- Email: [email protected]
Genome sequence analysis and organization of the Hyphantria cunea granulovirus (HycuGV-Hc1) from Turkey
Genomics xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Genomics journal homepage: www.elsevier.com/locate/ygeno
Genome sequence analysis and organization of the Hyphantria cunea granulovirus (HycuGV-Hc1) from Turkey ⁎
Donus Gencer, Zeynep Bayramoglu, Remziye Nalcacioglu, Zihni Demirbag, Ismail Demir Karadeniz Technical University, Faculty of Science, Department of Biology, 61080 Trabzon, Turkey
A R T I C LE I N FO
A B S T R A C T
Keywords: Granulovirus Hyphantria cunea Complete genome sequence HycuGV Baculovirus
The fall webworm (Hyphantria cunea) impacts a wide variety of crops and cultivated broadleaf plant species. The pest is native to North America, was introduced to Europe and has since spread further as far as central Asia. Despite several attempts to control its distribution, the pest continues to spread causing damage all over the world. A naturally occurring baculovirus, Hyphantria cunea granulovirus (HycuGV-Hc1), isolated from the larvae of H. cunea in Turkey appears to have a potential as microbial control agent against this pest. In this report we describe the complete genome sequence and organization of the granulovirus isolate (HycuGV-Hc1) that infects the larval stages and compare it to other baculovirus genomes. The HycuGV-Hc1 genome is a circular doublestranded DNA of 114,825 bp in size with a nucleotide distribution of 39.3% G + C. Bioinformatics analysis predicted 132 putative open reading frames of (ORFs) ≥ 150 nucleotides. There are 24 ORFs with unknown function. Seven homologous repeated regions (hrs) and two bro genes (bro-1 and bro-2) were identified in the genome. Comparison to other baculovirus genomes, HycuGV-Hc1 revealed some differences in gene content and organization. Gene parity plots and phylogenetics confirmed that HycuGV-Hc1 is a Betabaculovirus and is closely related to Plutella xylostella granulovirus. This study expands our knowledge on the genetic variation of HycuGV isolates and provides further novel knowledge on the nature of granuloviruses.
1. Introduction Baculoviruses are enveloped, rod shaped, insect specific viruses with double stranded circular DNA genomes ranging in size from 80 to 180 kbp [1,2]. These viruses have been reported to infect > 600 insect species from the orders Lepidoptera, Diptera and Hymenoptera [3]. A distinguishing feature of baculoviruses is the formation of occlusion bodies (OBs) consisting mostly of a single highly-expressed viral protein (polyhedrin or granulin) assembled into a protective paracrystalline matrix around enveloped virions. Based on the morphology of OBs, baculoviruses are either nucleopolyhedroviruses (NPVs) or granuloviruses (GVs) [4]. The family Baculoviridae comprises four genera: Alphabaculovirus (lepidopteran-specific NPVs), Betabaculovirus (lepidopteran-specific GVs), Gammabaculovirus (hymenopteran-specific NPVs) and Deltabaculovirus (dipteran-specific NPVs) [5]. Genomic studies on baculoviruses are very valuable unveiling intrinsic properties critical for virus classification, gene function and insecticidal potential. To date, 80 baculovirus reference genomes are available in the National Centre for Biotechonology Information (NCBl) database, including 50 from alphabaculoviruses and only 26 from betabaculoviruses. Genomic studies on GVs are much more limited due primarily to the lack of a
⁎
variety of permissive cell lines [6]. Biologically, GVs can generally be placed into three categories according to tissue tropism [7]. Type I-GVs infect the larval midgut epithelium and fat body tissues and kill the host slowly [8]. Type II-GVs exhibit a wide range of tissue tropism and kill their host at a speed similar to most NPVs. Type III-GVs infect only the midgut epithelium. The fall webworm, Hyphantria cunea Drury (Lepidoptera: Arctiidae) is widespread in North America, Europe, and Asia and forages on a wide range of forests, fruit trees, shrubs and ornamentals [9,10]. Over the last few years, populations of H. cunea became widely established in Turkey. Despite concerted efforts, its control has been hindered by rapid development of resistance to chemical insecticides [11]. Baculoviruses have a long history of being used as biological insecticide because of their high infectivity, general specificity and safety to nontarget organisms and the environment. Over 50 baculovirus insecticides have been used worldwide against various insect pests [12]. Hyphantria cunea granulovirus (HycuGV) is a specific and an effective pathogen with a potential as a biocontrol agent [13–15]. In a previous study, we reported the molecular characteristics of HycuGV-Hc1 and a partial genome sequence analysis [15]. In the present study, the genome of HycuGV-Hc1 has been
Corresponding author. E-mail address: [email protected] (I. Demir).
https://doi.org/10.1016/j.ygeno.2019.03.008 Received 17 December 2018; Received in revised form 13 March 2019; Accepted 15 March 2019 0888-7543/ © 2019 Published by Elsevier Inc.
Please cite this article as: Donus Gencer, et al., Genomics, https://doi.org/10.1016/j.ygeno.2019.03.008
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
3.2. Gene content
completely sequenced, annotated and compared to representative baculovirus genomes using various phylogenetic tools. The genome size was found to be 114,825 bp and was confirmed to be a member of the genus Betabaculovirus.
HycuGV-Hc1 genome contains all the 38 core genes found in every baculovirus genome (yellow line in Table S1) [22,23]. Eleven baculovirus genes involved in DNA replication were found in the HycuGV-Hc1 genome (Table 1). However, HycuGV-Hc1 does not contain helicase 2, pcna, lef-7 and dUTPase, which are typically found in other baculoviruses. All transcription-specific genes, except the pe-38, lef-12, ie-0, ie2 are present in the HycuGV-Hc-1 genome (Table 1). Additionally, 17 conserved structural genes were identified, including those encoding granulin (orf1); pk (orf3); odv-e18 (orf9); pep-1 (orf15); pep/p10 (orf16); pep-2 (orf23); efp (orf26); mp-nase (orf37); p10 (orf73); p40 (orf74); p6.9 (orf75); odv-e25 (orf80); vp39 (orf85); odv-ec27 (orf86); gp41 (orf92); fp (orf104); and vp1054 (orf126). HycuGV-Hc1 genome lacks homologs to odv-e66, p87, p24, calyx, vef-1, vef-2, vef-3, gp50 and gp64. Auxiliary genes are not essential for replication, but provide the virus a certain selective advantage in nature [24]. HycuGV-Hc1 genome does not have p35, cathepsin, ptp-1, ptp-2, ctl-1, ctl-2, arif-1, gp37 (Table 1). Auxiliary genes present in HycuGV-Hc1 genome are listed in Table 1. Among these, two bro genes (orf118, orf119) that are highly repetitive and conserved are present. Per os infectivity factors (PIFs) are proteins essential for oral infection of insect larvae [25]. So far, ten pif genes have been identified in baculoviruses and are present in the HycuGV-Hc1 genome (Table 1). However, enhancin which is a metalloprotease and proposed to enhance oral infection by degrading the insect peritrophic matrix [26], is absent from HycuGV-Hc1 genome. The HycuGV-Hc1 genome has seven hrs, designated as hr1 to hr7 (Fig. 2). These seven hrs comprise 0.33% of the genome. The repeats are separated from each other either with one/two bases or followed each other. Additionally, hr6 (67845–68,151 bp) contains two separate repeat regions, which are different from each other. These repeats are not complete palindromic sequences.
2. Materials and methods 2.1. Virus purification and DNA extraction HycuGV-Hc1 was isolated from vicinity of Samsun in Central Black Sea Region of Turkey from H. cunea larvae. Third instar laboratory reared H. cunea larvae were used to propogate the virus. The virus occlusion bodies were purified using sucrose gradients, and the DNA was extracted and purified following the methods described previously [16]. 2.2. Genome sequencing, assembly and annotation The procedures used for sequencing, assembly and annotation of HycuGV-Hc1 genome are similar to those used for the genome sequencing and annotation in an earlier study [16]. Concentration of purified DNA was 30 ng/μl and it has an OD260/ OD280 ratio of 1.85. DNA was sequenced at Macrogen (Macrogen Inc., Soul Korea) using Illumina Hiseq generates raw images utilizing HCS (HiSeq Control Software v2.2) for system control. The total number of bases reads, GC (%), Q20 (%), and Q30 (%) were calculated for HycuGV-Hc1. The GC and Q30 contents were 44.68% and 84.914%, respectively. The created reads were 16,552,240 and total read bases were 1.6 Gbp. 2.3. Phylogeny Concatenated protein sequences encoded by the 38 core genes from all sequenced baculoviruses were aligned using ClustalW [17]. The phylogenetic tree was constructed using the Maximum Likelihood method based on the Jones-Taylor-Thornton (JTT) model with 1000 bootstrap values for core proteins using MEGA7 software [18]. Tree reliability was analyzed via bootstrap analysis with 1000 replicates [19].
3.3. Phylogeny of HycuGV-Hc1 A phylogenetic tree, based on the protein sequences of 38 core baculovirus genes was built (Fig. 3). Five distinct groups were identified. HycuGV-Hc1 is located with betabaculoviruses as a separate branch. This branch is closely related with Plutella xylostella GV (PlxyGV), Agrotis segetum GV (AgseGV) and Spodoptera litura GV (SpltGV).
3. Results
3.4. Gene parity plot analysis
3.1. Features of the HycuGV-Hc1 genome
Gene parity plots compare gene organization between two different genomes and are used to illustrate collinearity among baculovirus genomes [27,28]. The gene order of HycuGV-Hc1 was compared with those of SpltGV, CpGV, AgseGV, PlxyGV and AcMNPV. It showed that HycuGV-Hc1 shared the highest gene order with PlxyGV, CpGV, SpltGV and AgseGV, respectively. However, its gene arrangement is significantly different from that of the Alphabaculovirus AcMNPV (Fig. 4).
The HycuGV-Hc1 genome is composed of 114,825 nt (GenBank Accession No. MH923363) with a G + C content of 39.3%. The coding regions cover 91.2% of the genome and the first nucleotide position was defined as the adenine of the granulin ORF initiation codon. [20,21]. The HycuGV-Hc1 genome contains 132 ORFs potentially encoding polypeptides of 50 or more amino acids. Identified ORFs are indicated by arrows in the circular genome map (Fig. 1). The ORFs are distributed on both strands of the DNA throughout the genome. Fifty-nine ORFs are in a clockwise direction and seventy-three ORFs are in an anticlockwise direction (Table S1). As with other baculoviruses, eighteen ORFs overlap each other with > 60 bp. An overlap of 72 bp between orf22 and orf23 (polyhedron envelope protein, pep-2); 64 bp between orf33 and orf34 and 62 bp between orf102 (inhibitor of apoptosis 5, iap-5) and orf103 (late expression factor 9, lef-9). In Table S1 each ORF of HycuGV-Hc1 is listed along with homologs in certain other baculoviruses (SpltGV, CpGV, AgseGV, and PlxyGV) and Alfabaculovirus group I (AcMNPV). Of the 132 HycuGV-Hc1 ORFs, 108 have an assigned function or homologs to other baculovirus ORFs. However, there are 24 ORFs with unknown function.
4. Discussion The HycuGV-Hc1 genome was estimated previously as 112 kb in size from restriction fragment analysis [15]. However, total sequencing revealed the genome to contain 114,825 bp (GenBank Accession No. MH923363). To date, twenty-six GV genome have been sequenced. HycuGV-Hc1 genome became the twenty-seventh to be submitted to GenBank. The sequenced GVs contain genome sizes varying between 98 kbp (Diatraea saccharalis GV) and 178 kbp (Xestia c-nigrum GV) [29,30]. The 39.3% G + C content of the HycuGV-Hc1 genome is slightly higher than that of AgseGV (37.27%) and SpltGV (38.82%) but lower than PlxyGV/XcGV (40.7%) and Cydia pomonella GV (CpGV) (45.2%) (Table 2) [31–35]. HycuGV-Hc1 genome contains 81, 81, 87, 90 and 69 ORFs homologous to those in SpltGV, CpGV, AgseGV, PlxyGV 2
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
Fig. 1. The circular map of HycuGV-Hc1 genome. Arrows indicate the position, size, and direction of transcription of the ORFs. ORF numbers and gene names are shown around the circle. Table 1 The functions of conserved and variable genes in HycuGV-Hc1 genome. Gene function
Genes present in HycuGV (orf no)
Genes missing in HycuGV
Replication
ie-1(6), lef-2(32), lef-1(64), dbp(68), helicase(79), dna pol(97), lef-3(99), DNA ligase(106), me53(131), rr2a(116), rr1(117) 39K(47), lef-11(48), p47(60), lef-6(67), lef-5(76), lef-4(84), vlf-1(94), lef-9(103), lef-8(111), lef-10(125) granulin(1), pk(3), odv-e18(9), pep-1(15), pep/p10(16), pep-2(23), p40(74), efp(26), mp-nase(37), p10(73), p6.9(75), odv-e25(80), vp39(85), odv-ec27(86), gp41(92), fp(104), vp1054(126) p49(10), ubiquitin(43), sod(51), fgf-1(65), iap-3(49), iap-5(102), fgf-2(108), fgf-3(109), egt(130), bro1(118), bro-2(119), chit-2a(52) p74(54), pif-1(4), pif-2(38), pif-3(29), odv-e28(78), odv-e56(12), pif-6(100), ac110(42), vp91(89), ac108(45) ac145(8), p24(62), 38.7kd(63), p45(70), p12(71), p40(74), 38 k protein(77), p18(81), p33(82), tlp20(90), ac81(91), desmoplakin(98), p43(113), he65(120), U-box/RING(122), 50, 61, 69, 72, 83, 87, 88, 93, 95, 96, 101, 105, 107, 110, 114, 123, 124, 127
helicase-2, pcna, lef-7, dUTPase
Transcription Structural Auxiliary PIFs or genes related to oral infection Unknown
pe38, lef-12, ie-0, ie-2 odv-e66, p87, p24, calyx, vef-1, vef-2, vef-3, gp50, gp64 p35, cathepsin, ptp-1, ptp-2, ctl-1, ctl-2, arif-1, gp37
HycuGV-Hc1 contains three orfs (ORF15, ORF16, ORF23) encoding polyhedron envelope protein (PEP), which confers stability on the OBs [39]. Of these three, ORF16 is present as a fusion protein with P10 homolog, as in the case of certain GVs [37,40]. Additionally, a p10 homolog (orf73) is found in HycuGV-Hc1 genome. P10 protein is related to occlusion body morphogenesis and disintegration of the nuclear matrix [41]. The genomes of both PlxyGV and SpltGV contain p10 gene homologs in three separate orfs [31,33]. Baculoviruses trigger apoptosis at the early stages of infection. As baculoviruses evolved, they acquired genes such as p35, p49 and iap to suppress apoptosis and replicate productively. While IAPs inhibit the activation of proteases indirectly, proteins encoded by p35/p49 directly interfere with the activity of the proteases [42]. Five iap genes (iap-1 to iap-5) have been so far identified in baculoviruses [43]. HycuGV-Hc1 genome contains homologs of p49 and two homologs of iap-3 and iap-5. These iap homologs are orf49 (iap-3) and orf102 (iap-5). Homologs of iap-3 have been found among most NPVs and GVs, however iap-5 genes have been identified only in betabaculoviruses [44]. Cathepsin and chitinase genes are related to host liquefaction late in the infection and degradation of insect tissues [45,46]. In the absence of cathepsin and chitinase or cathepsin alone, larval time of death is significantly delayed [47]. Our analyses indicate that HycuGV-Hc1
and AcMNPV, respectively (Table S1). Genes which do not have known homologs are referred to as encoding hypothetical proteins. We attempted to group gene sets which did not group by BLAST searches but when aligned appear to share a functional annotation. Twenty-four genes encoding hypothetical proteins have been identified in the HycuGv-Hc1 genome. Many genes associated with DNA replication and transcription have been identified in sequenced baculovirus genomes. Early genes such as ie-0, ie-1, ie-2 and pe38 are transcribed by the host cell polymerases [36]. Only ie-1 (orf6) seems to be in the HycuGV-Hc1 genome. Six gene essential for DNA replication (lef-1/orf64, lef-2/orf32, lef-3/orf99, dna pol/orf97, helicase/orf79, and ie-1/orf6) are conserved in all baculoviruses including HycuGV-Hc1 (Table 1). HycuGV-Hc1 does not have lef-7 and lef-12, which are present in most betabaculoviruses, such as XcGV, Clostera anachoreta GV (ClanGV), PlxyGV, Adoxophyes orana GV (AdorGV), Clostera anastomosis GV (ClasGV), CpGV and AgseGV. HycuGv-Hc1 genome contains the large and small subunits of ribonucleotide reductase (rr1, rr2; orf117 and orf116), which function in nucleotide metabolism [37]. Homologs thereof are present in most genomes of betabaculoviruses except those of ClanGV and ClasGV [21,38]. However, several DNA replication genes, including helicase-2, dUTPase and pcna are absent from the HycuGv-Hc1 genome. 3
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
HR 1 REGION 14800-15173 bp
CCTAACAAAGGTTATCTGGTCATGCGCAATCTTAATTACTTTGTTTGTGCTCATTATTTTTATCTAACCTAACAA AGGTTATCTGGTCACGTACACCATTTAGGTTATCAAAGAATTTTCGTATCGATAAAAATTAATTATACTGCATT ACGATAACCGCTTGATAACACTGCAGACTAATTGTGTAAAATTGTGCGCATATCGCATTTTTATCGAAACAGGC CGAGGTTATATCAACAATCAATTATTTTCGTATCGAAAAAAAAATCATTATCAGTCGCTTGCAACAGTATATAA ACGGCGTCGCGTAATATCGAGCCAGTTTTCTGCTACGCTNGCGTAATATCGAGCCAGTTTTCTGCTACGCTTTC AAC
HR 2 REGION 17246-17752 bp
TATAATACTTATAGATTACATACGCAGATTAGTGAGTTTAAATCTAATCTACAGTGCAACGCGTCGATATAAAA ACGGTGTTAAATACATATAGGCTTCATTTTTATACACGTAATGACTTGAAAAAGGGTTATCGCCGCAAAGTTGA CACAGAGTTCTCGGGTTAAAAATATTATTGTTGTTCGTTAAAGTTGACACAGAGTTCTCGGGTTAAAAATATTA TTGTTGTTCGTTAATAAGTTTATCGCGGTAAAGAATCTAGTTTATCGCGGTAAAGAGTCATCGGTTCAAATATA TTGTTGTTTGTTATATTACAGACCTCAAGTTTATCGCGAAGCGAGTCAACATTTATTAATATACTTGTTTTTAAG TCATGGGTTATCCTTATTATACAAACAAACCGCAAGTTATCATGTATAGGTCATATGCATGAGTATATAAACGA TTTTTAGGCTCGACATTAACCATATCATATTGAACTTCTACAAAGTGAACATTTGTTTTACC
HR 3 REGION 18929-19260 bp
GATTATTAATATCACCATTACCGTTATTGTTAACTAATACAGTGTGTTGTAAATTTAGCGCCCGTACAATTTGTT AGGTAGGTGCATGTGCATGTTGCATGTTAGCGCTTAAGGCATGTTAGTTCTAAGTGTTTTTTTTTATTGTACTAG CGCAAATTTTCTATACACGCACATTTGTATTAACTACCACGCACATTTGTATTAACTACCACACTATGTTATTAT CGTTTGTTATTATCTTGATCTCTTTAAATTAAAGGCCTTTATCGATAATTGTGTATAAATTAGTAAACCTTTTTA ACAACACATTCAGTTTGGTGTAAAACGTGAAC
HR 4 REGION 44095-44390 bp
TAAATAAAAGATATACTTTGTTTTATAACAATTATTTTATTTATAAAACAATGACATCATTTGTCACGATTCAAA TTGTTTAAACAATTATTTTATTATCAGTTGAGTGCTCTTCCCAGCAGTTTTGAACTCTTCCCAGCAGTTTTGAAC TCGCCACATTTTGATAACCCCACAGTAGAGACGCGTCGCCTGTTGTTGCCCGCACCAGACGGTGTGTCTATGAT ACATGCTTTTTCTTGCTTCTGATTTTTATTTAAAGCCATTATTAATACTTGCAAGAGTTTCATGAGGTAATT
HR 5 REGION 44731-45050 bp
AAATTTTTACGTAATATCGAGCCAGAATTGGGTTAAAAATTCAACCGGTAAGGGTCTAATATTCACAAAGTGC GCATTGTTAATAATGAAACGGCGAACTCACAGTCCCGCGGTGATAAAAGTGTGCGCACCGTATTAATTTAACA CGCTCAACATTAACGATTGAAAAGTTTTAAAATATTTTATTTTAATGTCGAACCAATATATGTTTTATCATTATG AGTTGCGGGTTGATAAATTATAAAGGTTAGGTTTATATTTTAAATTATCTTTATTTACAAATATACACGTTTATC ACAGTAGCGTTTCACAGTAGCGTT
HR 6 REGION 67845-68151 bp
ATTTGATAAAAGCGTCGATTTGATATAAGCGTCCTTATTGATTAAGTGTCTTATAGATTAGGCGTACTTAATTA CTTACCGACAAAGATTAATGTCACGCAATATATTAAATATCTGCAATGCGTCAAAGCGATAAAAAAAAATAAA CCATGTTGATTGAAAATGACAATTTTTATTGTTGAAAATAACGTCTAAACATTCTAAAAATTGATGTTTATACA CAAAAAATGCTATTTTACACAAAATCTACATTGTTAAATCGAAGTTTGCACACAAAAATTAAAATTTGCACAA AATTTACGTGTTT
HR 7 REGION 106696-107215 bp
ATCTTAATTTTGGTACAATATATCACCTGGATTACTGTATCTGAGACCGATCCATGAAAAGATAAAAACGATTC ATTAAAAGGTAAATGGTAGTCGTAAAAGTAGGCGCACTATTAAACGGGTCTAAATCTTCAAAATATTGAAATC GTTCGAGCATAATCTAGTTGAATTGGTGATCTGTTCATTCCTTTAATTAAATTCACTCAAAGTTGCGATTTACAT ATTTTTTAAATTAATCAACTCTTCGTTAACCTATGCTGGTAGGGTTTGATCACGAAGTCAAAATGAAAACAACA AAAATAATACAATGATTATAATGTAATGTATCAAAAACAATATATTTTACTTTTGCCGTGTGCACGCCAAACAA ATAATCAATGCCACTTCTATAAATTGTAACAAACATGTAAGCGCATTAATGATTACGTTGTAAGTGACAACGTT ACTCTCATATAAAATAGGAGCACCCGTCACATTGCCCAATGTCGTTGTGCACAATAAAACCAACACATAGTAA GAC Fig. 2. Alignment of homologous regions (hr) palindromic repeats.
metalloproteinase (MP-NASE, ORF37) with 30–45% amino acid sequence identity to matrix metalloproteinases of other granuloviruses. This metalloproteinase is distinct from enhancin and cathepsin and with homologs in most sequenced GV genomes. It is proposed to be involved in basement membrane degradation so as to aid in systemic infection by BV [50]. This metalloproteinase in HycuGV-Hc1 probably compensates for the lack of enhancin. Baculovirus repeated orfs (bro), whose function is not clear are found in many invertebrate DNA viruses [51]. The HycuGV-Hc1genome contains only two bro genes (orf118, orf119). ORF118 shows highest amino acid identity (75%) to BRO protein (ORF57) of TniGV (Trichoplusia ni GV). ORF119 shows highest amino acid identity (37%) to the
genome does not contain a cathepsin gene. Probably due to this deficiency H. cunea larvae infected with HycuGV-Hc1 do not appear to liquify even at the late stages of infection. Of the 24 sequenced betabaculoviruses genomes, 12 lack both cathepsin and chitinase, 2 lack cathepsin (Helicoverpa armigera GV/HearGV and Plodia interpunctella GV/PiGV) and 1 lacks chitinase (PiraGV). Enhancin is a metalloproteinase that disrupts the insect's peritrophic membrane to facilitate the initiation of infection and also the selective degradation of host's peritrophic matrix proteins [48,49]. HycuGV-Hc1 does not contain an enhancin gene as in ClasGV-A and B, PiraGV, Harrisina brillians GV (HbGV), Cnaphalocrocis medinalis GV (CnmeGV), AdorGv and PlxyGV. However, HycuGV-Hc1 encodes a 4
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
Fig. 3. Phylogeny based on amino acid sequences of baculoviruses core genes. The maximum likelihood phylogram was constructed from concatenated alignments of 38 core gene amino acid sequences using the ME method. Bootstrap values > 50% for both ME and MP analysis are indicated for each node (ME/MP). The location of HycuGV-Hc1 (bold square) is indicated with a black dot. The purple, green, yellow, blue and red parts represent Betabaculovirus, Alphabaculovirus group I, Alphabaculovirus group II, gammabaculoviruses and Deltabaculovirus, respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
(orf45). Homologous repeated sequences (hrs) have been identified in all baculoviruses [53]. These sequences are considered to act as enhancers of gene transcription and possibly as origins of DNA replication [54]. NPV hrs characteristically comprise direct repeats of 30 bp palindromes, but GV repeat regions are more flexible and often lack palindromes [44]. However, size of hrs in the HycuGV-Hc1 vary between 13 and 47 bp. Interestingly, hr1, hr2, hr3, hr4, hr5 and hr7 are all present as two direct repeat sequences, whereas hr6 includes two different and separate direct repeat regions (Fig. 2). Phylogenetic analysis based concatenated amino acid sequences of
BRO-7 protein (ORF162) of PsunGV (Pseudaletia unipuncta GV). BRO proteins encoded by invertebrate viruses contain a conserved N-terminal DNA binding domain (BRO-N) associated with a highly variable Cterminal domain (BROeC) [51]. Both BRO proteins in HycuGV-Hc1 include conserved BRO-N domains but variable BRO-C domains. Baculovirus genomes encode PIF proteins essential for oral infection of insect larvae [25]. The nine pif genes, identified so far in all baculoviruses are present in HycuGv-Hc1 genome: p74 (orf54), pif-1 (orf4), pif-2 (orf38), pif-3 (orf29), odv-e28 (orf78), odv-e56 (orf12), pif-6 (orf100), ac110 (orf42), vp91 (orf89). Additionally, a recently identified tenth pif gene (ac108) [52] is also found in HycuGV-Hc1 genome 5
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
Fig. 4. Gene-parity plot analysis of HycuGV-Hc1 in relation to CpGV, PlxyGV, AgseGV, SpltGV and AcMNPV. The presence and relative position of genes (orange dots) is pairwise comparisons.
order in baculoviruses [27] showed that HycuGV-Hc1 is highly similar to PlxyGV and least to AcMNPV (Fig. 4).
baculovirus core genes is more consistent and robust than using individual genes [28,55]. A phylogenetic tree of the of 21 GVs, 2 group I NPVs, 2 group II NPVs, 2 gammabaculoviruses and a deltabaculovirus was constructed (Fig. 2). Betabaculoviruses were subdivided into two clades. HycuGV-Hc1 is in a clade with AgseGV, PlxyGV, SpltGV, SpfrGV, PsunGV, HearGV and XecnGV (Fig. 3). Gene parity plot analysis, used to elucidates collinearity of gene
Funding This study was supported by the Karadeniz Technical University Research Foundation [grant number KTU BAP FBA-2018-7703].
Table 2 Genome size and G + C (%) content of certain betabaculoviruses. Virus
Abbreviation
No. of ORFs
Genome size (bp)
GC content (%)
Accession No.
Reference
Hyphantria cunea GV Plutella xylostella GV Xestia c-nigrum GV Spodoptera litura GV Cydia pomonella GV Agrotis segetum GV
HycuGV PlxyGV XecnGV SpliGV CpGV AgseGV
132 120 181 136 143 149
114,825 100,999 178,733 124,121 123,500 131,442
39.3 40.7 40.7 38.82 45.2 37.27
MH923363 NC_002593 NC_002331 NC_009503 NC_002816 KC994902
This study [31] [35] [33] [34] [35]
6
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
Author contributions
2.3. [18] S. Kumar, G. Stecher, K. Tamura, MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets, Mol. Biol. Evol. 33 (2016) 1870–1874, https://doi. org/10.1093/molbev/msw054. [19] M.J. Sanderson, M.F. Wojciechowski, Improved bootstrap confidence limits in large-scale phylogenies, with an example from neo-Astragalus (Leguminosae), Syst. Biol. 49 (2000) 671–685, https://doi.org/10.1080/106351500750049761. [20] J. Kuzio, M.N. Pearson, S.H. Harwood, C.J. Funk, J.T. Evans, J.M. Slavicek, G.F. Rohrmann, Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar, Virology 253 (1999) 17–34, https://doi.org/10.1006/viro. 1998.9469. [21] Z. Liang, X. Zhang, X. Yin, S. Cao, F. Xu, Genomic sequencing and analysis of Clostera anachoreta granulovirus, Arch. Virol. 156 (2011) 1185–1198, https://doi. org/10.1007/s00705-011-0977-0. [22] M.J. Garavaglia, S.A.B. Miele, J.A. Iserte, M.N. Belaich, P.D. Ghiringhelli, The ac53, ac78, ac101, and ac103 genes are newly discovered core genes in the family Baculoviridae, J. Virol. 86 (2012) 12069–12079, https://doi.org/10.1128/JVI. 01873-12. [23] M.A. Javed, S. Biswas, L.G. Willis, S. Harris, C. Pritchard, M.M. van Oers, B.C. Donly, M.A. Erlandson, D.D. Hegedus, D.A. Theilmann, Autographa californica multiple nucleopolyhedrovirus AC83 is a Per Os infectivity factor (PIF) protein required for occlusion-derived virus (ODV) and budded virus nucleocapsid assembly as well as assembly of the PIF complex in ODV envelopes, J. Virol. 91 (2017), https://doi.org/10.1128/JVI.02115-16. [24] D.R. O'Reilly, Auxiliary genes of baculoviruses, The Baculoviruses, Springer US, Boston, MA, 1997, pp. 267–300, , https://doi.org/10.1007/978-1-4899-1834-5_11. [25] K. Peng, M.M. van Oers, Z. Hu, J.W.M. van Lent, J.M. Vlak, Baculovirus per os infectivity factors form a complex on the surface of occlusion-derived virus, J. Virol. 84 (2010) 9497–9504, https://doi.org/10.1128/JVI.00812-10. [26] P. Wang, R.R. Granados, An intestinal mucin is the target substrate for a baculovirus enhancin, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 6977–6982 http://www.ncbi. nlm.nih.gov/pubmed/9192677 (accessed September 24, 2018). [27] Z.H. Hu, B.M. Arif, F. Jin, J.W.M. Martens, X.W. Chen, J.S. Sun, D. Zuidema, R.W. Goldbach, J.M. Vlak, Distinct gene arrangement in the Buzura suppressaria single-nucleocapsid nucleopolyhedrovirus genome, J. Gen. Virol. 79 (1998) 2841–2851, https://doi.org/10.1099/0022-1317-79-11-2841. [28] E.A. Herniou, J.A. Olszewski, J.S. Cory, D.R. O'Reilly, T he genome sequence and evolution of baculoviruses, Annu. Rev. Entomol. 48 (2003) 211–234, https://doi. org/10.1146/annurev.ento.48.091801.112756. [29] C. Goto, T. Hayakawa, S. Maeda, Genome organization of Xestia c-nigrum granulovirus, Virus Genes 16 (1998) 199–210 http://www.ncbi.nlm.nih.gov/pubmed/ 9608666 (accessed October 11, 2018). [30] D.M.P. Ardisson-Araújo, F.L. Melo, R.J. Clem, J.L.C. Wolff, B.M. Ribeiro, A betabaculovirus-encoded gp64 homolog codes for a functional envelope fusion protein, J. Virol. 90 (2016) 1668–1672, https://doi.org/10.1128/JVI.02491-15. [31] Y. Hashimoto, T. Hayakawa, Y. Ueno, T. Fujita, Y. Sano, T. Matsumoto, Sequence analysis of the Plutella xylostella granulovirus genome, Virology 275 (2000) 358–372, https://doi.org/10.1006/VIRO.2000.0530. [32] T. Hayakawa, R. Ko, K. Okano, S.-I. Seong, C. Goto, S. Maeda, Sequence analysis of the Xestia c-nigrum granulovirus genome, Virology 262 (1999) 277–297, https:// doi.org/10.1006/VIRO.1999.9894. [33] Y. Wang, J.Y. Choi, J.Y. Roh, S.D. Woo, B.R. Jin, Y.H. Je, Molecular and phylogenetic characterization of Spodoptera litura granulovirus, J. Microbiol. 46 (2008) 704–708, https://doi.org/10.1007/s12275-008-0133-z. [34] E. a Herniou, T. Luque, X. Chen, M. Just, D. Winstanley, J.S. Cory, R. David, O. Reilly, J.M. Vlak, D.R.O. Reilly, Use of whole genome sequence data to infer baculovirus phylogeny use of whole genome sequence data to infer baculovirus phylogeny, Society 75 (2001) 8117–8126, https://doi.org/10.1128/JVI.75.17. 8117. [35] X. Zhang, Z. Liang, X. Yin, J. Wang, X. Shao, Complete genome sequence of Agrotis segetum granulovirus Shanghai strain, Arch. Virol. 159 (2014) 1869–1872, https:// doi.org/10.1007/s00705-014-2001-y. [36] P.D. Friesen, Regulation of baculovirus early gene expression, The Baculoviruses, Springer US, Boston, MA, 1997, pp. 141–170, , https://doi.org/10.1007/978-14899-1834-5_6. [37] M. Lange, J.A. Jehle, The genome of the Cryptophlebia leucotreta granulovirus, Virology 317 (2003) 220–236 http://www.ncbi.nlm.nih.gov/pubmed/14698662 (accessed September 24, 2018). [38] F. Yin, Z. Zhu, X. Liu, D. Hou, J. Wang, L. Zhang, M. Wang, Z. Kou, H. Wang, F. Deng, Z. Hu, The complete genome of a new betabaculovirus from Clostera anastomosis, PLoS ONE 10 (2015) e0132792, , https://doi.org/10.1371/journal. pone.0132792. [39] A. Bateman, L. Coin, R. Durbin, R.D. Finn, V. Hollich, S. Griffiths-Jones, A. Khanna, M. Marshall, S. Moxon, E.L.L. Sonnhammer, D.J. Studholme, C. Yeats, S.R. Eddy, The Pfam protein families database, Nucleic Acids Res. 32 (2004) 138D–141, https://doi.org/10.1093/nar/gkh121. [40] S.R. Escasa, H.A.M. Lauzon, A.C. Mathur, P.J. Krell, B.M. Arif, Sequence analysis of the Choristoneura occidentalis granulovirus genome, J. Gen. Virol. 87 (2006) 1917–1933, https://doi.org/10.1099/vir.0.81792-0. [41] M.M. Van Oers, J.M. Vlak, The baculovirus 10-kDa protein, J. Invertebr. Pathol. 70 (1997) 1–17, https://doi.org/10.1006/jipa.1997.4675. [42] D.L. Vaux, A. Strasser, The molecular biology of apoptosis, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 2239–2244 http://www.ncbi.nlm.nih.gov/pubmed/8637856 (accessed September 24, 2018). [43] M. Ikeda, K. Yanagimoto, M. Kobayashi, Identification and functional analysis of Hyphantria cunea nucleopolyhedrovirus iap genes, Virology 321 (2004) 359–371,
Resources: RN, ZD, ID. Conceived and designed the experiments: DG, RN, ZD, ID. Performed the experiments: DG, ZB. Analyzed the data: DG, ZB. Wrote the paper: DG, ZB, RN. Review and editing: ZD, ID. Conflict of interest The authors have no conflicts of interest to declare. Research involving human and animal participants The research described in this paper does not use any human or animal subjects. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ygeno.2019.03.008. References [1] V.J. Theilmann, Blissard DA, Bonning GW, B. Jehle, J.A. O'Reilly, D.R. Rohrmann, G.F. Thiem, S. Baculoviridae, Virus taxonomy-classification and nomenclature of viruses, in: B.L.A. Fauquet, Mayo M.A. CX, J. Maniloff, U. Desselberger (Eds.), 8th Rep. Int. Comm. Taxon. Viruses, 8th ed., Elsevier, Amsterdam, 2005, pp. 177–185. [2] İ. Demir, Böcek Virüslerinin Biyoteknolojik Önemi, 14 (2008), pp. 193–201. [3] J. Slack, B.M. Arif, The baculoviruses occlusion-derived virus: virion structure and function, Adv. Virus Res. 69 (2007) 99–165, https://doi.org/10.1016/S00653527(06)69003-9. [4] G.F. Rohrmann, Baculovirus Molecular Biology, National Center for Biotechnology Information (US), http://www.ncbi.nlm.nih.gov/pubmed/24479205, (2013) (accessed October 11, 2018). [5] H.-W. Ackermann, W.A. Smirnoff, A morphological investigation of 23 baculoviruses, J. Invertebr. Pathol. 41 (1983) 269–280, https://doi.org/10.1016/00222011(83)90244-6. [6] D. Winstanley, N.E. Crook, Replication of Cydia pomonella granulosis virus in cell cultures, J. Gen. Virol. 74 (1993) 1599–1609, https://doi.org/10.1099/0022-131774-8-1599. [7] B.A. Federici, Baculovirus pathogenesis, The Baculoviruses, Springer US, Boston, MA, 1997, pp. 33–59, , https://doi.org/10.1007/978-1-4899-1834-5_3. [8] H. Watanabe, M. Kobayashi, Histopathology of a granulosis in the larva of the fall webworm, Hyphantria cunea, J. Invertebr. Pathol. 16 (1970) 71–79, https://doi. org/10.1016/0022-2011(70)90208-9. [9] K.V. Deseo, A. Montermini, W. Cortellini, The 1st outbreak of the fall webworm (Hyphantria cunea Drury, Lepid, Arctiidae) in North Italy - preliminary-observations on the development, diapause and derivation, J. Appl. Entomol. 101 (1986) 201–206, https://doi.org/10.1111/j.1439-0418.1986.tb00850.x. [10] R. Wittenberg, C. Bioscience, T.S. Agency, L.S. Del, An inventory of alien species and their threat to biodiversity and economy in Switzerland, Bioscience 29 (2005) 417 https://www.researchgate.net/publication/265455571_An_Inventory_of_Alien_ Species_and_Their_Threat_to_Biodiversity_and_Economy_in_Switzerland (accessed September 24, 2018). [11] M. Tserodze, N. Meskhi, Third International Scientific Symposium, (2012), p. 514, https://doi.org/10.7251/AGSY1203514T. [12] F. Moscardi, M.L. de Souza, M.E.B. de Castro, M. Lara Moscardi, B. Szewczyk, Baculovirus pesticides: present state and future perspectives, Microbes Microb. Technol, Springer New York, New York, NY, 2011, pp. 415–445, , https://doi.org/ 10.1007/978-1-4419-7931-5_16. [13] D.G. Boucias, G.L. Nordin, Interinstar susceptibility of the fall webworm, Hyphantria cunea, to its nucleopolyhedrosis and granulosis viruses, J. Invertebr. Pathol. 30 (1977) 68–75, https://doi.org/10.1016/0022-2011(77)90038-6. [14] D.G. Boucias, G.L. Nordin, Susceptibility of Hyphantria cunea infected with the Diacrisia granulosis virus to its homologous baculoviruses, J. Invertebr. Pathol. 32 (1978) 341–347, https://doi.org/10.1016/0022-2011(78)90198-2. [15] Z. Bayramoglu, R. Nalcacioglu, Z. Demirbag, I. Demir, Characterization of a Betabaculovirus from the fall webworm, Hyphantria cunea Drury. (Lepidoptera: Erebidae), in Turkey, Biocontrol Sci. Tech. (2018) 1–13, https://doi.org/10.1080/ 09583157.2018.1520197. [16] D. Gencer, R. Nalcacioglu, Z. Demirbag, I. Demir, Complete genome sequence analysis of the Malacosoma neustria nucleopolyhedrovirus from Turkey, Virus Genes 54 (2018) 706–718, https://doi.org/10.1007/s11262-018-1595-7. [17] J.D. Thompson, T.J. Gibson, D.G. Higgins, Multiple Sequence Alignment Using ClustalW and ClustalX, in: Curr. Protoc. Bioinforma, John Wiley & Sons, Inc, Hoboken, NJ, USA, 2002, https://doi.org/10.1002/0471250953.bi0203s00 Unit
7
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
https://doi.org/10.1016/j.virol.2004.01.002. [44] S. Wormleaton, J. Kuzio, D. Winstanley, The complete sequence of the Adoxophyes orana granulovirus genome, Virology 311 (2003) 350–365 http://www.ncbi.nlm. nih.gov/pubmed/12842624 (accessed September 24, 2018). [45] J.M. Slack, J. Kuzio, P. Faulkner, Characterization of v-cath, a cathepsin L-like proteinase expressed by the baculovirus Autographa californica multiple nuclear polyhedrosis virus, J. Gen. Virol. 76 (1995) 1091–1098, https://doi.org/10.1099/ 0022-1317-76-5-1091. [46] R.E. Hawtin, T. Zarkowska, K. Arnold, C.J. Thomas, G.W. Gooday, L.A. King, J.A. Kuzio, R.D. Possee, Liquefaction ofAutographa californica nucleopolyhedrovirus-infected insects is dependent on the integrity of virus-encoded Chitinase and Cathepsin genes, Virology 238 (1997) 243–253, https://doi.org/10.1006/viro. 1997.8816. [47] E. Ishimwe, J.J. Hodgson, R.J. Clem, A.L. Passarelli, Reaching the melting point: degradative enzymes and protease inhibitors involved in baculovirus infection and dissemination, Virology 479–480 (2015) 637–649, https://doi.org/10.1016/J. VIROL.2015.01.027. [48] P. Wang, R.R. Granados, Observations on the presence of the Peritrophic membrane in LarvalTrichoplusia niand its role in limiting baculovirus infection, J. Invertebr. Pathol. 72 (1998) 57–62, https://doi.org/10.1006/jipa.1998.4759. [49] U. Toprak, S. Harris, D. Baldwin, D. Theilmann, C. Gillott, D.D. Hegedus, M.A. Erlandson, Role of enhancin in mamestra configurata nucleopolyhedrovirus
[50]
[51]
[52]
[53]
[54]
[55]
8
virulence: selective degradation of host peritrophic matrix proteins, J. Gen. Virol. 93 (2012) 744–753, https://doi.org/10.1099/vir.0.038117-0. R. Ko, K. Okano, S. Maeda, Structural and functional analysis of the Xestia c-nigrum granulovirus matrix metalloproteinase, J. Virol. 74 (2000) 11240–11246 http:// www.ncbi.nlm.nih.gov/pubmed/11070022 (accessed February 11, 2019). D.K. Bideshi, S. Renault, K. Stasiak, B.A. Federici, Y. Bigot, Phylogenetic analysis and possible function of bro-like genes, a multigene family widespread among large double-stranded DNA viruses of invertebrates and bacteria, J. Gen. Virol. 84 (2003) 2531–2544, https://doi.org/10.1099/vir.0.19256-0. B. Boogaard, F. Evers, J.W.M. van Lent, M.M. van Oers, The baculovirus Ac108 protein is a per os infectivity factor and a component of the ODV entry complex, J. Gen. Virol. (2019), https://doi.org/10.1099/jgv.0.001200. T. Hayakawa, G.F. Rohrmann, Y. Hashimoto, Patterns of genome organization and content in lepidopteran baculoviruses, Virology 278 (2000) 1–12, https://doi.org/ 10.1006/viro.2000.0668. S. Hilton, D. Winstanley, Identification and functional analysis of the origins of DNA replication in the Cydia pomonella granulovirus genome, J. Gen. Virol. 88 (2007) 1496–1504, https://doi.org/10.1099/vir.0.82760-0. R.L. Harrison, B. Puttler, H.J.R. Popham, Genomic sequence analysis of a fast-killing isolate of Spodoptera frugiperda multiple nucleopolyhedrovirus, J. Gen. Virol. 89 (2008) 775–790, https://doi.org/10.1099/vir.0.83566-0.
Contents lists available at ScienceDirect
Genomics journal homepage: www.elsevier.com/locate/ygeno
Genome sequence analysis and organization of the Hyphantria cunea granulovirus (HycuGV-Hc1) from Turkey ⁎
Donus Gencer, Zeynep Bayramoglu, Remziye Nalcacioglu, Zihni Demirbag, Ismail Demir Karadeniz Technical University, Faculty of Science, Department of Biology, 61080 Trabzon, Turkey
A R T I C LE I N FO
A B S T R A C T
Keywords: Granulovirus Hyphantria cunea Complete genome sequence HycuGV Baculovirus
The fall webworm (Hyphantria cunea) impacts a wide variety of crops and cultivated broadleaf plant species. The pest is native to North America, was introduced to Europe and has since spread further as far as central Asia. Despite several attempts to control its distribution, the pest continues to spread causing damage all over the world. A naturally occurring baculovirus, Hyphantria cunea granulovirus (HycuGV-Hc1), isolated from the larvae of H. cunea in Turkey appears to have a potential as microbial control agent against this pest. In this report we describe the complete genome sequence and organization of the granulovirus isolate (HycuGV-Hc1) that infects the larval stages and compare it to other baculovirus genomes. The HycuGV-Hc1 genome is a circular doublestranded DNA of 114,825 bp in size with a nucleotide distribution of 39.3% G + C. Bioinformatics analysis predicted 132 putative open reading frames of (ORFs) ≥ 150 nucleotides. There are 24 ORFs with unknown function. Seven homologous repeated regions (hrs) and two bro genes (bro-1 and bro-2) were identified in the genome. Comparison to other baculovirus genomes, HycuGV-Hc1 revealed some differences in gene content and organization. Gene parity plots and phylogenetics confirmed that HycuGV-Hc1 is a Betabaculovirus and is closely related to Plutella xylostella granulovirus. This study expands our knowledge on the genetic variation of HycuGV isolates and provides further novel knowledge on the nature of granuloviruses.
1. Introduction Baculoviruses are enveloped, rod shaped, insect specific viruses with double stranded circular DNA genomes ranging in size from 80 to 180 kbp [1,2]. These viruses have been reported to infect > 600 insect species from the orders Lepidoptera, Diptera and Hymenoptera [3]. A distinguishing feature of baculoviruses is the formation of occlusion bodies (OBs) consisting mostly of a single highly-expressed viral protein (polyhedrin or granulin) assembled into a protective paracrystalline matrix around enveloped virions. Based on the morphology of OBs, baculoviruses are either nucleopolyhedroviruses (NPVs) or granuloviruses (GVs) [4]. The family Baculoviridae comprises four genera: Alphabaculovirus (lepidopteran-specific NPVs), Betabaculovirus (lepidopteran-specific GVs), Gammabaculovirus (hymenopteran-specific NPVs) and Deltabaculovirus (dipteran-specific NPVs) [5]. Genomic studies on baculoviruses are very valuable unveiling intrinsic properties critical for virus classification, gene function and insecticidal potential. To date, 80 baculovirus reference genomes are available in the National Centre for Biotechonology Information (NCBl) database, including 50 from alphabaculoviruses and only 26 from betabaculoviruses. Genomic studies on GVs are much more limited due primarily to the lack of a
⁎
variety of permissive cell lines [6]. Biologically, GVs can generally be placed into three categories according to tissue tropism [7]. Type I-GVs infect the larval midgut epithelium and fat body tissues and kill the host slowly [8]. Type II-GVs exhibit a wide range of tissue tropism and kill their host at a speed similar to most NPVs. Type III-GVs infect only the midgut epithelium. The fall webworm, Hyphantria cunea Drury (Lepidoptera: Arctiidae) is widespread in North America, Europe, and Asia and forages on a wide range of forests, fruit trees, shrubs and ornamentals [9,10]. Over the last few years, populations of H. cunea became widely established in Turkey. Despite concerted efforts, its control has been hindered by rapid development of resistance to chemical insecticides [11]. Baculoviruses have a long history of being used as biological insecticide because of their high infectivity, general specificity and safety to nontarget organisms and the environment. Over 50 baculovirus insecticides have been used worldwide against various insect pests [12]. Hyphantria cunea granulovirus (HycuGV) is a specific and an effective pathogen with a potential as a biocontrol agent [13–15]. In a previous study, we reported the molecular characteristics of HycuGV-Hc1 and a partial genome sequence analysis [15]. In the present study, the genome of HycuGV-Hc1 has been
Corresponding author. E-mail address: [email protected] (I. Demir).
https://doi.org/10.1016/j.ygeno.2019.03.008 Received 17 December 2018; Received in revised form 13 March 2019; Accepted 15 March 2019 0888-7543/ © 2019 Published by Elsevier Inc.
Please cite this article as: Donus Gencer, et al., Genomics, https://doi.org/10.1016/j.ygeno.2019.03.008
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
3.2. Gene content
completely sequenced, annotated and compared to representative baculovirus genomes using various phylogenetic tools. The genome size was found to be 114,825 bp and was confirmed to be a member of the genus Betabaculovirus.
HycuGV-Hc1 genome contains all the 38 core genes found in every baculovirus genome (yellow line in Table S1) [22,23]. Eleven baculovirus genes involved in DNA replication were found in the HycuGV-Hc1 genome (Table 1). However, HycuGV-Hc1 does not contain helicase 2, pcna, lef-7 and dUTPase, which are typically found in other baculoviruses. All transcription-specific genes, except the pe-38, lef-12, ie-0, ie2 are present in the HycuGV-Hc-1 genome (Table 1). Additionally, 17 conserved structural genes were identified, including those encoding granulin (orf1); pk (orf3); odv-e18 (orf9); pep-1 (orf15); pep/p10 (orf16); pep-2 (orf23); efp (orf26); mp-nase (orf37); p10 (orf73); p40 (orf74); p6.9 (orf75); odv-e25 (orf80); vp39 (orf85); odv-ec27 (orf86); gp41 (orf92); fp (orf104); and vp1054 (orf126). HycuGV-Hc1 genome lacks homologs to odv-e66, p87, p24, calyx, vef-1, vef-2, vef-3, gp50 and gp64. Auxiliary genes are not essential for replication, but provide the virus a certain selective advantage in nature [24]. HycuGV-Hc1 genome does not have p35, cathepsin, ptp-1, ptp-2, ctl-1, ctl-2, arif-1, gp37 (Table 1). Auxiliary genes present in HycuGV-Hc1 genome are listed in Table 1. Among these, two bro genes (orf118, orf119) that are highly repetitive and conserved are present. Per os infectivity factors (PIFs) are proteins essential for oral infection of insect larvae [25]. So far, ten pif genes have been identified in baculoviruses and are present in the HycuGV-Hc1 genome (Table 1). However, enhancin which is a metalloprotease and proposed to enhance oral infection by degrading the insect peritrophic matrix [26], is absent from HycuGV-Hc1 genome. The HycuGV-Hc1 genome has seven hrs, designated as hr1 to hr7 (Fig. 2). These seven hrs comprise 0.33% of the genome. The repeats are separated from each other either with one/two bases or followed each other. Additionally, hr6 (67845–68,151 bp) contains two separate repeat regions, which are different from each other. These repeats are not complete palindromic sequences.
2. Materials and methods 2.1. Virus purification and DNA extraction HycuGV-Hc1 was isolated from vicinity of Samsun in Central Black Sea Region of Turkey from H. cunea larvae. Third instar laboratory reared H. cunea larvae were used to propogate the virus. The virus occlusion bodies were purified using sucrose gradients, and the DNA was extracted and purified following the methods described previously [16]. 2.2. Genome sequencing, assembly and annotation The procedures used for sequencing, assembly and annotation of HycuGV-Hc1 genome are similar to those used for the genome sequencing and annotation in an earlier study [16]. Concentration of purified DNA was 30 ng/μl and it has an OD260/ OD280 ratio of 1.85. DNA was sequenced at Macrogen (Macrogen Inc., Soul Korea) using Illumina Hiseq generates raw images utilizing HCS (HiSeq Control Software v2.2) for system control. The total number of bases reads, GC (%), Q20 (%), and Q30 (%) were calculated for HycuGV-Hc1. The GC and Q30 contents were 44.68% and 84.914%, respectively. The created reads were 16,552,240 and total read bases were 1.6 Gbp. 2.3. Phylogeny Concatenated protein sequences encoded by the 38 core genes from all sequenced baculoviruses were aligned using ClustalW [17]. The phylogenetic tree was constructed using the Maximum Likelihood method based on the Jones-Taylor-Thornton (JTT) model with 1000 bootstrap values for core proteins using MEGA7 software [18]. Tree reliability was analyzed via bootstrap analysis with 1000 replicates [19].
3.3. Phylogeny of HycuGV-Hc1 A phylogenetic tree, based on the protein sequences of 38 core baculovirus genes was built (Fig. 3). Five distinct groups were identified. HycuGV-Hc1 is located with betabaculoviruses as a separate branch. This branch is closely related with Plutella xylostella GV (PlxyGV), Agrotis segetum GV (AgseGV) and Spodoptera litura GV (SpltGV).
3. Results
3.4. Gene parity plot analysis
3.1. Features of the HycuGV-Hc1 genome
Gene parity plots compare gene organization between two different genomes and are used to illustrate collinearity among baculovirus genomes [27,28]. The gene order of HycuGV-Hc1 was compared with those of SpltGV, CpGV, AgseGV, PlxyGV and AcMNPV. It showed that HycuGV-Hc1 shared the highest gene order with PlxyGV, CpGV, SpltGV and AgseGV, respectively. However, its gene arrangement is significantly different from that of the Alphabaculovirus AcMNPV (Fig. 4).
The HycuGV-Hc1 genome is composed of 114,825 nt (GenBank Accession No. MH923363) with a G + C content of 39.3%. The coding regions cover 91.2% of the genome and the first nucleotide position was defined as the adenine of the granulin ORF initiation codon. [20,21]. The HycuGV-Hc1 genome contains 132 ORFs potentially encoding polypeptides of 50 or more amino acids. Identified ORFs are indicated by arrows in the circular genome map (Fig. 1). The ORFs are distributed on both strands of the DNA throughout the genome. Fifty-nine ORFs are in a clockwise direction and seventy-three ORFs are in an anticlockwise direction (Table S1). As with other baculoviruses, eighteen ORFs overlap each other with > 60 bp. An overlap of 72 bp between orf22 and orf23 (polyhedron envelope protein, pep-2); 64 bp between orf33 and orf34 and 62 bp between orf102 (inhibitor of apoptosis 5, iap-5) and orf103 (late expression factor 9, lef-9). In Table S1 each ORF of HycuGV-Hc1 is listed along with homologs in certain other baculoviruses (SpltGV, CpGV, AgseGV, and PlxyGV) and Alfabaculovirus group I (AcMNPV). Of the 132 HycuGV-Hc1 ORFs, 108 have an assigned function or homologs to other baculovirus ORFs. However, there are 24 ORFs with unknown function.
4. Discussion The HycuGV-Hc1 genome was estimated previously as 112 kb in size from restriction fragment analysis [15]. However, total sequencing revealed the genome to contain 114,825 bp (GenBank Accession No. MH923363). To date, twenty-six GV genome have been sequenced. HycuGV-Hc1 genome became the twenty-seventh to be submitted to GenBank. The sequenced GVs contain genome sizes varying between 98 kbp (Diatraea saccharalis GV) and 178 kbp (Xestia c-nigrum GV) [29,30]. The 39.3% G + C content of the HycuGV-Hc1 genome is slightly higher than that of AgseGV (37.27%) and SpltGV (38.82%) but lower than PlxyGV/XcGV (40.7%) and Cydia pomonella GV (CpGV) (45.2%) (Table 2) [31–35]. HycuGV-Hc1 genome contains 81, 81, 87, 90 and 69 ORFs homologous to those in SpltGV, CpGV, AgseGV, PlxyGV 2
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
Fig. 1. The circular map of HycuGV-Hc1 genome. Arrows indicate the position, size, and direction of transcription of the ORFs. ORF numbers and gene names are shown around the circle. Table 1 The functions of conserved and variable genes in HycuGV-Hc1 genome. Gene function
Genes present in HycuGV (orf no)
Genes missing in HycuGV
Replication
ie-1(6), lef-2(32), lef-1(64), dbp(68), helicase(79), dna pol(97), lef-3(99), DNA ligase(106), me53(131), rr2a(116), rr1(117) 39K(47), lef-11(48), p47(60), lef-6(67), lef-5(76), lef-4(84), vlf-1(94), lef-9(103), lef-8(111), lef-10(125) granulin(1), pk(3), odv-e18(9), pep-1(15), pep/p10(16), pep-2(23), p40(74), efp(26), mp-nase(37), p10(73), p6.9(75), odv-e25(80), vp39(85), odv-ec27(86), gp41(92), fp(104), vp1054(126) p49(10), ubiquitin(43), sod(51), fgf-1(65), iap-3(49), iap-5(102), fgf-2(108), fgf-3(109), egt(130), bro1(118), bro-2(119), chit-2a(52) p74(54), pif-1(4), pif-2(38), pif-3(29), odv-e28(78), odv-e56(12), pif-6(100), ac110(42), vp91(89), ac108(45) ac145(8), p24(62), 38.7kd(63), p45(70), p12(71), p40(74), 38 k protein(77), p18(81), p33(82), tlp20(90), ac81(91), desmoplakin(98), p43(113), he65(120), U-box/RING(122), 50, 61, 69, 72, 83, 87, 88, 93, 95, 96, 101, 105, 107, 110, 114, 123, 124, 127
helicase-2, pcna, lef-7, dUTPase
Transcription Structural Auxiliary PIFs or genes related to oral infection Unknown
pe38, lef-12, ie-0, ie-2 odv-e66, p87, p24, calyx, vef-1, vef-2, vef-3, gp50, gp64 p35, cathepsin, ptp-1, ptp-2, ctl-1, ctl-2, arif-1, gp37
HycuGV-Hc1 contains three orfs (ORF15, ORF16, ORF23) encoding polyhedron envelope protein (PEP), which confers stability on the OBs [39]. Of these three, ORF16 is present as a fusion protein with P10 homolog, as in the case of certain GVs [37,40]. Additionally, a p10 homolog (orf73) is found in HycuGV-Hc1 genome. P10 protein is related to occlusion body morphogenesis and disintegration of the nuclear matrix [41]. The genomes of both PlxyGV and SpltGV contain p10 gene homologs in three separate orfs [31,33]. Baculoviruses trigger apoptosis at the early stages of infection. As baculoviruses evolved, they acquired genes such as p35, p49 and iap to suppress apoptosis and replicate productively. While IAPs inhibit the activation of proteases indirectly, proteins encoded by p35/p49 directly interfere with the activity of the proteases [42]. Five iap genes (iap-1 to iap-5) have been so far identified in baculoviruses [43]. HycuGV-Hc1 genome contains homologs of p49 and two homologs of iap-3 and iap-5. These iap homologs are orf49 (iap-3) and orf102 (iap-5). Homologs of iap-3 have been found among most NPVs and GVs, however iap-5 genes have been identified only in betabaculoviruses [44]. Cathepsin and chitinase genes are related to host liquefaction late in the infection and degradation of insect tissues [45,46]. In the absence of cathepsin and chitinase or cathepsin alone, larval time of death is significantly delayed [47]. Our analyses indicate that HycuGV-Hc1
and AcMNPV, respectively (Table S1). Genes which do not have known homologs are referred to as encoding hypothetical proteins. We attempted to group gene sets which did not group by BLAST searches but when aligned appear to share a functional annotation. Twenty-four genes encoding hypothetical proteins have been identified in the HycuGv-Hc1 genome. Many genes associated with DNA replication and transcription have been identified in sequenced baculovirus genomes. Early genes such as ie-0, ie-1, ie-2 and pe38 are transcribed by the host cell polymerases [36]. Only ie-1 (orf6) seems to be in the HycuGV-Hc1 genome. Six gene essential for DNA replication (lef-1/orf64, lef-2/orf32, lef-3/orf99, dna pol/orf97, helicase/orf79, and ie-1/orf6) are conserved in all baculoviruses including HycuGV-Hc1 (Table 1). HycuGV-Hc1 does not have lef-7 and lef-12, which are present in most betabaculoviruses, such as XcGV, Clostera anachoreta GV (ClanGV), PlxyGV, Adoxophyes orana GV (AdorGV), Clostera anastomosis GV (ClasGV), CpGV and AgseGV. HycuGv-Hc1 genome contains the large and small subunits of ribonucleotide reductase (rr1, rr2; orf117 and orf116), which function in nucleotide metabolism [37]. Homologs thereof are present in most genomes of betabaculoviruses except those of ClanGV and ClasGV [21,38]. However, several DNA replication genes, including helicase-2, dUTPase and pcna are absent from the HycuGv-Hc1 genome. 3
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
HR 1 REGION 14800-15173 bp
CCTAACAAAGGTTATCTGGTCATGCGCAATCTTAATTACTTTGTTTGTGCTCATTATTTTTATCTAACCTAACAA AGGTTATCTGGTCACGTACACCATTTAGGTTATCAAAGAATTTTCGTATCGATAAAAATTAATTATACTGCATT ACGATAACCGCTTGATAACACTGCAGACTAATTGTGTAAAATTGTGCGCATATCGCATTTTTATCGAAACAGGC CGAGGTTATATCAACAATCAATTATTTTCGTATCGAAAAAAAAATCATTATCAGTCGCTTGCAACAGTATATAA ACGGCGTCGCGTAATATCGAGCCAGTTTTCTGCTACGCTNGCGTAATATCGAGCCAGTTTTCTGCTACGCTTTC AAC
HR 2 REGION 17246-17752 bp
TATAATACTTATAGATTACATACGCAGATTAGTGAGTTTAAATCTAATCTACAGTGCAACGCGTCGATATAAAA ACGGTGTTAAATACATATAGGCTTCATTTTTATACACGTAATGACTTGAAAAAGGGTTATCGCCGCAAAGTTGA CACAGAGTTCTCGGGTTAAAAATATTATTGTTGTTCGTTAAAGTTGACACAGAGTTCTCGGGTTAAAAATATTA TTGTTGTTCGTTAATAAGTTTATCGCGGTAAAGAATCTAGTTTATCGCGGTAAAGAGTCATCGGTTCAAATATA TTGTTGTTTGTTATATTACAGACCTCAAGTTTATCGCGAAGCGAGTCAACATTTATTAATATACTTGTTTTTAAG TCATGGGTTATCCTTATTATACAAACAAACCGCAAGTTATCATGTATAGGTCATATGCATGAGTATATAAACGA TTTTTAGGCTCGACATTAACCATATCATATTGAACTTCTACAAAGTGAACATTTGTTTTACC
HR 3 REGION 18929-19260 bp
GATTATTAATATCACCATTACCGTTATTGTTAACTAATACAGTGTGTTGTAAATTTAGCGCCCGTACAATTTGTT AGGTAGGTGCATGTGCATGTTGCATGTTAGCGCTTAAGGCATGTTAGTTCTAAGTGTTTTTTTTTATTGTACTAG CGCAAATTTTCTATACACGCACATTTGTATTAACTACCACGCACATTTGTATTAACTACCACACTATGTTATTAT CGTTTGTTATTATCTTGATCTCTTTAAATTAAAGGCCTTTATCGATAATTGTGTATAAATTAGTAAACCTTTTTA ACAACACATTCAGTTTGGTGTAAAACGTGAAC
HR 4 REGION 44095-44390 bp
TAAATAAAAGATATACTTTGTTTTATAACAATTATTTTATTTATAAAACAATGACATCATTTGTCACGATTCAAA TTGTTTAAACAATTATTTTATTATCAGTTGAGTGCTCTTCCCAGCAGTTTTGAACTCTTCCCAGCAGTTTTGAAC TCGCCACATTTTGATAACCCCACAGTAGAGACGCGTCGCCTGTTGTTGCCCGCACCAGACGGTGTGTCTATGAT ACATGCTTTTTCTTGCTTCTGATTTTTATTTAAAGCCATTATTAATACTTGCAAGAGTTTCATGAGGTAATT
HR 5 REGION 44731-45050 bp
AAATTTTTACGTAATATCGAGCCAGAATTGGGTTAAAAATTCAACCGGTAAGGGTCTAATATTCACAAAGTGC GCATTGTTAATAATGAAACGGCGAACTCACAGTCCCGCGGTGATAAAAGTGTGCGCACCGTATTAATTTAACA CGCTCAACATTAACGATTGAAAAGTTTTAAAATATTTTATTTTAATGTCGAACCAATATATGTTTTATCATTATG AGTTGCGGGTTGATAAATTATAAAGGTTAGGTTTATATTTTAAATTATCTTTATTTACAAATATACACGTTTATC ACAGTAGCGTTTCACAGTAGCGTT
HR 6 REGION 67845-68151 bp
ATTTGATAAAAGCGTCGATTTGATATAAGCGTCCTTATTGATTAAGTGTCTTATAGATTAGGCGTACTTAATTA CTTACCGACAAAGATTAATGTCACGCAATATATTAAATATCTGCAATGCGTCAAAGCGATAAAAAAAAATAAA CCATGTTGATTGAAAATGACAATTTTTATTGTTGAAAATAACGTCTAAACATTCTAAAAATTGATGTTTATACA CAAAAAATGCTATTTTACACAAAATCTACATTGTTAAATCGAAGTTTGCACACAAAAATTAAAATTTGCACAA AATTTACGTGTTT
HR 7 REGION 106696-107215 bp
ATCTTAATTTTGGTACAATATATCACCTGGATTACTGTATCTGAGACCGATCCATGAAAAGATAAAAACGATTC ATTAAAAGGTAAATGGTAGTCGTAAAAGTAGGCGCACTATTAAACGGGTCTAAATCTTCAAAATATTGAAATC GTTCGAGCATAATCTAGTTGAATTGGTGATCTGTTCATTCCTTTAATTAAATTCACTCAAAGTTGCGATTTACAT ATTTTTTAAATTAATCAACTCTTCGTTAACCTATGCTGGTAGGGTTTGATCACGAAGTCAAAATGAAAACAACA AAAATAATACAATGATTATAATGTAATGTATCAAAAACAATATATTTTACTTTTGCCGTGTGCACGCCAAACAA ATAATCAATGCCACTTCTATAAATTGTAACAAACATGTAAGCGCATTAATGATTACGTTGTAAGTGACAACGTT ACTCTCATATAAAATAGGAGCACCCGTCACATTGCCCAATGTCGTTGTGCACAATAAAACCAACACATAGTAA GAC Fig. 2. Alignment of homologous regions (hr) palindromic repeats.
metalloproteinase (MP-NASE, ORF37) with 30–45% amino acid sequence identity to matrix metalloproteinases of other granuloviruses. This metalloproteinase is distinct from enhancin and cathepsin and with homologs in most sequenced GV genomes. It is proposed to be involved in basement membrane degradation so as to aid in systemic infection by BV [50]. This metalloproteinase in HycuGV-Hc1 probably compensates for the lack of enhancin. Baculovirus repeated orfs (bro), whose function is not clear are found in many invertebrate DNA viruses [51]. The HycuGV-Hc1genome contains only two bro genes (orf118, orf119). ORF118 shows highest amino acid identity (75%) to BRO protein (ORF57) of TniGV (Trichoplusia ni GV). ORF119 shows highest amino acid identity (37%) to the
genome does not contain a cathepsin gene. Probably due to this deficiency H. cunea larvae infected with HycuGV-Hc1 do not appear to liquify even at the late stages of infection. Of the 24 sequenced betabaculoviruses genomes, 12 lack both cathepsin and chitinase, 2 lack cathepsin (Helicoverpa armigera GV/HearGV and Plodia interpunctella GV/PiGV) and 1 lacks chitinase (PiraGV). Enhancin is a metalloproteinase that disrupts the insect's peritrophic membrane to facilitate the initiation of infection and also the selective degradation of host's peritrophic matrix proteins [48,49]. HycuGV-Hc1 does not contain an enhancin gene as in ClasGV-A and B, PiraGV, Harrisina brillians GV (HbGV), Cnaphalocrocis medinalis GV (CnmeGV), AdorGv and PlxyGV. However, HycuGV-Hc1 encodes a 4
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
Fig. 3. Phylogeny based on amino acid sequences of baculoviruses core genes. The maximum likelihood phylogram was constructed from concatenated alignments of 38 core gene amino acid sequences using the ME method. Bootstrap values > 50% for both ME and MP analysis are indicated for each node (ME/MP). The location of HycuGV-Hc1 (bold square) is indicated with a black dot. The purple, green, yellow, blue and red parts represent Betabaculovirus, Alphabaculovirus group I, Alphabaculovirus group II, gammabaculoviruses and Deltabaculovirus, respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
(orf45). Homologous repeated sequences (hrs) have been identified in all baculoviruses [53]. These sequences are considered to act as enhancers of gene transcription and possibly as origins of DNA replication [54]. NPV hrs characteristically comprise direct repeats of 30 bp palindromes, but GV repeat regions are more flexible and often lack palindromes [44]. However, size of hrs in the HycuGV-Hc1 vary between 13 and 47 bp. Interestingly, hr1, hr2, hr3, hr4, hr5 and hr7 are all present as two direct repeat sequences, whereas hr6 includes two different and separate direct repeat regions (Fig. 2). Phylogenetic analysis based concatenated amino acid sequences of
BRO-7 protein (ORF162) of PsunGV (Pseudaletia unipuncta GV). BRO proteins encoded by invertebrate viruses contain a conserved N-terminal DNA binding domain (BRO-N) associated with a highly variable Cterminal domain (BROeC) [51]. Both BRO proteins in HycuGV-Hc1 include conserved BRO-N domains but variable BRO-C domains. Baculovirus genomes encode PIF proteins essential for oral infection of insect larvae [25]. The nine pif genes, identified so far in all baculoviruses are present in HycuGv-Hc1 genome: p74 (orf54), pif-1 (orf4), pif-2 (orf38), pif-3 (orf29), odv-e28 (orf78), odv-e56 (orf12), pif-6 (orf100), ac110 (orf42), vp91 (orf89). Additionally, a recently identified tenth pif gene (ac108) [52] is also found in HycuGV-Hc1 genome 5
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
Fig. 4. Gene-parity plot analysis of HycuGV-Hc1 in relation to CpGV, PlxyGV, AgseGV, SpltGV and AcMNPV. The presence and relative position of genes (orange dots) is pairwise comparisons.
order in baculoviruses [27] showed that HycuGV-Hc1 is highly similar to PlxyGV and least to AcMNPV (Fig. 4).
baculovirus core genes is more consistent and robust than using individual genes [28,55]. A phylogenetic tree of the of 21 GVs, 2 group I NPVs, 2 group II NPVs, 2 gammabaculoviruses and a deltabaculovirus was constructed (Fig. 2). Betabaculoviruses were subdivided into two clades. HycuGV-Hc1 is in a clade with AgseGV, PlxyGV, SpltGV, SpfrGV, PsunGV, HearGV and XecnGV (Fig. 3). Gene parity plot analysis, used to elucidates collinearity of gene
Funding This study was supported by the Karadeniz Technical University Research Foundation [grant number KTU BAP FBA-2018-7703].
Table 2 Genome size and G + C (%) content of certain betabaculoviruses. Virus
Abbreviation
No. of ORFs
Genome size (bp)
GC content (%)
Accession No.
Reference
Hyphantria cunea GV Plutella xylostella GV Xestia c-nigrum GV Spodoptera litura GV Cydia pomonella GV Agrotis segetum GV
HycuGV PlxyGV XecnGV SpliGV CpGV AgseGV
132 120 181 136 143 149
114,825 100,999 178,733 124,121 123,500 131,442
39.3 40.7 40.7 38.82 45.2 37.27
MH923363 NC_002593 NC_002331 NC_009503 NC_002816 KC994902
This study [31] [35] [33] [34] [35]
6
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
Author contributions
2.3. [18] S. Kumar, G. Stecher, K. Tamura, MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets, Mol. Biol. Evol. 33 (2016) 1870–1874, https://doi. org/10.1093/molbev/msw054. [19] M.J. Sanderson, M.F. Wojciechowski, Improved bootstrap confidence limits in large-scale phylogenies, with an example from neo-Astragalus (Leguminosae), Syst. Biol. 49 (2000) 671–685, https://doi.org/10.1080/106351500750049761. [20] J. Kuzio, M.N. Pearson, S.H. Harwood, C.J. Funk, J.T. Evans, J.M. Slavicek, G.F. Rohrmann, Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar, Virology 253 (1999) 17–34, https://doi.org/10.1006/viro. 1998.9469. [21] Z. Liang, X. Zhang, X. Yin, S. Cao, F. Xu, Genomic sequencing and analysis of Clostera anachoreta granulovirus, Arch. Virol. 156 (2011) 1185–1198, https://doi. org/10.1007/s00705-011-0977-0. [22] M.J. Garavaglia, S.A.B. Miele, J.A. Iserte, M.N. Belaich, P.D. Ghiringhelli, The ac53, ac78, ac101, and ac103 genes are newly discovered core genes in the family Baculoviridae, J. Virol. 86 (2012) 12069–12079, https://doi.org/10.1128/JVI. 01873-12. [23] M.A. Javed, S. Biswas, L.G. Willis, S. Harris, C. Pritchard, M.M. van Oers, B.C. Donly, M.A. Erlandson, D.D. Hegedus, D.A. Theilmann, Autographa californica multiple nucleopolyhedrovirus AC83 is a Per Os infectivity factor (PIF) protein required for occlusion-derived virus (ODV) and budded virus nucleocapsid assembly as well as assembly of the PIF complex in ODV envelopes, J. Virol. 91 (2017), https://doi.org/10.1128/JVI.02115-16. [24] D.R. O'Reilly, Auxiliary genes of baculoviruses, The Baculoviruses, Springer US, Boston, MA, 1997, pp. 267–300, , https://doi.org/10.1007/978-1-4899-1834-5_11. [25] K. Peng, M.M. van Oers, Z. Hu, J.W.M. van Lent, J.M. Vlak, Baculovirus per os infectivity factors form a complex on the surface of occlusion-derived virus, J. Virol. 84 (2010) 9497–9504, https://doi.org/10.1128/JVI.00812-10. [26] P. Wang, R.R. Granados, An intestinal mucin is the target substrate for a baculovirus enhancin, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 6977–6982 http://www.ncbi. nlm.nih.gov/pubmed/9192677 (accessed September 24, 2018). [27] Z.H. Hu, B.M. Arif, F. Jin, J.W.M. Martens, X.W. Chen, J.S. Sun, D. Zuidema, R.W. Goldbach, J.M. Vlak, Distinct gene arrangement in the Buzura suppressaria single-nucleocapsid nucleopolyhedrovirus genome, J. Gen. Virol. 79 (1998) 2841–2851, https://doi.org/10.1099/0022-1317-79-11-2841. [28] E.A. Herniou, J.A. Olszewski, J.S. Cory, D.R. O'Reilly, T he genome sequence and evolution of baculoviruses, Annu. Rev. Entomol. 48 (2003) 211–234, https://doi. org/10.1146/annurev.ento.48.091801.112756. [29] C. Goto, T. Hayakawa, S. Maeda, Genome organization of Xestia c-nigrum granulovirus, Virus Genes 16 (1998) 199–210 http://www.ncbi.nlm.nih.gov/pubmed/ 9608666 (accessed October 11, 2018). [30] D.M.P. Ardisson-Araújo, F.L. Melo, R.J. Clem, J.L.C. Wolff, B.M. Ribeiro, A betabaculovirus-encoded gp64 homolog codes for a functional envelope fusion protein, J. Virol. 90 (2016) 1668–1672, https://doi.org/10.1128/JVI.02491-15. [31] Y. Hashimoto, T. Hayakawa, Y. Ueno, T. Fujita, Y. Sano, T. Matsumoto, Sequence analysis of the Plutella xylostella granulovirus genome, Virology 275 (2000) 358–372, https://doi.org/10.1006/VIRO.2000.0530. [32] T. Hayakawa, R. Ko, K. Okano, S.-I. Seong, C. Goto, S. Maeda, Sequence analysis of the Xestia c-nigrum granulovirus genome, Virology 262 (1999) 277–297, https:// doi.org/10.1006/VIRO.1999.9894. [33] Y. Wang, J.Y. Choi, J.Y. Roh, S.D. Woo, B.R. Jin, Y.H. Je, Molecular and phylogenetic characterization of Spodoptera litura granulovirus, J. Microbiol. 46 (2008) 704–708, https://doi.org/10.1007/s12275-008-0133-z. [34] E. a Herniou, T. Luque, X. Chen, M. Just, D. Winstanley, J.S. Cory, R. David, O. Reilly, J.M. Vlak, D.R.O. Reilly, Use of whole genome sequence data to infer baculovirus phylogeny use of whole genome sequence data to infer baculovirus phylogeny, Society 75 (2001) 8117–8126, https://doi.org/10.1128/JVI.75.17. 8117. [35] X. Zhang, Z. Liang, X. Yin, J. Wang, X. Shao, Complete genome sequence of Agrotis segetum granulovirus Shanghai strain, Arch. Virol. 159 (2014) 1869–1872, https:// doi.org/10.1007/s00705-014-2001-y. [36] P.D. Friesen, Regulation of baculovirus early gene expression, The Baculoviruses, Springer US, Boston, MA, 1997, pp. 141–170, , https://doi.org/10.1007/978-14899-1834-5_6. [37] M. Lange, J.A. Jehle, The genome of the Cryptophlebia leucotreta granulovirus, Virology 317 (2003) 220–236 http://www.ncbi.nlm.nih.gov/pubmed/14698662 (accessed September 24, 2018). [38] F. Yin, Z. Zhu, X. Liu, D. Hou, J. Wang, L. Zhang, M. Wang, Z. Kou, H. Wang, F. Deng, Z. Hu, The complete genome of a new betabaculovirus from Clostera anastomosis, PLoS ONE 10 (2015) e0132792, , https://doi.org/10.1371/journal. pone.0132792. [39] A. Bateman, L. Coin, R. Durbin, R.D. Finn, V. Hollich, S. Griffiths-Jones, A. Khanna, M. Marshall, S. Moxon, E.L.L. Sonnhammer, D.J. Studholme, C. Yeats, S.R. Eddy, The Pfam protein families database, Nucleic Acids Res. 32 (2004) 138D–141, https://doi.org/10.1093/nar/gkh121. [40] S.R. Escasa, H.A.M. Lauzon, A.C. Mathur, P.J. Krell, B.M. Arif, Sequence analysis of the Choristoneura occidentalis granulovirus genome, J. Gen. Virol. 87 (2006) 1917–1933, https://doi.org/10.1099/vir.0.81792-0. [41] M.M. Van Oers, J.M. Vlak, The baculovirus 10-kDa protein, J. Invertebr. Pathol. 70 (1997) 1–17, https://doi.org/10.1006/jipa.1997.4675. [42] D.L. Vaux, A. Strasser, The molecular biology of apoptosis, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 2239–2244 http://www.ncbi.nlm.nih.gov/pubmed/8637856 (accessed September 24, 2018). [43] M. Ikeda, K. Yanagimoto, M. Kobayashi, Identification and functional analysis of Hyphantria cunea nucleopolyhedrovirus iap genes, Virology 321 (2004) 359–371,
Resources: RN, ZD, ID. Conceived and designed the experiments: DG, RN, ZD, ID. Performed the experiments: DG, ZB. Analyzed the data: DG, ZB. Wrote the paper: DG, ZB, RN. Review and editing: ZD, ID. Conflict of interest The authors have no conflicts of interest to declare. Research involving human and animal participants The research described in this paper does not use any human or animal subjects. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ygeno.2019.03.008. References [1] V.J. Theilmann, Blissard DA, Bonning GW, B. Jehle, J.A. O'Reilly, D.R. Rohrmann, G.F. Thiem, S. Baculoviridae, Virus taxonomy-classification and nomenclature of viruses, in: B.L.A. Fauquet, Mayo M.A. CX, J. Maniloff, U. Desselberger (Eds.), 8th Rep. Int. Comm. Taxon. Viruses, 8th ed., Elsevier, Amsterdam, 2005, pp. 177–185. [2] İ. Demir, Böcek Virüslerinin Biyoteknolojik Önemi, 14 (2008), pp. 193–201. [3] J. Slack, B.M. Arif, The baculoviruses occlusion-derived virus: virion structure and function, Adv. Virus Res. 69 (2007) 99–165, https://doi.org/10.1016/S00653527(06)69003-9. [4] G.F. Rohrmann, Baculovirus Molecular Biology, National Center for Biotechnology Information (US), http://www.ncbi.nlm.nih.gov/pubmed/24479205, (2013) (accessed October 11, 2018). [5] H.-W. Ackermann, W.A. Smirnoff, A morphological investigation of 23 baculoviruses, J. Invertebr. Pathol. 41 (1983) 269–280, https://doi.org/10.1016/00222011(83)90244-6. [6] D. Winstanley, N.E. Crook, Replication of Cydia pomonella granulosis virus in cell cultures, J. Gen. Virol. 74 (1993) 1599–1609, https://doi.org/10.1099/0022-131774-8-1599. [7] B.A. Federici, Baculovirus pathogenesis, The Baculoviruses, Springer US, Boston, MA, 1997, pp. 33–59, , https://doi.org/10.1007/978-1-4899-1834-5_3. [8] H. Watanabe, M. Kobayashi, Histopathology of a granulosis in the larva of the fall webworm, Hyphantria cunea, J. Invertebr. Pathol. 16 (1970) 71–79, https://doi. org/10.1016/0022-2011(70)90208-9. [9] K.V. Deseo, A. Montermini, W. Cortellini, The 1st outbreak of the fall webworm (Hyphantria cunea Drury, Lepid, Arctiidae) in North Italy - preliminary-observations on the development, diapause and derivation, J. Appl. Entomol. 101 (1986) 201–206, https://doi.org/10.1111/j.1439-0418.1986.tb00850.x. [10] R. Wittenberg, C. Bioscience, T.S. Agency, L.S. Del, An inventory of alien species and their threat to biodiversity and economy in Switzerland, Bioscience 29 (2005) 417 https://www.researchgate.net/publication/265455571_An_Inventory_of_Alien_ Species_and_Their_Threat_to_Biodiversity_and_Economy_in_Switzerland (accessed September 24, 2018). [11] M. Tserodze, N. Meskhi, Third International Scientific Symposium, (2012), p. 514, https://doi.org/10.7251/AGSY1203514T. [12] F. Moscardi, M.L. de Souza, M.E.B. de Castro, M. Lara Moscardi, B. Szewczyk, Baculovirus pesticides: present state and future perspectives, Microbes Microb. Technol, Springer New York, New York, NY, 2011, pp. 415–445, , https://doi.org/ 10.1007/978-1-4419-7931-5_16. [13] D.G. Boucias, G.L. Nordin, Interinstar susceptibility of the fall webworm, Hyphantria cunea, to its nucleopolyhedrosis and granulosis viruses, J. Invertebr. Pathol. 30 (1977) 68–75, https://doi.org/10.1016/0022-2011(77)90038-6. [14] D.G. Boucias, G.L. Nordin, Susceptibility of Hyphantria cunea infected with the Diacrisia granulosis virus to its homologous baculoviruses, J. Invertebr. Pathol. 32 (1978) 341–347, https://doi.org/10.1016/0022-2011(78)90198-2. [15] Z. Bayramoglu, R. Nalcacioglu, Z. Demirbag, I. Demir, Characterization of a Betabaculovirus from the fall webworm, Hyphantria cunea Drury. (Lepidoptera: Erebidae), in Turkey, Biocontrol Sci. Tech. (2018) 1–13, https://doi.org/10.1080/ 09583157.2018.1520197. [16] D. Gencer, R. Nalcacioglu, Z. Demirbag, I. Demir, Complete genome sequence analysis of the Malacosoma neustria nucleopolyhedrovirus from Turkey, Virus Genes 54 (2018) 706–718, https://doi.org/10.1007/s11262-018-1595-7. [17] J.D. Thompson, T.J. Gibson, D.G. Higgins, Multiple Sequence Alignment Using ClustalW and ClustalX, in: Curr. Protoc. Bioinforma, John Wiley & Sons, Inc, Hoboken, NJ, USA, 2002, https://doi.org/10.1002/0471250953.bi0203s00 Unit
7
Genomics xxx (xxxx) xxx–xxx
D. Gencer, et al.
https://doi.org/10.1016/j.virol.2004.01.002. [44] S. Wormleaton, J. Kuzio, D. Winstanley, The complete sequence of the Adoxophyes orana granulovirus genome, Virology 311 (2003) 350–365 http://www.ncbi.nlm. nih.gov/pubmed/12842624 (accessed September 24, 2018). [45] J.M. Slack, J. Kuzio, P. Faulkner, Characterization of v-cath, a cathepsin L-like proteinase expressed by the baculovirus Autographa californica multiple nuclear polyhedrosis virus, J. Gen. Virol. 76 (1995) 1091–1098, https://doi.org/10.1099/ 0022-1317-76-5-1091. [46] R.E. Hawtin, T. Zarkowska, K. Arnold, C.J. Thomas, G.W. Gooday, L.A. King, J.A. Kuzio, R.D. Possee, Liquefaction ofAutographa californica nucleopolyhedrovirus-infected insects is dependent on the integrity of virus-encoded Chitinase and Cathepsin genes, Virology 238 (1997) 243–253, https://doi.org/10.1006/viro. 1997.8816. [47] E. Ishimwe, J.J. Hodgson, R.J. Clem, A.L. Passarelli, Reaching the melting point: degradative enzymes and protease inhibitors involved in baculovirus infection and dissemination, Virology 479–480 (2015) 637–649, https://doi.org/10.1016/J. VIROL.2015.01.027. [48] P. Wang, R.R. Granados, Observations on the presence of the Peritrophic membrane in LarvalTrichoplusia niand its role in limiting baculovirus infection, J. Invertebr. Pathol. 72 (1998) 57–62, https://doi.org/10.1006/jipa.1998.4759. [49] U. Toprak, S. Harris, D. Baldwin, D. Theilmann, C. Gillott, D.D. Hegedus, M.A. Erlandson, Role of enhancin in mamestra configurata nucleopolyhedrovirus
[50]
[51]
[52]
[53]
[54]
[55]
8
virulence: selective degradation of host peritrophic matrix proteins, J. Gen. Virol. 93 (2012) 744–753, https://doi.org/10.1099/vir.0.038117-0. R. Ko, K. Okano, S. Maeda, Structural and functional analysis of the Xestia c-nigrum granulovirus matrix metalloproteinase, J. Virol. 74 (2000) 11240–11246 http:// www.ncbi.nlm.nih.gov/pubmed/11070022 (accessed February 11, 2019). D.K. Bideshi, S. Renault, K. Stasiak, B.A. Federici, Y. Bigot, Phylogenetic analysis and possible function of bro-like genes, a multigene family widespread among large double-stranded DNA viruses of invertebrates and bacteria, J. Gen. Virol. 84 (2003) 2531–2544, https://doi.org/10.1099/vir.0.19256-0. B. Boogaard, F. Evers, J.W.M. van Lent, M.M. van Oers, The baculovirus Ac108 protein is a per os infectivity factor and a component of the ODV entry complex, J. Gen. Virol. (2019), https://doi.org/10.1099/jgv.0.001200. T. Hayakawa, G.F. Rohrmann, Y. Hashimoto, Patterns of genome organization and content in lepidopteran baculoviruses, Virology 278 (2000) 1–12, https://doi.org/ 10.1006/viro.2000.0668. S. Hilton, D. Winstanley, Identification and functional analysis of the origins of DNA replication in the Cydia pomonella granulovirus genome, J. Gen. Virol. 88 (2007) 1496–1504, https://doi.org/10.1099/vir.0.82760-0. R.L. Harrison, B. Puttler, H.J.R. Popham, Genomic sequence analysis of a fast-killing isolate of Spodoptera frugiperda multiple nucleopolyhedrovirus, J. Gen. Virol. 89 (2008) 775–790, https://doi.org/10.1099/vir.0.83566-0.