journal homepage: www.nutritionjrnl.com

Basic nutritional investigation

Genistein antagonizes inflammatory damage induced by b-amyloid peptide in microglia through TLR4 and NF-kB Xin Zhou M.Med. a, b, Linhong Yuan M.B.B.S. a, Xia Zhao M.B.B.S. b, Chengcheng Hou M.Med. a, Weiwei Ma M.D. a, Huanling Yu M.D. a, Rong Xiao M.D. a, * a b

Department of Nutrition and Food Hygiene, School of Public Health, Capital Medical University, Beijing, P.R. China Department of Nutrition, Beijing Jishuitan Hospital, Beijing, P.R. China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 3 January 2013 Accepted 4 June 2013

Objectives: Microglia activation and neuroinflammation have been associated with the pathogenesis of neurodegenerative disorders such as Alzheimer’s disease (AD). Toll-like receptor 4 (TLR4) and nuclear factor (NF)-kB–mediated signal pathways exert key modulating roles in the inflammatory processes. The aim of the present study was to investigate whether genistein (Gen) has a neuroprotective effect against inflammatory damage induced by b-amyloid peptide25-35 (Ab25– 35) through the TLR4 and NF-kB-mediated signal pathways. Methods: BV-2 microglia cells were preincubated with Gen for 2 h and then treated with 25 mM Ab25–35 for another 24 h. The expression of inflammatory mediators, TLR4 and NF-kB and the activity of NF-kB were measured. Results: The results showed that Gen could attenuate the cytotoxicity and inflammatory damage induced by Ab25–35. Gen also significantly reversed Ab25–35-induced up-regulation of TLR4 and NF-kB expression and the DNA binding and transcriptional activities of NF-kB. Conclusion: These results indicated that Gen could alleviate the inflammation caused by Ab25–35 treatment, which might be associated with the regulation of the TLR4/NF-kB signal pathway. Ó 2014 Elsevier Inc. All rights reserved.

Keywords: Genistein Neuroinflammation b-amyloid peptides 25-35 TLR4 NF-kB

Introduction Soybeans have been widely consumed throughout the world. Soybean isoflavone (SIF) is a kind of polyphenol phytochemical present in the soybean. Recent studies have found that SIFs not only could be potential anticancer agents [1], anti-osteoporosis agents [2], and cardioprotectants [3], but inhibitors of neurodegeneration [4,5] as well. Genistein (Gen), one of the principal active components of SIF, is reported to have analogous biological activities because of its effect on anti-estrogen [6], antioxidant [7], anti-inflammation [8], and modulation of signaling pathways. It is well recognized that inflammation has been deeply implicated in neurodegenerative diseases such as Alzheimer’s disease (AD) [9]. Microglia, the prime component of an intrinsic immune defense system in the central nervous system, contributes to the pathogenesis of AD [10]. One of the earliest neuropathological changes in patients with AD is the * Corresponding author. Tel.: þ86-10-83911512; fax: þ86-10-83911512. E-mail address: [email protected] (R. Xiao). 0899-9007/$ - see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.nut.2013.06.006

accumulation of activated microglia surrounding b-amyloid peptide (Ab) deposition, which exhibit increased levels of proinflammatory cytokines, complement components, and proteases [11]. With regard to different kinds of surface transmembrane pattern-recognition receptors (PRRs) Ab-recognized, toll-like receptors (TLRs) are the family that have a central role in the initiation of innate immunity against invading microbial pathogens [12]. Most TLRs have been shown to trigger its signaling cascade dependent of myeloid differentiation factor 88 (MyD88). The activated TLRs subsequently modulate inflammation-related transcriptional nuclear factor (NF)-kB and/or activator protein1(AP-1) by recruiting a set of adaptor proteins [13]. The literature have confirmed that TLR2 and TLR4 expression were up-regulated in patients with AD [14–16] and the activity of NF-kB in Ab deposition and degenerative neurons increased [17–19]. All of these indicated that the signaling molecules TLRs and NF-kB might exert an important role in neurodegenerative mechanisms and disease progression. As far as the effect of SIF and Gen is concerned, we previously found that subchronic administration of SIF (80 mg/kg
bw
d-1,

X. Zhou et al. / Nutrition 30 (2014) 90–95

91

Table 1 Primer of IL-1b, IL-10, iNOS, TLR4, NF-kB p65, NF-kB p50 and b-actin and the annealing temperature and fragment length Primer name

Forward sequence (5’-3’)

Prime sequence (5’-3’)

Annealing temperature ( C)

Fragment length (bp)

b-actin IL-1a

atatcgctgcgctggtcgtc agagcatccagcttcaaatctc aggaacctaccagctcactctg tacagccgggaagacaataact cagtggtcagtgtgattgtgg gctccttttctcaagctgatgt atttcgattccgctatgtgtg

aggatggcgtgagggagagc cagttgtctaatgggaacgtca caaagacctctggatcttgacc tccactgccttgctcttatttt gcaatggctacaccaggaata cagaagttgagtttcgggtagg tccgccttctgcttgtagata

60 60 60 60 60 60 60

517 236 431 353 247 312 388

iNOS IL-10 TLR4 NF-kB p65 NF-kB p50

IL, interleukin; iNOS, inducible nitric oxide synthase; TLR, toll-like receptor; NF, nuclear factor

PO for 4 wk) significantly alleviated Ab1-42–induced learning and memory impairment (Morris water maze test) and improved the anti-inflammatory ability in rats [20,21]. Similarly, Gen could antagonize the oxidative damage in PC12 cells induced by Ab25–35 to maintain redox system in normal state [22]. Besides, Gen might also have neuroprotective effect via its anti-inflammatory activity [23]. However, the underlying mechanism for Gen to prevent the inflammatory impairment induced by Ab is still obscure. In the present study, we investigated the effect of Gen on the expression of inflammatory mediators, TLR4 and NF-kB and the activity of NF-kB in Ab25–35 treated microglia to elucidate the possible neuroprotective mechanisms of Gen.

A

Materials and methods Reagents and cells Gen were purchased from Sigma Chemical Co. Ab25–35 (Sigma, USA) was dissolved in deionized distilled water at a concentration of 625 mM. The mixture was stored at 20 C. BV-2 cells were purchased from Cell Resource Center, IBMS, CAMS/PUMC. Cell culture The BV-2 cell line is able to simulate many microglial responses and has been widely used as a microglial model in many experimental studies including AD researches [24]. BV-2 cells were maintained routinely in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum at 37 C in a humidified atmosphere of 5% CO2/95% air. The DMEM was changed every other day, and the

100

1: control

80

2

*

*

Viability

3: 200µM Gen 60

4: 100µM Gen 5: 50µM Gen

40

6: 25µM Gen 20

7: 12.5µM Gen

0 1

B

90

2

3

4

5

†

6

†

80

7

1: control

†

*

2

70 * †

Viability

60

3

50

4:

40 30

5:

20

6:

10

7:

0 1

2

3

4

5

6

7

Fig. 1. (A) The cell viability of BV-2 microglia in different dose of Gen. Cell viability of BV-2 cell from untreated cells (control group); cells exposed to 25 mM Ab25–35 (Ab group); cell exposed to 200 mM genistein (200 mM Gen group); cell exposed to 100 mM genistein (100 mM Gen group); cell exposed to 50 mM genistein (50 mM Gen group); cell exposed to 25 mM genistein (25 mM Gen group); cell exposed to 12.5 mM genistein (12.5 mM Gen group). All data were shown as mean  SE. *P < 0.05 compared with control group. (B) The cell viability of microglia in different groups. Cell viability of BV-2 cell from untreated cells (control group); cells exposed to 25 mM Ab25–35 (Ab group); cells exposed to 200 mM genistein 2 h before 25 mM Ab25–35 was added (200 mM Gen þ Ab group); cells exposed to 100 mM genistein 2 h before 25 mM Ab25–35 was added (100 mM Gen þ Ab group); cells exposed to 50 mM genistein 2 h before 25 mM Ab25–35 was added (50 mM Gen þ Ab group); cells exposed to 25 mM genistein 2 h before 2 5 mM Ab25–35 was added (25 mM Gen þ Ab group); cells exposed to 12.5 mM genistein 2 h before 25 mM Ab25–35 was added (12.5 mM Gen þ Ab group). All data were shown as mean  SE. *P < 0.05 compared with control group; yP < 0.05 compared with Ab25–35 group.

92

X. Zhou et al. / Nutrition 30 (2014) 90–95 0.5 *

iNO S IL-10

0.4 *

0.3

† †

†

0.2 *

†

† †

0.1

0

Control

Gen

Fig. 2. The effect of Gen on the expression of IL-1a, iNOS and IL-10 mRNA in BV-2 microglia induced by Ab25–35. IL-1 a, iNOS and IL-10 expression of BV-2 cells from untreated cells (control group); cells exposed to 25 mM Ab25–35 (Ab group); cells exposed to 50 mM genistein 2 h before 25 mM Ab25–35 was added (Gen þ Ab group); cell exposed to 50 mM genistein (Gen group). All data were shown as mean  SE. *P < 0.05 compared with control group; yP < 0.05 compared with Ab25–35 group.

(Pierce Biotechnology, USA). 60 mg of protein were loaded and separated by a 10% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride blots at the voltage of 60 V for 2 h. The transferred membrane was blocked by fresh blocking buffer (tris-buffered saline, containing 5% nonfat dry milk) at room temperature for 1 h. The different primary antibodies for anti-IL-10 (Abcam Biotechnology, USA), anti-IL-1b (1:200; Santa Cruz Biotechnology, USA), antiiNOS (Abcam Biotechnology, USA), anti-b-actin (Santa Cruz Biotechnology, USA), anti-TLR4 (Abcam Biotechnology, USA), anti-NF-kB p50 (Abcam Biotechnology, USA), and anti-NF-kB p65 (Cell Signaling Technology, USA) were respectively added to the membrane and incubated for 12 h at 4 C. After completing the primary antibody reaction and washed the membrane with trisbuffered saline tween-20 (TBST), the proper secondary antibodies were incubated for 1 h (1:5000 in TBST). The membrane was finally washed with TBST, and ProtoBlotÒ kit (Promege Corporation, Madison, WI, USA) was used to detect the protein and FluoChemÒ FC2 (Alpha Innotech Corporation) was used to photo and analyze the gray value of the protein expression in each group.

cells were plated at an appropriate density (1  106 cells/mL). Based on the study design, BV-2 cells were preincubated with or without Gen for 2 h followed by incubation with 25 mM Ab25–35 for another 24 h, and DMEM was added in the blank control group correspondingly. Measurement of cell viability Cell viability was assessed by Alamar Blue assay (Biosource, USA). Briefly, BV-2 cells were preincubated with or without Gen for 2 h following incubation with 25 mM Ab25–35 for another 24 h. The cells were incubated for 4 h at 37 C after adding 10% Alama Blue to the medium. The absorbance was recorded at 540 nm and 620 nm, respectively, by microtiter plate reader (Tecan, Switzerland). Reverse transcription-polymerase chain reaction Total RNA of BV-2 cells in different treatment groups was purified by using Trizol (Invitrogen, Carlsbad, CA, USA) and reverse transcription was performed by reverse transcriptase kit purchased from Applied Promega (Madison, WI, USA). Briefly, double-stranded DNA was synthesized from 2 mg of total RNA, and used as a template for polymerase chain reaction. The mRNA expression of interleukin (IL)-1b, inducible nitric oxide synthase (iNOS), IL-10, TLR4, NF-kB p65, NF-kB p50, and b-actin (used as an invariant control) in brain were measured. The forward, reverse primer sequence and the annealing temperature are showed in Table 1. After 35 cycles, amplification products were electrophoresed on a 2% agarose gel. Then, FluorChem FC2 software (Alpha Innotech, CA, USA) was used to photo and analyze the gray value of the mRNA expression in each group.

NF-kB dual-luciferase reporter assays BV-2 cells were cotransfected using FUGENE HD transfection reagent (Promega) with 1 mg of pGL4.32 [luc2p/NF-kB-RE/Hygro] vector (Promega) together with 0.2 mg of pRL renilla luciferase reporter vectors (Promega). Transfection was performed according to the supplier’s instructions. Ab25–35 was added to the pretreated cells with Gen. The cells were subsequently cultured for another 24 h. The luciferase activity in each group was measured using the dual-luciferase reporter assay system (Promega) and Chemiluminescence detector (Berthold Corporation, Germany).

Western blot Electrophoretic mobility shift assay BV-2 cells in different treatment groups were harvested and washed with phosphate-buffered saline. The pelleted cells after centrifugation were dissolved in the modified radioimmunoprecipitation buffer containing protease inhibitors. The homogenate was kept at 4 C for 40 min, and then centrifuged at 15,000g for 15 min. Supernatant was separated and collected for protein analysis. The protein concentration was determined by using the bicinchoninic acid protein assay kit

Nuclear protein extracts of BV-2 cells were prepared using NucBuster protein extraction kit (Novagen, Germany). The biotin end-labeled duplex (5’biotin.TAGCATATGCTA.-3’ and 3’-.ATCGTATACGAT.-biotin 5’) from Thermo Scientific of USA was used as a probe. Biotin-labeled oligonucleotide (0.1 mmol) was incubated with BV-2 nuclear protein extract (10 mg) in binding buffer (10 mM

1.2 *

†

0.8

iNOS IL-10

†

*

† † 0.4

†

†

*

0

Control

Gen

Fig. 3. The effect of Gen on the expression of IL-1a, iNOS and IL-10 protein in BV-2 microglia induced by Ab25–35. IL-1a, iNOS and IL-10 expression of BV-2 cells from untreated cells (control group); cells exposed to 25 mM Ab25–35 (Ab group); cells exposed to 50 mM genistein 2 h before 25 mM Ab25–35 was added (Gen þ Ab group); cell exposed to 50 mM genistein (Gen group). All data were shown as mean  SE. *P < 0.05 compared with control group; yP < 0.05 compared with Ab25–35 group.

X. Zhou et al. / Nutrition 30 (2014) 90–95 1.2

*

93

p65 p50

1

TLR4

*

0.8

†

†

†

0.6

†

0.4 0.2 0 Control

Gen

Fig. 4. The effect of Gen on the expression of TLR4, NF-kB p65 and p50 mRNA in BV-2 microglia induced by Ab25–35. TLR4, NF-kB p65 and p50 expression of BV-2 cells from untreated cells (control group); cells exposed to 25 mM Ab25–35 (Ab group); cells exposed to 50 mM genistein 2 hours before 25 mM Ab25–35 was added (Gen þ Ab group); cell exposed to 50 mM genistein (Gen group). All data were shown as mean  SE. *P < 0.05 compared with control group; yP < 0.05 compared with Ab25–35 group.

Tris, pH 7.5, 50 mM KCl, 1 mM dithiothreitol, 1 mg/mL poly(dI–dC)) at room temperature for 20 min. Mixtures were electrophoresed in a 6% nondenaturing polyacrylamide gel in 0.5  TBE buffer at 100 V for 1 h. Separated DNA-containing fragments were transferred to a nylon membrane and detected with the LightShift electrophoretic mobility shift assay (EMSA) Optimization and Control kit (Pierce).

Effect of Gen on mRNA and protein expression of inflammatory mediators in BV-2 microglia As shown in Figures 2 and 3, Ab25–35 treatment remarkably up-regulated the mRNA and protein expression of proinflammatory cytokines: IL-1b and iNOS, and down-regulated the expression of anti-inflammatory mediator IL-10. However, Gen pretreatment could reverse the changes in both mRNA and protein induced by Ab25–35 (Figs. 2 and 3).

Statistical analysis Data were expressed as mean  SE and analyzed with the software SPSS 13.0 (SPSS Inc., Chicago, IL). Normal distribution of data was first tested by ShapiroWilk test, and P > 0.05 was accepted. Statistical analysis was performed by using analysis of variance, followed by post hoc Duncan’s multiple range test. P-value < 0.05 was considered statistically significant.

Effect of Gen on mRNA and protein expression of TLR4, NF-kB p65, and NF-kB p50 in BV-2 microglia Compared with the control group, Ab25–35 treatment significantly increased the mRNA and protein expression of TLR4, NF-kB p65, and NF-kB p50 protein expression. However, Gen pretreatment reversed these changes caused by Ab25–35 treatment. Although there was an increasing trend for the mRNA expression of NF-kB p50 in the Ab25–35 treatment group, no statistical significance was found when compared with other groups (Figs. 4 and 5).

Results Effect of Gen on cell viability in BV-2 microglia To determine the protective effect of Gen against inflammatory damage induced by Ab25–35 treatment, the viability of BV-2 microglia were measured by Alamar Blue assay. Figure 1A shows that compared with the control group, the cell viability was significantly decreased after treatment with 25mM Ab25–35. And treatment with Gen alone had no effect on cell viability except for the highest concentration of Gen (200 mM). However, when the cells were pretreated with 25 mM or 50 mM Gen, the viability was enhanced significantly compared with only the Ab25–35 treated group (Fig. 1B). Because of the better protective effect of 50 mM Gen, it was selected as the concentration used in the experiments discussed here.

1.4

Effect of Gen on the DNA binding and transcriptional activity of NF-kB in BV-2 microglia In order to investigate the inhibitory effect of Gen on Ab25– 35-induced transcriptional and DNA-binding activity of NF-kB, we performed the NF-kB dual-luciferase reporter assays and EMSA. Compared with the control group, the Ab25–35 treatment

p65

*

1.2

p50

*

TLR4

1

*

†

0.8

†

†

†

†

0.6 0.4 0.2 0 Control

Gen

Fig. 5. The effect of Gen on the expression of TLR4, NF-kB p65 and p50 protein in BV-2 microglia induced by Ab25–35. TLR4, NF-kB p65 and p50 expression of BV-2 cells from untreated cells (control group); cells exposed to 25 mM Ab25–35 (Ab group); cells exposed to 50 mM genistein 2 h before 25 mM Ab25–35 was added (Gen þ Ab group); cell exposed to 50 mM genistein (Gen group). All data were shown as mean  SE. *P < 0.05 compared with control group; yP < 0.05 compared with Ab25–35 group.

94

X. Zhou et al. / Nutrition 30 (2014) 90–95

BV-2 microglia treated by Ab25–35 significantly decreased, whereas the mRNA and protein levels of proinflammatory mediators IL-1b and iNOS were significantly increased. Therefore, Gen could alleviate Ab25–35-induced inflammatory response through modulating the expression of inflammatory mediators resulting in enhancing the viability of microglial cells. However, the exact signaling mechanism leading to the release of these glial-derived inflammatory cytokines still needs to be clarified. Individual factors such as cytokine or adhesion molecules only represent a downstream target, whereas TLRs and/or NF-kB may be just the final common pathways or ratelimiting steps in this inflammatory cascade [28,29]. TLRs are important surface receptors of microglia, which have been shown to recognize Ab [30]. In TLR4-deficient microglia, Ab failed to induce NF-kB activation, which proved that TLR4 was required for fibrillar Ab-stimulated microglial activation [31]. In our study, we found the expression of TLR4 in both mRNA and protein levels were up-regulated after Ab administration; whereas Gen pretreatment could reverse the regulation of TLR4 expression induced by Ab25–35. These findings were consistent with a previous report that polyphenol garlic could restrain LPSinduced TLR4 dimerization, thus modulating downstream inflammatory responses [32]. Our previous research also found that intragastric administration of SIF significantly inhibited the expression of TLR2, TLR4, myeloid differentiation factor88 (Myd88), inhibitor kB kinase, and proinflammatory factors in learning-impaired and memory-impaired rats induced by Ab1-42 injection into the lateral ventricle [20,21]. Additionally, polyphenol resveratrol could modulate TANK-binding kinase (TBK) 1 and RIP1 in Toll/IL-1R domain-containing adaptor inducing interferon-a (TRIF) complex to inhibit the LPS-induced activation of TLR3 and TLR4 [33,34]. All these results meant that Gen could exert considerable important role on the expression and activity of TLRs. Additionally, in the downstream signal pathway, Gen might also influence the expression and their activity of molecules, and finally play an anti-inflammatory effect. NF-kB is one of the most important downstream transcription factors in TLR signaling pathways [35]. In fact, studies have shown that, accompanied by a significant increase of proinflammatory cytokines, NF-kB is activated in glial cells in patients with AD and these activated NF-kBs also are found in neurons in Ab plaquesurrounding areas [36,37]. Once activated in cytoplasm, NF-kB p65 and p50 complex will translocate to nucleus and bind with DNA consensus sequence to induce inflammation-related transcriptional processes [38].

70

*

60 50

† 40

†

30 20 10 0 Control

Gen

Fig. 6. The effect of Gen on the transcriptional activity of NF-kB in BV-2 microglia induced by Ab25–35. The transcriptional activity of NF-kB in BV-2 cells from untreated cells (control group); cells exposed to 25 mM Ab25–35 (Ab group); cells exposed to 50 mM genistein 2 h before 25 mM Ab25–35 was added (Gen þ Ab group); cell exposed to 50 mM genistein (Gen group). All data were shown as mean  SE. *P < 0.05 compared with control group; yP < 0.05 compared with Ab25–35 group.

group significantly up-regulated the transcriptional and DNAbinding activity of NF-kB. Gen inhibited the increase of activity and subsequently alleviated NF-kB-induced inflammationassociated gene transcription (Figs. 6 and 7). Discussion The pretreatment of 50 mM Gen significantly prevented the decrease of the cell viability of BV-2 microglia induced by Ab25–35. Gen could reduce the inflammatory response caused by Ab25–35. Furthermore, Gen significantly inhibited the upregulation of the expression of TLR4, NF-kB, and the activity of NF-kB induced by Ab25–35 in microglia. These results indicated Gen protected microglia from the damage caused by Ab25–35 through the mechanisms of modulating inflammatory response. TLR4 and NF-kB signal pathways could be involved in these processes. The neuroinflammation is predominantly mediated by activated microglial cells that are stimulated by proinflammatory inducers such as Ab. The microglia produce a wide spectrum of proinflammatory cytokines such as IL-1b, tumor necrosis factor (TNF)-a, cyclooxygenase (COX)-2, and iNOS, which ultimately induce neuronal cell damage in the AD-affected brain [25–27]. In the study, the cell viability and anti-inflammatory factor IL-10 of

600 * 500 400 †

300 200

†

100 0 Control

Gen

Fig. 7. The effect of Gen on the DNA-binding activity of NF-kB in microglia induced by Ab25–35. The DNA-binding activity of NF-kB in BV-2 cells from untreated cells (control group); cells exposed to 25 mM Ab25–35 (Ab group); cells exposed to 50 mM genistein 2 h before 25 mM Ab25–3535 was added (Gen þ Ab group); cell exposed to 50 mM genistein (Gen group). All data were shown as mean  SE. *P < 0.05 compared with control group; yP < 0.05 compared with Ab25–35 group.

X. Zhou et al. / Nutrition 30 (2014) 90–95

In the present study, we provided direct evidence that Ab25–35 treatment significantly increased the expression of p65 and p50 subunits and the transcriptional and DNA-binding activity of NF-kB. The results also were consistent with our previous research, which showed that nuclear translocation of p65 subunits and the expression of signaling molecules Myd88 and inhibitor kB kinase (IKK) were increased, and the expression of inhibitor kB-a (IkB-a) was decreased in rats with injection of Ab1-42 [20,21]. Gen/SIF not only could prevent the up-regulation of the expression of NF-kB subunits induced by Ab, it also could inhibit the translocation and binding of NF-kB and downstream inflammatory reaction. In summary, pretreatment with Gen significantly alleviated Ab25–35-induced inflammatory damage, which was evidenced by increasing cell viability, up-regulated expression of proinflammatory mediators and down-regulated anti-inflammatory factors compared with the Ab25–35 group. In these processes, the role of TLRs and NF-kB could not be ignored. Gen’s antiinflammatory effect could be due to inhibiting the expression of TLR4, NF-kB, and the activity of NF-kB. These findings suggest that the consumption of a diet containing plant polyphenol Gen might be a possible preventive and/or complementary therapy in maintaining a good quality of life in patients affected by neurodegenerative diseases caused by neuroinflammation, such as AD. Acknowledgments This work was supported by the grants from Beijing Municipal Natural Science Foundation (No.7102015), National Natural Science Foundation of China (No. 30972470), and the National High Technology Research and Development Program (863 Program) of China (No. 2010AA023003).

[14] [15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25] [26]

References [1] Messina M. A brief historical overview of the past two decades of soy and isoflavone research. J Nutr 2010;140:1350S–4S. [2] Taku K, Melby MK, Takebayashi J, Mizuno S, Ishimi Y, Omori T, et al. Effect of soy isoflavone extract supplements on bone mineral density in menopausal women: meta-analysis of randomized controlled trials. Asia Pac J Clin Nutr 2010;19:33–42. rez MA, Tarın JJ. Isoflavones and cardiovascular disease. [3] Cano A, Garcıa-Pe Maturitas 2010;67:219–26. [4] Yang H, Jin G, Ren D, Luo S, Zhou T. Mechanism of isoflavone aglycone’s effect on cognitive performance of senescence-accelerated mice. Brain Cogn 2011;76:206–10. [5] Rettberg JR, Hamilton RT, Mao Z, To J, Zhao L, Appt SE, et al. The effect of dietary soy isoflavones before and after ovariectomy on hippocampal protein markers of mitochondrial bioenergetics and antioxidant activity in female monkeys. Brain Res 2011;16:23–33. [6] Isoda H, Talorete TP, Kimura M, Maekawa T, Inamori Y, Nakajima N, et al. Phytoestrogens genistein and daidzin enhance the acetylcholinesterase activity of the rat pheochromocytoma cell line PC12 by binding to the estrogen receptor. Cytotechnology 2002;40:117–23. [7] Xi YD, Yu HL, Ma WW, Ding BJ, Ding J, Yuan LH, et al. Genistein inhibits mitochondrial-targeted oxidative damage induced by beta-amyloid peptide 25–35 in PC12 cells. J Bioenerg Biomembr 2011;43:399–407. [8] Soraya LV, Pablo DG, Juan G, Consuelo B, Ana L, Federico V, et al. Estradiol or genistein prevent Alzheimer’s disease-associated inflammation correlating with an increase PPARa expressionin cultured astrocytes. Brain Res 2010;1312:138–44. [9] Brent C, Gary EL. Inflammation, microglia, and Alzheimer’s disease. Neurobiol Dis 2010;37:503–9. [10] Solito E, Sastre M. Microglia function in Alzheimer’s disease. Front Pharmacol 2012;3:1–10. [11] Schwab C, McGeer PL. Inflammatory aspects of Alzheimer disease and other neurodegenerative disorders. J Alzheimers Dis 2008;13:359–69. [12] Arroyo DS, Soria JA, Gaviglio EA, Rodriguez-Galan MC, Iribarren P. Toll-like receptors are key players in neurodegeneration. Int Immunopharmacol 2011;11:1415–21. [13] Hashimoto M, Hossain S, Tanabe Y, Kawashima A, Harada T, Yano T. The protective effect of dietary eicosapentaenoic acid against impairment of

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35] [36] [37]

[38]

95

spatial cognition learning ability in rats infused with amyloid b (1–40). J Nutr Biochem 2009;20:965–73. Okun E, Griffioen KJ, Lathia JD, Tang SC, Mattson MP, Arumugam TV. Toll-like receptors in neurodegeneration. Brain Res Rev 2009;59:278–92. Walter S, Letiembre M, Liu Y, Heine H, Penke B, Hao W, et al. Role of the toll-like receptor 4 in neuroinflammation in Alzheimer’s disease. Cell Physiol Biochem 2007;20:947–56. Letiembre M, Liu Y, Walter S, Hao W, Pfander T, Wrede A, et al. Screening of innate immune receptors in neurodegenerative diseases: a similar pattern. Neurobiol Aging 2009;30:759–68. Caballero B, Coto-Montes A. An insight into the role of autophagy in cell responses in the aging and neurodegenerative brain. Histol Histopathol 2012;27:263–75. Liao Y, Guan ZZ, Ravid R. Changes of nuclear factor and inflammatory chemotactic factors in brain of patients with Alzheimer’s disease. Zhonghua Bing Li Xue Za Zhi 2011;40:585–9. valo-Serrano J, Carrero I, Gonzalo MR, Martin B, Sanz-Anquela JM, Are Gonzalo-Ruiz A. Oligomers of beta-amyloid protein (Ab1-42) induce the activation of cyclooxygenase-2 in astrocytes via an interaction with interleukin-1beta, tumour necrosis factor-alpha, and a nuclear factor kappa-B mechanism in the rat brain. Exp Neurol 2012;236:215–27. Ding BJ, Ma WW, He LL, Zhou X, Yuan LH, Yu HL, et al. Soybean isoflavone alleviates b-amyloid 1-42 induced. inflammatory response to improve learning and memory ability by down regulation of Toll-like receptor 4 expression and nuclear factor-kB activity in rats. Int J Dev Neurosci 2011;29:537–42. Yuan LH, Zhou X, Li D, Ma WW, Yu HL, Xi YD, et al. Pattern recognition receptors involved in the inflammatory attenuating effects of soybean isoflavone in b-amyloid peptides 1-42 treated rats. Neurosci Lett 2012;506:266–70. Ma WW, Xiang L, Yu HL, Yuan LH, Guo AM, et al. Neuroprotection of soyabean isoflavone co-administration with folic acid against beta-amyloid 1-40-induced neurotoxicity in rats. Br J Nutr 2009;102:502–5. Hsieh HM, Wu WM, Hu ML. Genistein attenuates D-galactose-induced oxidative damage through decreased reactive oxygen species and NF-kB binding activity in neuronal PC12 cells. Life Sci 2011;88:82–8. Henn A, Lund S, Hedtjärn M, Schrattenholz A, Pörzgen P, Leist M. The suitability of BV2 cells as alternative model system for primary microglia cultures or for animal experiments examining brain inflammation. ALTEX 2009;26:83–94. Morales I, Farıas G, Maccioni RB. Neuroimmunomodulation in the pathogenesis of Alzheimer’s disease. Neuroimmunomodulation 2010;17:202–4. Heneka MT, O’Banion MK. Inflammatory processes in Alzheimer’s disease. J Neuroimmunol 2007;184:69–91. Salminen A, Ojala J, Kauppinen A, Kaarniranta K, Suuronen T. Inflammation in Alzheimer’s disease: Amyloid- b oligomers trigger innate immunity defence via pattern recognition receptors. Prog Neurobiol 2009;87:181–94. Wu M, Bian Q, Liu Y, Fernandes AF, Taylor A, Pereira P, et al. Sustained oxidative stress inhibits NF-kB activation partially via inactivating the proteasome. Free Radic Biol Med 2009;46:62–9. He FQ, Qiu BY, Zhang XH, Li TK, Xie Q, Cui DJ, et al. Tetrandrine attenuates spatial memory impairment and hippocampal neuroinflammation via inhibiting NF-kB activation in a rat model of Alzheimer’s disease induced by amyloid-b (1-42). Brain Res 2011;1384:89–96. Frank S, Copanaki E, Burbach GJ, Müller UC, Deller T. Differential regulation of toll-like receptor mRNAs in amyloid plaque-associated brain tissue of aged APP23 transgenic mice. Neurosci Lett 2009;453:41–4. Reed-Geaghan EG, Savage JC, Hise AG, Landreth GE. CD14 and toll-like receptors 2 and 4 are required for fibrillar Ab-stimulated microglial activation. J Neurosci 2009;29:11982–92. Youn HS, Lim HJ, Lee HJ, Hwang D, Yang M, Jeon R, Ryu JH. Garlic (Allium sativum) extract inhibits lipopolysaccharide-induced Toll-like receptor 4 dimerization. Biosci Biotechnol Biochem 2008;72:368–75. Kim MH, Yoo DS, Lee SY, Byeon SE, Lee YG, Min T. The TRIF/TBK1/IRF-3 activation pathway is the primary inhibitory target of resveratrol, contributing to its broad-spectrum anti-inflammatory effects. Pharmazie 2011;66:293–300. Youn HS, Lee JY, Fitzgerald KA, Young HA, Akira S, Hwang DH. Specific inhibition of MyD88-independent signaling pathways of TLR3 and TLR4 by resveratrol: molecular targets are TBK1 and RIP1 in TRIF complex. J Immunol 2005;175:3339–46. Kawai T, Akira S. Signaling to NF-kappaB by Toll-like receptors. Trends Mol Med 2007;13:460–9. Falsig J, Van Beek J, Hermann C, Leist M. Molecular basis for detection of invading pathogens in the brain. J Neurosci Res 2008;86:1434–47. Chen G, Zhang S, Shi J, Ai J, Qi M, Hang C. Simvastatin reduces secondary brain injury caused by cortical contusion in rats: possible involvement of TLR4/NF-kappaB pathway. Exp Neurol 2009;216:398–406. Salminen A, Huuskonen J, Ojala J, Kauppinen A, Kaarniranta K, Suuronen T. Activation of innate immunity system during aging: NF-kB signaling is the molecular culprit of inflamm-aging. Ageing Res Rev 2008;7:83–105.