Genomic code for Sox2 binding uncovers its regulatory role in Six3 activation in the forebrain

Developmental Biology 381 (2013) 491–501

Contents lists available at ScienceDirect

Developmental Biology journal homepage: www.elsevier.com/locate/developmentalbiology

Genomes and Developmental Control

Genomic code for Sox2 binding uncovers its regulatory role in Six3 activation in the forebrain Bumwhee Lee a, Hobeom Song a, Karine Rizzoti b, Youngsook Son a, Jaeseung Yoon a, Kwanghee Baek a, Yongsu Jeong a,n a Department of Genetic Engineering, College of Life Sciences and Graduate School of Biotechnology, Kyung Hee University, Yongin-si 446-701, Republic of Korea b Division of Stem Cell Biology and Developmental Genetics, MRC National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK

ar t ic l e i nf o

a b s t r a c t

Article history: Received 7 April 2013 Received in revised form 9 June 2013 Accepted 12 June 2013 Available online 19 June 2013

The SRY-related HMG box transcription factor Sox2 plays critical roles throughout embryogenesis. Haploinsufficiency for SOX2 results in human developmental defects including anophthalmia, microphthalmia and septo-optic dysplasia, a congenital forebrain defect. To understand how Sox2 plays a role in neurogenesis, we combined genomic and in vivo transgenic approaches to characterize genomic regions occupied by Sox2 in the developing forebrain. Six3, a homeobox gene associated with holoprosencephaly, a forebrain midline defect, was identified as a Sox2 transcriptional target. This study shows that Sox2 directly regulates a previously unidentified long-range forebrain enhancer to activate Six3 expression in the rostral diencephalon. Further biochemical and genetic evidences indicated a direct regulatory link between Sox2 and Six3 during forebrain development, providing a better understanding of a common molecular mechanism underlying these forebrain defects. & 2013 Elsevier Inc. All rights reserved.

Keywords: Sox2 Six3 Forebrain ChIP Display Mouse

Introduction Sox2 is a member of the Sox family of transcription factors that contain the SRY-related high mobility group (HMG) box. On the basis of HMG box homology Sox2 belongs to the SoxB1 subfamily and is best known for its role in the establishment and maintenance of embryonic stem (ES) cells (Bowles et al., 2000; Pevny and Lovell-Badge, 1997). Recently Sox2 has been shown to be a key factor in pluripotency induction in various somatic cell types (Takahashi and Yamanaka, 2006; Yamanaka, 2012). Sox2 also performs a wide range of functions during embryo development. After ectoderm formation, Sox2 expression is largely restricted to the neuroectodermal cells and plays a critical role in early central nervous system development (Pevny and Placzek, 2005). Studies in chick and Xenopus embryos showed that Sox2 is needed to keep neural progenitors undifferentiated by repressing the activity of proneural genes (Graham et al., 2003; Kishi et al., 2000). Sox2 heterozygous mouse embryos did not manifest overt abnormalities, although one third of the embryos had anterior pituitary defects (Kelberman et al., 2006). Hypomorphic Sox2 embryos, in which the protein level is decreased to 15%–40% of wild type, showed that Sox2 is a dose-dependent key regulator of brain and

n

Corresponding author. Fax: +82 31 203 8127. E-mail address: [email protected] (Y. Jeong).

0012-1606/$ - see front matter & 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ydbio.2013.06.016

eye development (Ferri et al., 2004; Langer et al.,2012). Reduced Sox2 dosage resulted in abnormal hypothalamic patterning and disrupted the morphogenesis of the optic cup, causing variable microphthalmia (Langer et al.,2012; Taranova et al.,2006). Moreover, complete ablation of Sox2 in the developing retina led to a failure to maintain retinal neural progenitors in an undifferentiated state and resulted in severe microphthalmia (Taranova et al., 2006). The neural retina and hypothalamus are more sensitive than other regions of the neuroepithelium to Sox2 dosage, likely because the other SoxB1 members, Sox1 and Sox3, are not expressed in the neural retina, and Sox1 is excluded from the ventral diencephalon. Normal dosage of SOX2 is also critical for human development. SOX2 haploinsufficiency has been associated with anophthalmia, microphthalmia, and septo-optic dysplasia (SOD) which is a congenital brain malformation with pituitary, optic nerve, and midline forebrain defects (Kelberman et al., 2006; Fantes et al., 2003; Kelberman and Dattani, 2007; Williamson et al., 2006). Despite the recognition of critical roles of Sox2 in central nervous system (CNS) development, little is known about mechanisms of how Sox2 deficiency leads to different outcomes in dose- and context- dependent manners. This is partly due to the limited number of known Sox2 targets during the progress of CNS development. Previous analyses of Sox2 targets have primarily been performed in ES cells or ES-derived neural progenitor cells (Bergsland et al., 2011; Chen et al., 2008; Peterson et al., 2012).

492

B. Lee et al. / Developmental Biology 381 (2013) 491–501

Some of these targets are likely to be re -employed in late developing CNS regions, but context-specific targets remain to be determined. Several independent investigations indicated that Sox2 is a direct regulator of Shh and Six6 in the hypothalamus, and of Pax6, Rax, and the delta-crystallin gene in the eye (Danno et al., 2008; Donner et al., 2007; Kamachi et al., 2001; Lee et al.,2012; Zhao et al., 2012). To provide a better understanding of the gene regulatory network in the CNS we identified additional genes expressed in the developing forebrains that are activated by Sox2. By genomescale location analysis and in vivo verification, novel Sox2 transcriptional targets were identified. Interestingly, we revealed a Sox2-bound genomic region that functions as a long-range acting forebrain enhancer of Six3, which is a critical regulator of forebrain development and one of the major causes of holoprosencephaly (HPE). Further biochemical and genetic evidences indicated that Sox2 directly regulates this remote Six3 forebrain enhancer. Given our data, and that recently reported by other (Beccari et al., 2012), we propose that Sox2-dependent Six3 activation is critical for forebrain development.

Materials and methods ChIP Display Chromatin immunoprecipitation (ChIP) was performed using the ChIP assay kit (Millipore) following the manufacturer's instruction. Display was performed essentially as previously described (Barski and Frenkel, 2004). E10.5 mouse embryos were harvested in DMEM containing 10% fetal bovine serum and fixed with 1% formaldehyde for 20 min with shaking. After a 10 min incubation with 10 mM glycine, forebrain tissues were dissected and disrupted in lysis buffer (provided in the kit) by passing through 30 G needles, then nuclei were pelleted and resuspended in nuclei lysis buffer (provided in the kit). Chromatin was sonicated and incubated overnight with anti-Sox2 (Abcam, ab15830) or IgG (Santa

Cruz, sc2025), followed by incubation with protein A/G agarose beads. After washing and elution with buffers (provided in the kit), DNA was purified and subjected to Display. The immunoprecipitated DNA was treated with rAPid alkaline phosphatase (Roche), digested with AvaII, and ligated to linkers (sense, 5'– TTCGCGGCCGCAC-3'; antisense, 5'–GWCGTGCGGCCGCGAA-3'). After purification with a MinElute kit (Qiagen), the DNA was subjected to PCR amplification using nested primers (5'– CGGCCGCACGWCCN-3'). After the resulting PCR products were resolved on 6% PAGE, DNA from each band was purified with QIAEX II columns (Qiagen) and reamplified by PCR. The resulting DNAs were digested with HinfI or MspI and resolved on 2% agarose gel electrophoresis. Bands of interest were excised and the DNA was purified with GeneClean III kit (BIO101) for sequencing. Quantitative PCR was performed with a QuantiTect SYBR Green PCR kit (Qiagen) using the primers listed in Supplementary Text 1. Generation of reporter constructs and production of transgenic mice SBR sequences assayed were cloned into the NotI restriction site of a reporter vector containing the beta-globin minimal promoter, lacZcDNA, and SV40 large T antigen poly(A) site. Transient transgenic embryos or mouse lines were generated by pronuclear injection into fertilized eggs derived from FVBN strains. The list of primer sequences used for PCR amplification is shown in Supplementary Text 1. To test the requirement of each Sox2 binding site in SBR25, mutations designed to disrupt DNA binding at the recognition sequences were constructed by a threecomponent assembly ligation of two PCR product and reporter vector. Each primer sequence is shown in Supplementary Text 1. Whole-mount β-galactosidase staining and whole-mount in situ hybridization The β-galactosidase activity was measured using X-gal (Roche) as substrate (Lee et al., 2012). Representative embryos were fixed

Fig. 1. ChIP-Display coupled with functional in vivo assay to identify targets of Sox2 in the developing forebrain: Chromatin DNAs were isolated from E10.5 mouse forebrains and immunoprecipitated with anti-Sox2 antibody. After dephosphorylation with rAPid alkaline phosphatase to prevent ligation of linkers to the DNA ends generated by sonication, the chromatin DNAs were digested with AvaII to scatter non-specific DNAs, ligated to linkers, and subjected to PCR using nested primers. DNAs from bands reproduced in three independent ChIPs were purified and re-amplified by PCR. The resulting PCR products were digested with HinfI and MspI, resolved on 2% agarose gel electrophoresis and sequenced for identification. Novel SBRs were cloned into a reporter construct and assayed for enhancer activity in transient transgenic mouse embryos.

B. Lee et al. / Developmental Biology 381 (2013) 491–501

493

Fig. 2. Sox2 bound regions act as functional regulatory enhancers during embryogenesis: Transient transgenic reporter assays of Sox2-bound regions (SBRs) performed in E10.5 embryos. Shown at the top of each panel shown is Multiz Alignment of SBRs among vertebrate species (http://genome.ucsc.edu). Numbers of embryos exhibiting reproducible reporter activity over total number of transgenic embryos are indicated in Supplementary Table 1. hg19, human; galGal4, chicken; xenTro3, frog; fr3, fugu; danRer7, zebrafish.

494

B. Lee et al. / Developmental Biology 381 (2013) 491–501

in 4% paraformaldehyde, embedded and frozen in optimal cutting temperature medium (OCT) and sectioned at 20 μm on a cryostat. Whole-mount RNA in situ hybridization was carried out using digoxygenin-UTP-labeled riboprobes against Six3, Sox2, and Sox3 according to a previously described protocol (Jeong et al., 2006). Some of the stained embryos were photographed after clearing in a 1:1 benzyl alcohol/benzyl benzoate solution and rehydrated, soaked in 30% sucrose, frozen in OCT, and cryosectioned at 20 μm. Electromobility shift assays (EMSA) CHO cells were transfected with pcDNA3-Flag or pcDNA3-FlagSox2 plasmids using Lipofectamine 2000 transfection reagent (Invitrogen). After 48 h, whole -cell lysates were prepared in a buffer containing 50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, and 0.5% sodium deoxycholate. EMSA was performed as described (Jeong et al., 2006, 2008). The nucleotide sequences of probe and competitors are as follows: SBR25(S1), 5'–TTATATAAATGGCTTTGTAAAGAAAACTATAA-3' SBR25(ΔS1), 5'–TTATATAAATGGGCCCGCGAAGAAAACTATAA -3' SBR25(S2), 5'–CCAGCACAAACTCAACAATACGCACAGCCTAG -3' SBR25(ΔS2), 5'-CCAGCACAAACTGCCGCCGCCGCACAGCCTAG-3' Fbx15: 5'–GGAGATGTGCTTTATCATAACAATGGAATTCCTAGGGGCT-3'

Transient transfection and dual reporter assay CHO cells seeded at 70% confluency were transfected with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Two μg of pcDNA3-Sox2 expression plasmid or empty vector was mixed with 5 ng of pRL-TK vector (Promega) as an internal control, and 1 μg of SBR25::lacZ, SBR25(ΔS1)::lacZ, or SBR25(ΔS2)::lacZ reporter plasmid. Cells were harvested and lysed 48 h after transfection by adding 100 μl of lysis solution (DualLight System; Applied Biosystems). β-galactosidase activity was determined by Galacton-Plus substrate reaction, and normalized to that produced by Renilla luciferase (Dual-Light System; Applied Biosystems).

Results Genome-wide location of Sox2-bound regions in the developing forebrain To obtain better insight into the role of Sox2 in CNS development, particularly forebrain development, in vivo Sox2 binding sites throughout the mouse genome were identified by coupling chromatin immunoprecipitation (ChIP)–Display with transgenic mouse reporter assays (Fig. 1). Chromatin DNA immunoprecipitated from E10.5 mouse forebrains by Sox2 antibody was dephosphorylated, digested, and ligated to linkers, followed by PCR amplification (Barski and Frenkel, 2004). To reduce non-specific background fragments and the complexity of DNA resolved on a polyacrylamide gel (PAGE), the ligated restriction fragments were segregated into groups by 36 separate PCR reactions with 8 nested primers (see Materials and Methods). Only bands reproduced in three independent Sox2 ChIP lanes and in none of the IgG control lanes were excised from the PAGE and reamplified. The resulting products were subjected to secondary digestion to further separate any co-migrating bands as well as to verify, before sequencing, that DNA fragments isolated from the three different lanes were the same. Sequences from these digested subfragments were aligned with the mouse genome using UCSC genome browser

(http://genome.ucsc.edu). From these location analyses we identified a total of 102 Sox2 bound regions (SBRs) (Supplementary Table 1). From the list of SBRs, we randomly selected eight regions and tested these by ChIP-QPCR. Significant enrichment was detected in all of the SBRs tested (n¼ 8/8; Supplementary Fig. 1), validating the consistency of Sox2 occupied locations. We next matched the SBRs to the nearest annotated transcription units, and found several SBRs located from the known target genes of Sox2 in the developing CNS, Nestin, Pax6, Shh, and Sox2 (Danno et al., 2008; Donner et al., 2007; Kamachi et al., 2001; Tanaka et al., 2004; Zhao et al., 2012; Supplementary Table 1). When comparing the SBRs with recent Sox2 binding data from ES cells or their neural derivatives (Bergsland et al., 2011; Chen et al., 2008; Peterson et al., 2012), we found that 63 SBRs did overlap with ES cells-associated Sox2-bound regions, suggesting that a significant fraction of Sox2-bound regions were reused at later developmental stages. To identify forebrain-specific targets of Sox2, we focused on SBRs that were not shared in ES cell or their neural derivatives. To examine the functional relevance of these novel SBRs in vivo, we cloned each sequence into a reporter construct containing betaglobin minimal promoter, lacZ reporter and SV40 polyA, and analyzed reporter expression in transient transgenic mouse embryos (Supplementary Text 1). Of the 35 SBRs tested, 30 displayed highly specific and reproducible X-gal staining in the developing embryonic tissues including the forebrain (Fig. 2; Supplementary Table 1). Of these SBRs, 14 showed consistent expression in the forebrain regions, 5 in the eye, 10 in the craniofacial regions, and 11 in the branchial arch (Fig. 2; Supplementary Table 1). These data suggest that the majority of these novel SBRs can serve as functional regulatory enhancers, thus validating the efficacy of this strategy to identify Sox2 targets. SBR25 is a Six3 forebrain enhancer Prominent on the list of SBRs displaying enhancer function in the forebrain is SBR25 which directs lacZ expression to the ventral forebrain (Fig. 2) and is located between the nearest upstream (4425 kb) genes, Camkmt (calmodulin-lysine N-methyltransferase), Prep1 (prolylendopeptidase-like), Slc3a1 (solute carrier family3 a1), and Ppm1b (protein phosphatase 1B) and downstream (4125 kb) genes, Six3 and Six2 (Fig. 3). Camkmt, Prepl, Slc3a1, and Ppm1b are widely expressed in various tissues (Parvari et al., 2005), Six2 is in non-neural derivatives of neural crest origins (Oliver et al., 1995a), and Six3 is found in the ventral forebrain and eye (Oliver et al., 1995b). Therefore, attention was directed to Six3 because of SRB25 tissue specificity. Six3, a member of the Six gene family that has been identified as a vertebrate homolog of the Drosophila sine oculis gene, plays crucial roles in the development of brain and craniofacial structures. Six3−/− mouse embryos lack anterior forebrain and exhibit severe craniofacial abnormalities (Lagutin et al., 2003). In humans, SIX3 mutations have been associated with HPE, a defect in anterior midline formation with a spectrum of brain and craniofacial malformations (Wallis et al., 1999). HPE phenotypes overlap in several features reported for the Sox2 causative diseases, such as anophthalmia and SOD. Early Six3 expression is restricted to the anterior neural plate, and is later predominantly detected in the ventral forebrain, eye, and rostral non-neural tissues. Sox2 expression showed a broad distribution along the CNS axis, but at the forebrain level, was far more prominent in the ventral floor and dorsal roof (Fig. 4). Interestingly, Six3 mRNA was embedded within the Sox2 expression domain in the ventral forebrain (Fig. 4). In all of 7 transient transgenic embryos carrying SBR25, X-gal staining was detected in the ventral forebrain where Six3 is normally expressed (Fig. 3). To examine the expression pattern

B. Lee et al. / Developmental Biology 381 (2013) 491–501

495

Fig. 3. Identification of a Sox2-bound region as a Six3 forebrain enhancer: (Top) Genomic location of SBR25 (red). Close view of a 1-Mb genomic locus in band E4 of the mouse chromosome 17. Genomic locations and organizations including exons, introns and 5' to3' direction of nearest upstream (Camkmt, Prepl, Slc3a1, Ppmlb) and downstream (Six3, Six2) genes are shown in brown. (A–H) Time-course of Six3 (A–D) and SBR25::lacZ (E–H). At E8.5, Six3 expression is present in the eye field (arrow) and ventral forebrain (arrowhead) (A, A'), while SBR25 directed lacZ expression only in the ventral forebrain (arrowhead) albeit ectopic staining was occasionally detected (asterisk) (E, E'). At E9.5 –E12.5, Six3 expression is also detected in several brain compartments (B–D). X-gal staining driven by SBR25 is confined to the anterior diencephalon and its derivative hypothalamic region (F–H). (D, H) Heads were bisected sagitally along the midline prior to staining. Di, diencephalon; HY, hypothalamus; MB, midbrain; OP, olfactory placode; OV, optic vesicle; RP, Rathke's pouch; rTH, rostral thalamus; SP, subpallium; PreT, pretectum; PT, prethalamus; Tel, telencephalon.

Fig. 4. Comparison of Six3 and SoxB1 expression in the ventral forebrain: (A–F) Whole-mount in situ hybridization for of Six3 (A, D), Sox2 (B, E) and Sox3 (C, F) showing colocalization of Six3, Sox2 and Sox3 in the ventral forebrain. Six3 and Sox2 are also co-expressed in the optic vesicle and olfactory placode, while Sox3 expression is detected in the olfactory placode at low levels and is down-regulated normally in the optic vesicle at E10.5. Dashed lines (A–C) indicate the planes of transverse sections (D–F) through the forebrain at the level of the anterior hypothalamus.

of the SBR25 transgenic embryos at various stages, five independent stable mouse lines carrying the transgene were generated. At E8.5, Six3 is expressed in the most rostral border of the neural plate including the ventral forebrain and eye field (Fig. 3A, A') (Oliver et al., 1995b). This unique pattern of Six3 expression in the

ventral forebrain and eye is maintained at later stages (Fig. 3B, C). As distinct brain compartments emerge, in addition to the derivatives of the forebrain and eye, Six3 expression is also detected in other brain regions including prethalamus, rostral thalamus, pretectum, and ventral midbrain (Fig. 3D). In all transgenic embryos

496

B. Lee et al. / Developmental Biology 381 (2013) 491–501

from the five independent lines carrying the SBR25, lacZ reporter expression was similarly observed in the ventral forebrain, but not in the eye field (Fig. 3E, E'). At later stages, X-gal staining was present in the anterior diencephalon and its derivative hypothalamus where Six3 is normally expressed (Fig. 3F, H), indicating that the transgene faithfully recapitulates the expression pattern of Six3 in the ventral forebrain. Therefore, we concluded that SBR25 functions as a regulatory enhancer to control Six3 transcription in the ventral forebrain.

X-gal staining (Fig. 5F, G). The medaka regulatory element has been recently shown to control one of the two Six3 medaka homologs, Six3.2 (Conte and Bovolenta, 2007), and was found to be located far distant from SBR25. Transgenic mouse embryos carrying the medaka sequences containing module G, H and I (n¼0/7) or mouse counterpart (n¼ 0/7) failed to activate transgene expression in the forebrain (Supplementary Fig. 2). Given that vertebrate Six3 displays similar features of expression, these results indicated profound divergence of the regulatory mechanisms underlying the pattern of Six3 activation.

Six3 forebrain enhancer is functionally conserved Six3 forebrain enhancer activity is dependent on Sox2-binding sites We further characterized this enhancer by assessing the activity of orthologous sequences from divergent organisms. Blat searches using the UCSC genome browser (Multiz Alignments of 60 vertebrates) were performed to determine whether SBR25 is evolutionarily conserved. These comparative sequence analyses identified conserved sequences from 56 of 60 vertebrates that are placed at various distances from the Six3 coding region (Fig. 5). We cloned SBR25 sequences from human, chicken, and frog into the reporter cassette and examined the enhancer activity in transgenic mouse embryos. Strong lacZ expression in transgenic embryos carrying human (n ¼3/3), chicken (n ¼10/10) and frog SBR25 (n ¼3/5) sequences was detected in the ventral forebrain in a manner similar to mouse SBR25 (Fig. 5C–E), indicating functional conservation of the Six3 enhancer in these species. In contrast, SBR25 from teleost fishes differed significantly from the other vertebrates. Despite low conservation, we tested the enhancer activity in transgenic mouse embryos. None of the embryos carrying zebrafish (n ¼0/8) or medaka SBR25 (n¼ 0/7) showed X-gal staining in the forebrain despite the presence of ectopic

The finding that the Sox2-bound region functions as a Six3 regulatory element suggests that Sox2 may act upstream of Six3 in the ventral forebrain. To address this question, we first examined whether Sox2 binding site is required for Six3 forebrain enhancer activity. Because a variety of ChIP-associated genome-wide analyses do not pinpoint nucleotide sequences occupied by transcription factors, we searched for Sox2 binding sites by scanning the enhancer sequence using the rVISTA tool as well as by comparing the consensus site [(A/T)(A/T)CAA(A/T)G] manually. This analysis recognized four putative binding sites for Sox2 in the enhancer that were highly conserved in human, mouse, chicken and frog, but not in teleost fishes (S1–S4 in Fig. 6). To address the in vivo significance of the candidate binding sites on forebrain transcription, reporter constructs were generated harboring point mutations in each of the core recognition sequences. Due to the nature of random integration of transgenes into the genome, it is not feasible to discriminate between the effects of transgene silencing and mutation. Therefore, lacZ expression in variable ectopic

Fig. 5. Functional conservation of Six3 forebrain enhancer: (A) Multiz alignment comparing SBR25 sequences of human, dog, horse, opossum, chicken, frog, tetraodon, fugu, medaka and zebrafish (UCSC genome browser, http://genome.uscs.edu). (B) Comparison of the distance between SBR25 and the Six3 first exon in human, chicken, frog, zebrafish, and medaka. (C–G) SBR25 reporter activity derived from human (C; hg19 chr2:45031501-45032719), chicken (D; galGal4 chr3:25080030-25080913), frog (E; xenTro3 GL172661:1607059-1608352) zebrafish (F; danRer7 chr13:9896009-9896990), and medaka (G; oryLat2 chr15:15513062-15513890).

B. Lee et al. / Developmental Biology 381 (2013) 491–501

497

Fig. 6. Six3 forebrain enhancer activity is dependent on highly conserved Sox2 binding sites: A schematic of the reporter construct indicating the locations of the Sox2 binding sites (S1–S4) in mouse SBR25 is shown at the top. Below are parts of alignments of SBR25 sequences from mouse, human, chicken, and frog. Conserved Sox2 binding sites are shaded in yellow. (A–D) X-gal staining of transgenic embryos at E10.5 carrying reporter constructs with mutant DNA binding sites.

regions served as an internal control, and embryos that did not show X-gal staining in any places were not used to account for the effect of mutation. Transgenic embryos carrying the SBR25 with the mutated S1 site failed to activate lacZ in the ventral forebrain (n ¼7/7; Fig. 6A). The effect of mutating the S2 site was also dramatic as each of the transgenic embryos carrying the S2 mutation showed either a complete absence (n¼ 7/10) or very weak patchy (n ¼3/10) expression of lacZ in the ventral forebrain (Fig. 6B). In contrast, point mutations in the S3 (n ¼5/5) or S4 sites (n ¼7/10) had no consequences on transgene expression in the ventral forebrain (Fig. 6C, D). These results demonstrated that the Sox2 binding sites are critical for Six3 forebrain enhancer function. Sox2 directly activates the Six3 forebrain enhancer To further determine if the Sox2 protein directly regulates the Six3 forebrain enhancer, we performed electromobility shift assays to determine whether the binding sites S1 and S2 in the SBR25 could be bound by Sox2. CHO cell lysates transfected with Flagtagged Sox2 formed a specific complex when incubated with a radiolabeled SBR25 (S1). This protein-DNA complex was super shifted when exposed to anti-Flag antibody, but not control IgG (Fig. 7A), indicating that the binding of Sox2 to the S1 site of SBR25 was direct. We also evaluated the affinity of Sox2 for SBR25 (S1) compared to the mutated site SBR25 (ΔS1) and a previously identified binding site in the Fbx15 promoter. In the presence of excess wild-type SBR25 (S1) or Fbx15-derived unlabeled competitor, the majority of the radiolabeled SBR25 (S1) probe was displaced from Sox2, whereas when excess SBR25 (ΔS1) unlabeled competitor was introduced, marginal inhibitory effect was observed (Fig. 7A, C). We obtained similar results when testing the binding site S2 as the radiolabeled probe (Fig. 7B, D). We also confirmed Sox2 binding to SBR25 in vivo by ChIP-QPCR. SBR25 was significantly enriched in Sox2-bound chromatin, whereas a control sequence, 3.5 kb downstream of SBR25, was not enriched in Sox2bound chromatin (Fig. 7E).

Sox2 protein acts as a transcriptional activator in the nervous system. To determine if Sox2 is able to stimulate SBR25 enhancer activity, we carried out transient transfection assays in CHO cells by using wild type and mutant SBR25::lacZ constructs. Cotransfection of SBR25::lacZ with pcDNA3-Sox2 led to marked elevation of β-galactosidase activity (Fig. 7F). In contrast, SBR25::lacZ(ΔS1) and SBR25::lacZ(ΔS2), but not SBR25::lacZ(ΔS3) or SBR25::lacZ(ΔS4), showed significantly reduced lacZ activity (Fig. 7F), and furthermore, combined mutation of S1 and S2 abrogated activation of SBR25 enhancer (Fig. 7F). Taken together, these data demonstrated that Sox2 is a direct regulator of Six3 forebrain enhancer. Previous reports have shown the cooperation of Sox2 and other partner factors such as Oct3/4, Brn2 and Pax6 that bind DNA in the vicinity of the Sox2 site (Ambrosetti et al., 1997; Kamachi et al., 2001; Kondoh and Kamachi, 2010; Tanaka et al., 2004). Thus, we surveyed sequences around the Sox2 binding sites, S1 and S2, for consensus sites recognized by these factors. However we did not find the potential binding sites. The identity of binding partners for regulating the Six3 forebrain enhancer activity, therefore, remains to be determined. Six3 transcription in the ventral forebrain is down-regulated in SoxB1 mutants We next determined whether Sox2 is required to regulate Six3 expression. Homozygous Sox2 knockout embryos do not form epiblast and extraembryonic ectoderm properly and die soon after implantation (Avilion et al., 2003). As Sox2+/− display abnormal pituitary development (Kelberman et al., 2006), we examined the expression pattern of Six3 in the heterozygotes. Compared to controls, Six3 expression was similarly detected throughout the nervous system (data not shown). The SoxB1 subfamily comprises Sox1, Sox2, and Sox3 on the basis of phylogenetic analysis of HMG domains (Bowles et al., 2000; Pevny and Lovell-Badge, 1997). Because Sox2 and Sox3 are widely co-expressed in the nervous system including the ventral forebrain, share common transcriptional targets, and

498

B. Lee et al. / Developmental Biology 381 (2013) 491–501

Fig. 7. Sox2 binds directly to the Six3 forebrain enhancer: (A, B) EMSAs performed with CHO cell extracts transfected with pcDNA3-Flag (lane 1) or pcDNA3-Flag-Sox2 (lanes 2– 13) expression vectors and incubated with SBR25 (S1) (A) or SBR25 (S2) (B) -radiolabeled probes. Specific DNA-protein complexes were super shifted in the presence of antiFlag antibody (lane 4) but not nonspecific IgG (lane 5). (C, D) Graphical representation of the data in A and B. The relative intensities of the specific DNA-protein bands were determined and plotted against competitor concentration. (*P o0.01, Student's t-test). (E) ChIP from embryos using anti-Sox2 or IgG. QPCR results from three independent experiments indicate a significant enrichment for SBR25 DNA in Sox2 chromatin versus IgG chromatin DNAs. (*Po 0.01, Student's t-test). A negative control sequence, 3.5 kb downstream of SBR25 was not enriched in Sox2 chromatin. (F) Sox2 stimulates SBR25 activity in vitro. CHO cells were cotransfected with pcDNA3-Sox2 expression DNA and SBR25::lacZ, SBR25::lacZ(ΔS1), SBR25::lacZ(ΔS2), SBR25::lacZ(ΔS1,S2), SBR25::lacZ(ΔS3), SBR25::lacZ(ΔS4). pcDNA3-Sox2 activated wild-type SBR25::lacZ, compared to the empty expression plasmid. This stimulation by Sox2 was reduced in cells expressing SBR25::lacZ(ΔS1) or SBR25::lacZ(ΔS2), but not SBR25::lacZ(ΔS3) or SBR25::lacZ(ΔS4). Combined mutation of S1 and S2 abolished activation by Sox2. (*,**,*** P o0.01, Student's t-test). Each bar represents an average of three replicates. Each bar, s.d.

show similar regulatory functions (Fig. 4; Bergsland et al., 2011; Bylund et al., 2003; Kamachi et al., 1999; Wood and Episkopou, 1999), they could act in a redundant fashion to control Six3 expression. We thus examined the pattern of Six3 transcription in various SoxB1 compound mutant embryos. In Sox2+/−;Sox3+/− and Sox3y/− embryos, the overall expression pattern of Six3 appeared normal compared to wild type controls (Fig. 8B, C, F, and G). Remarkably, embryos with the combined loss of three of four wild type alleles of Sox2 and Sox3 (Sox2+/−;Sox3y/−) showed a profound loss of Six3 transcription in the ventral forebrain, while Six3 expression was similarly detected in other regions including the eye and olfactory placode (Fig. 8D). Upon sectioning Six3 expression was not detected in the ventral region of the hypothalamus (Fig. 8H). In Sox2+/−;Sox3y/− mutants, Nkx2.1 and Six6 expression were still detectable in the anterior diencephalon,

indicating that loss of Six3 expression was not due to lack of hypothalamic tissues (Supplementary Fig. 3; Lee et al., 2012). Therefore, these results suggested that Sox2 and Sox3 function redundantly to control Six3 transcription specifically in the ventral forebrain.

Discussion In this study, we describe a functional genomic approach to the analysis of Sox2 occupancy. By coupling ChIP-Display with transgenic reporter assays, we attempted to identify genomic locations occupied by Sox2 protein in the developing forebrain. Despite less high throughput compared to comprehensive ChIP-based location

B. Lee et al. / Developmental Biology 381 (2013) 491–501

499

Fig. 8. Six3 expression is disrupted in SoxB1 compound mutants: Whole-mount in situ hybridization for Six3 in wild-type (A, E) and SoxB1 mutant embryos (B–D, F–H) at E10.5. Six3 transcription was similarly observed in Sox2+/−;Sox3+/− and Sox2+/+;Sox3y/− embryos (B, C, F, G). In contrast, compared to control, Sox2+/−;Sox3y/− embryos exhibited an almost complete lack of Six3 expression in the ventral forebrain (D, H). Dashed lines (A–D) indicate the planes of transverse sections (E–H) through the forebrain at the level of the anterior diencephalon.

approaches such as ChIP-ChIP and ChIP-Seq, ChIP -Display proved successful in identifying novel Sox2-bound targets that were forebrain -specific. The strength of our approach relied on combining ChIP location analysis and functional in vivo assays, thereby providing a direct connection between sequence and function. Microarray expression profiling has been used to measure the actual changes of gene expression under the control of a transcription factor, but alone is unable to determine if the affected genes are direct or indirect targets. Recently, the combined analysis of gene expression profiling and ChIP based location is emerging as an effective tool to specifically identify the list of transcriptional targets (Zecchini and Mills, 2009). However it is unlikely to be beneficial in cases when nearest genes are closely dispersed and show similar expression changes. Therefore, further detailed experiments performed as with SBR25 are also required to ascertain a direct link between transcription factor binding and gene association. Our analysis of Sox2 occupied regions shows that not all SBRs are targeted by Sox2 in ES cell or their derivatives. In addition, there are also considerable differences in target recognition of Sox2 among ES and their derivative neural progenitor cells (Bergsland et al., 2011; Chen et al., 2008; Peterson et al., 2012). This indicated that transcriptional regulation by Sox2 is not fixed, but dynamically changes as developmental programs progress. For example, two Sox2-bound regions SBR55 and SBR45 overlapped with previously identified Shh regulatory elements, SBE2 and SBE3, respectively (Supplementary Table 1; Jeong et al., 2006). These elements, which regulate Shh transcription in distinct regions of the forebrain, required direct Sox2 binding and activation (Favaro et al., 2009; Zhao et al., 2012), but were not Sox2targeted in ES or their derivatives. SBR59 corresponded to an intron region that controls transcription of Nestin in the neural tube (Supplementary Table 1). This Nestin neural enhancer contained essential Sox binding sites (Tanaka et al., 2004), but was not enriched with Sox2 ChIP in ES or their derivatives. However, it remains to be determined how this shift in target recognition occurs during the progression of developmental processes. Previous studies suggested that Sox2 functions are dependent on the cooperation of partner factors that bind DNA near the Sox2 binding site (Kondoh and Kamachi, 2010). Recent genome-wide

studies of partner factor binding, such as Pax6 and Chd7, revealed transcriptional targets in embryonic neural tissues or neural stem cells (Engelen et al., 2011, Xie et al., 2013). Chd7, a chromatin remodeling ATPase, was shown to interact with Sox2 and cooccupy half of the genomic regions bound by Sox2 in neural stem cells. However, forebrain-specific SBRs were not targeted by these cofactors. Therefore, other tissue -specific binding partners are likely to participate in Sox2 regulation in the forebrain. Elucidating the molecular mechanism by which its binding partner factors cooperate with Sox2 to select target genes will uncover specific roles of Sox2 in CNS development. In determining genomic regions occupied by Sox2 we found a novel interaction between Sox2 HMG protein and Six3 homeoprotein during forebrain development. Six3 acts as a transcriptional activator or repressor depending on cellular or tissue context (Lagutin et al., 2003, Liu et al., 2006, Zhu et al., 2002). Six3 was shown to protect the anterior neural ectoderm from the posteriorising function of Wnt1 via repressing its transcription (Lagutin et al., 2003). In contrast, Six3 was shown to positively regulate Shh transcription in the ventral forebrain (Geng et al., 2008;, Jeong et al., 2008) and Pax6 and Sox2 in the developing lens (Liu et al., 2006). While progress has been made in deciphering the functional role of Six3 as a transcription factor, little is known about the mechanisms involved in activating Six3 transcription during brain development. Six3 is expressed dynamically in various regions of the brain and non-neural tissues from early embryonic stages to adult. The restricted pattern of the reporter activity of SBR25 in the anterior diencephalon suggested the presence of multiple enhancers responsible for controlling Six3 transcription in other expression domains. A previous study using medaka embryos identified cis-regulatory modules that function as enhancers and silencers to control the entire Six3.2 distribution (Conte and Bovolenta, 2007). In medaka embryos, the human counterpart was found to drive a similar pattern of reporter expression. In mouse embryos, however, the medaka enhancer, its mouse counterpart, or teleost SBR25 sequences did not direct reporter expression in any of the Six3 expression domains. Interestingly, despite the presence of other medaka SoxB1 members, knock-down of Sox2 alone was shown to result in loss of Six3.2 expression throughout the brain and eye (Beccari et al., 2012).

500

B. Lee et al. / Developmental Biology 381 (2013) 491–501

This observation was different from the case of mouse embryos in that the combined loss of three of four wild type alleles of Sox2 and Sox3 failed to activate Six3 expression in the ventral forebrain. Taken together, these results demonstrated that the regulatory trans-acting function, but not the cis-acting structure may be conserved among these vertebrate species. Similar regulatory divergence reported in other instances, such as the regulatory elements of Ret, Shh, and HoxC8 also showed that function or structure is modified during the evolutionary process (Anand et al., 2003; Epstein et al., 1999; Fisher et al., 2006; Müller et al., 1999). Therefore, one can not necessarily predict regulatory function and architecture of an enhancer by extrapolation of the cisand trans-acting elements observed in one species. Six3-causative human and mouse phenotypes overlap in several features resulting from Sox2 mutations. Conditional ablation of Six3 disrupted eye morphogenesis, causing anophthalmia and microphthalmia (Liu et al., 2010). In these optic areas, Six3 is required to activate Sox2 expression in the developing retina and lens. Sox2 -deficiency also resulted in loss of retinal neural progenitors as well as a failure of lens induction (Taranova et al., 2006; Smith et al., 2009). In addition to the eye defects, Six3 and Sox2 have been shown to play critical roles in rostral forebrain development. Like humans, a 50% reduction of Six3 function in mouse embryos, albeit with low phenotype penetrance and genetic background dependence, gives rise to telencephalic midline anomalies, including absence of septum pellucidum and corpus callosum, which also manifest as defects in SOD (Geng et al., 2008). Conditional removal of Six3 from neural progenitors using Nestin-Cre leads to loss of the pituitary and disrupts normal formation of hypothalamic nucleus (VanDunk et al., 2011). Analysis of Six3+/−;Hesx1Cre/+ compound mutant embryos found pituitary defects including dysmorphic and bifurcated Rathke's pouch, while Hesx1Cre/+did not, revealing synergistic interaction of Six3 and another SOD-causative gene, Hesx1, in normal anterior pituitary development (Gaston-Massuet et al., 2008). Similar to this mutant, bifurcated anterior lobes have also been observed in Sox2+/− and Sox3y/−embryos (Kelberman et al., 2006; Rizzoti et al., 2004). Severe alterations in forebrain development were also found in Sox2 hypomorphic mutants, Sox2F/F;Hesx1-Cre embryos and Sox2F/F;Foxg1-Cre (Ferri et al., 2013; Jayakody et al., 2012; Langer et al., 2012). Interestingly, these abnormalities resulting from disruption of Six3 or Sox2 functions are likely to be mediated partially by reduced Shh, another HPE-causative gene. A portion of Six3+/ki and all of Six3+/ki;Shh+/−embryos failed to express Shh in the ventral forebrain (Geng et al., 2008). Similarly, Shh expression was also lost in the rostral diencephalon of Sox2+/−; Sox3y/− compound mutant embryos and in the ventral telencephalon of Sox2F/F;Foxg1-Cre embryos (Ferri et al., 2013; Zhao et al., 2012). Interestingly, conditional ablation of Shh in the presumptive hypothalamus resulted in SOD (Zhao et al., 2012). Moreover, the distinct transcription factors, Six3 and SoxB1, were shown to be direct upstream activators of Shh transcription in the ventral forebrain (Geng et al., 2008; Jeong et al., 2008; Zhao et al., 2012). As SoxB1 and Six3 are expressed in multiple CNS regions from early stages, it will be important to determine to what extent each spatiotemporal source of these transcription factors may be involved during normal forebrain development and in the pathogenesis of the forebrain defects.

Acknowledgments We thank Dr. Guillermo Oliver for constructive comments on the paper. This work was supported by the Future-Based Technology Development Program (NRF-2010-0020410) and the Basic Science Research Program (NRF-2012R1A1A2003749) through

the National Research Foundation of Korea funded by the Ministry of Science, ICT & Future Planning.

Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ydbio.2013.06.016.

References Ambrosetti, D.C., Basilico, C., Dailey, L., 1997. Synergistic activation of the fibroblast growth factor 4 enhancer by Sox2 and Oct-3 depends on protein-protein interactions facilitated by a specific spatial arrangement of factor binding sites. Mol. Cell. Biol. 17, 6321–6329. Anand, S., Wang, W.C., Powell, D.R., Bolanowski, S.A., Zhang, J., Ledje, C., Pawashe, A.B., Amemiya, C.T., Shashikant, C.S., 2003. Divergence of Hoxc8 early enhancer parallels diverged axial morphologies between mammals and fishes. Proc. Natl. Acad. Sci. USA 100, 15666–15669. Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., Lovell-Badge, R., 2003. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 17, 126–140. Barski, A., Frenkel, B., 2004. ChIP Display: novel method for identification of genomic targets of transcription factors. Nucleic Acids Res. 32, e104. Beccari, L., Conte, I., Cisneros, E., Bovolenta, P., 2012. Sox2-mediated differential activation of Six3.2 contributes to forebrain patterning. Development 139, 151–164. Bergsland, M., Ramsköld, D., Zaouter, C., Klum, S., Sandberg, R., Muhr, J., 2011. Sequentially acting Sox transcription factors in neural lineage development. Genes Dev. 25, 2453–2464. Bowles, J., Schepers, G., Koopman, P., 2000. Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators. Dev. Biol 227, 239–255. Bylund, M., Andersson, E., Novitch, B.G., Muhr, J., 2003. Vertebrate neurogenesis is counteracted by Sox1-3 activity. Nat. Neurosci. 6, 1162–1168. Chen, X., Xu, H., Yuan, P., Fang, F., Huss, M., Vega, V.B., Wong, E., Orlov, Y.L., Zhang, W., Jiang, J., Loh, Y.H., Yeo, H.C., Yeo, Z.X., Narang, V., Govindarajan, K.R., Leong, B., Shahab, A., Ruan, Y., Bourque, G., Sung, W.K., Clarke, N.D., Wei, C.L., Ng, H.H., 2008. Integration of external signaling pathways with the core transcriptional network in embryonic stem cells. Cell 133, 1106–1117. Conte, I., Bovolenta, P., 2007. Comprehensive characterization of the cis-regulatory code responsible for the spatio-temporal expression of olSix3.2 in the developing medaka forebrain. Genome Biol. 8, R137. Danno, H., Michiue, T., Hitachi, K., Yukita, A., Ishiura, S., Asashima, M., 2008. Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression. Proc. Natl. Acad. Sci. USA 105, 5408–5413. Donner, A.L., Episkopou, V., Maas, R.L., 2007. Sox2 and Pou2f1 interact to control lens and olfactory placode development. Dev. Biol. 303, 784–799. Engelen, E., Akinci, U., Bryne, J.C., Hou, J., Gontan, C., Moen, M., Szumska, D., Kockx, C., van Ijcken, W., Dekkers, D.H., Demmers, J., Rijkers, E.J., Bhattacharya, S., Philipsen, S., Pevny, L.H., Grosveld, F.G., Rottier, R.J., Lenhard, B., Poot, R.A., 2011. Sox2 cooperates with Chd7 to regulate genes that are mutated in human syndromes. Nat. Genet. 43, 607–611. Epstein, D.J., McMahon, A.P., Joyner, A.L., 1999. Regionalization of Sonic hedgehog transcription along the anteroposterior axis of the mouse central nervous system is regulated by Hnf3-dependent and -independent mechanisms. Development 126, 281–292. Fantes, J., Ragge, N.K., Lynch, S.A., McGill, N.I., Collin, J.R., Howard-Peebles, P.N., Hayward, C., Vivian, A.J., Williamson, K., van Heyningen, V., FitzPatrick, D.R., 2003. Mutations in SOX2 cause anophthalmia. Nat. Genet. 33, 461–463. Favaro, R., Valotta, M., Ferri, A.L.M., Latorre, E., Mariani, J., Giachino, C., Lancini, C., Tosetti, V., Ottolenghi, S., Taylor, V., Nicolis, S.K., 2009. Hippocampal development and neural stem cell maintenance require Sox2-dependent regulation of Shh. Nat. Neurosci. 12, 1248–1256. Ferri, A.L., Cavallaro, M., Braida, D., Di Cristofano, A., Canta, A., Vezzani, A., Ottolenghi, S., Pandolfi, P.P., Sala, M., DeBiasi, S., Nicolis, S.K., 2004. Sox2 deficiency causes neurodegeneration and impaired neurogenesis in the adult mouse brain. Development 131, 3805–3819. Ferri, A., Favaro, R., Beccari, L., Bertolini, J., Mercurio, S., Nieto-Lopez, F., Verzeroli, C., La Regina, F., Tonelli, De Pietri, Ottolenghi, D., Bovolenta, S., Nicolis, S.K., P., 2013. Sox2 is required for embryonic development of the ventral telencephalon through the activation of the ventral determinants Nkx2.1 and Shh. Development 140, 1250–1261. Fisher, S., Grice, E.A., Vinton, R.M., Bessling, S.L., McCallion, A.S., 2006. Conservation of RET regulatory function from human to zebrafish without sequence similarity. Science 312, 276–279. Gaston-Massuet, C., Andoniadou, C.L., Signore, M., Sajedi, E., Bird, S., Turner, J.M., Martinez-Barbera, J.P., 2008. Genetic interaction between the homeobox transcription factors HESX1 and SIX3 is required for normal pituitary development. Dev. Biol. 324, 322–333.

B. Lee et al. / Developmental Biology 381 (2013) 491–501

Geng, X., Speirs, C., Lagutin, O., Inbal, A., Liu, W., Solnica-Krezel, L., Jeong, Y., Epstein, D.J., Oliver, G., 2008. Haploinsufficiency of Six3 fails to activate Sonic hedgehog expression in the ventral forebrain and causes holoprosencephaly. Dev. Cell 15, 236–247. Graham, V., Khudyakov, J., Ellis, P., Pevny, L., 2003. SOX2 functions to maintain neural progenitor identity. Neuron 39, 749–765. Jayakody, S.A., Andoniadou, C.L., Gaston-Massuet, C., Signore, M., Cariboni, A., Bouloux, P.M., Le Tissier, P., Pevny, L.H., Dattani, M.T., Martinez-Barbera, J.P., 2012. SOX2 regulates the hypothalamic-pituitary axis at multiple levels. J. Clin. Invest. 122, 3635–3646. Jeong, Y., El-Jaick, K., Roessler, E., Muenke, E., Epstein, D.J., 2006. A functional screen for sonic hedgehog regulatory elements across a 1 Mb interval identifies longrange ventral forebrain enhancers. Development 133, 761–772. Jeong, Y., Leskow, F.C., El-Jaick, K., Roessler, E., Muenke, M., Yocum, A., Dubourg, C., Li, X., Geng, X., Oliver, G., Epstein, D.J., 2008. Regulation of a remote Shh forebrain enhancer by the Six3 homeoprotein. Nat. Genet. 40, 1348–1353. Lee, B., Rizzoti, K., Kwon, D.S., Kim, S.Y., Oh, S., Epstein, D.J., Son, Y., Yoon, J., Baek, K., Jeong, Y., 2012. Direct transcriptional regulation of Six6 is controlled by SoxB1 binding to a remote forebrain enhancer. Dev. Biol. 366, 393–403. Kamachi, Y., Cheah, K.S., Kondoh, H., 1999. Mechanism of regulatory target selection by the SOX high-mobility-group domain proteins as revealed by comparison of SOX1/2/3 and SOX9. Mol. Cell. Biol. 19, 107–120. Kamachi, Y., Uchikawa, M., Tanouchi, A., Sekido, R., Kondoh, H., 2001. Pax6 and SOX2 form a co-DNA-binding partner complex that regulates initiation of lens development. Genes. Dev. 15, 1272–1286. Kelberman, D., Dattani, M.T., 2007. Genetics of septo-optic dysplasia. Pituitary 10, 393–407. Kelberman, D., Rizzoti, K., Avilion, A., Bitner-Glindzicz, M., Cianfarani, S., Collins, J., Chong, W.K., Kirk, J.M., Achermann, J.C., Ross, R., Carmignac, D., Lovell-Badge, R., Robinson, I.C., Dattani, M.T., 2006. Mutations within Sox2/SOX2 are associated with abnormalities in the hypothalamo-pituitary-gonadal axis in mice and humans. J. Clin. Invest. 116, 2442–2455. Kishi, M., Mizuseki, K., Sasai, N., Yamazaki, H., Shiota, K., Nakanishi, S., Sasai, Y., 2000. Requirement of Sox2-mediated signaling for differentiation of early Xenopus neuroectoderm. Development 127, 791–800. Kondoh, H., Kamachi, Y., 2010. SOX-partner code for cell specification: regulatory target selection and underlying molecular mechanisms. Int. J. Biochem. Cell Biol. 42, 391–399. Lagutin, O.V., Zhu, C.C., Kobayashi, D., Topczewski, J., Shimamura, K., Puelles, L., Russell, H.R., McKinnon, P.J., Solnica-Krezel, L., Oliver, G., 2003. Six3 repression of Wnt signaling in the anterior neuroectoderm is essential for vertebrate forebrain development. Genes Dev. 17, 368–379. Langer, L., Taranova, O., Sulik, K., Pevny, L., 2012. SOX2 hypomorphism disrupts development of the prechordal floor and optic cup. Mech. Dev. 129, 1–12. Lee, B., Rizzoti, K., Kwon, D.S., Kim, S.Y., Oh, S., Epstein, D.J., Son, Y., Yoon, J., Baek, K., Jeong, Y., 2012. Direct transcriptional regulation of Six6 is controlled by SoxB1 binding to a remote forebrain enhancer. Dev. Biol. 366, 393–403. Liu, W., Lagutin, O.V., Mende, M., Streit, A., Oliver, G., 2006. Six3 activation of Pax6 expression is essential for mammalian lens induction and specification. EMBO J. 25, 5383–5395. Liu, W., Lagutin, O., Swindell, E., Jamrich, M., Oliver, G., 2010. Neuroretina specification in mouse embryos requires Six3-mediated suppression of Wnt8b in the anterior neural plate. J. Clin. Invest. 120, 3568–3577. Müller, F., Chang, B., Albert, S., Fischer, N., Tora, L., Strähle, U., 1999. Intronic enhancers control expression of zebrafish sonic hedgehog in floor plate and notochord. Development 126, 2103–2116. Oliver, G., Wehr, R., Jenkins, N.A., Copeland, N.G., Cheyette, B.N., Hartenstein, V., Zipursky, S.L., Gruss, P., 1995a. Homeobox genes and connective tissue patterning. Development 121, 693–705.

501

Oliver, G., Mailhos, A., Wehr, R., Copeland, N.G., Jenkins, N.A., Gruss, P., 1995b. Six3, a murine homologue of the sine oculis gene, demarcates the most anterior border of the developing neural plate and is expressed during eye development. Development 121, 4045–4055. Parvari, R., Gonen, Y., Alshafee, I., Buriakovsky, S., Regev, K., Hershkovitz, E., 2005. The 2p21 deletion syndrome: characterization of the transcription content. Genomics 86, 195–211. Pevny, L., Lovell-Badge, R., 1997. Sox genes find their feet. Curr. Opin. Genet. Dev. 7, 338–344. Pevny, L., Placzek, M., 2005. SOX genes and neural progenitor identity. Curr. Opin. Neurobiol. 15, 7–13. Peterson, K.A., Nishi, Y., Ma, W., Vedenko, A., Shokri, L., Zhang, X., McFarlane, M., Baizabal, J.M., Junker, J.P., van Oudenaarden, A., Mikkelsen, T., Bernstein, B.E., Bailey, T.L., Bulyk, M.L., Wong, W.H., McMahon, A.P., 2012. Neural-specific Sox2 input and differential Gli-binding affinity provide context and positional information in Shh-directed neural patterning. Genes. Dev. 26, 2802–2816. Rizzoti, K., Brunelli, S., Carmignac, D., Thomas, P.Q., Robinson, I.C., Lovell-Badge, R., 2004. SOX3 is required during the formation of the hypothalamo-pituitary axis. Nat. Genet. 36, 247–255. Smith, A.N., Miller, L.A., Radice, G., Ashery-Padan, R., Lang, R.A., 2009. Stagedependent modes of Pax6-Sox2 epistasis regulate lens development and eye morphogenesis. Development 136, 2977–2985. Takahashi, K., Yamanaka, S., 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676. Tanaka, S., Kamachi, Y., Tanouchi, A., Hamada, H., Jing, N., Kondoh, H., 2004. Interplay of SOX and POU factors in regulation of the Nestin gene in neural primordial cells. Mol. Cell. Biol. 24, 8834–8846. Taranova, O.V., Magness, S.T., Fagan, B.M., Wu, Y., Surzenko, N., Hutton, S.R., Pevny, L.H., 2006. SOX2 is a dose-dependent regulator of retinal neural progenitor competence. Genes. Dev. 20, 1187–1202. VanDunk, C., Hunter, L.A., Gray, P.A., 2011. Development, maturation, and necessity of transcription factors in the mouse suprachiasmatic nucleus. J. Neurosci. 31, 6457–6467. Wallis, D.E., Roessler, E., Hehr, U., Nanni, L., Wiltshire, T., Richieri-Costa, A., Gillessen-Kaesbach, G., Zackai, E.H., Rommens, J., Muenke, M., 1999. Mutations in the homeodomain of the human SIX3 gene cause holoprosencephaly. Nat. Genet. 22, 196–198. Williamson, K.A., Hever, A.M., Rainger, J., Rogers, R.C., Magee, A., Fiedler, Z., Keng, W.T., Sharkey, F.H., McGill, N., Hill, C.J., Schneider, A., Messina, M., Turnpenny, P. D., Fantes, J.A., van Heyningen, V., FitzPatrick, D.R., 2006. Mutations in SOX2 cause anophthalmia–esophageal–genital (AEG) syndrome. Hum. Mol. Genet. 15, 1413–1422. Wood, H.B., Episkopou, V., 1999. Comparative expression of the mouse Sox1, Sox2 and Sox3 genes from pre-gastrulation to early somite stages. Mech. Dev. 86, 197–201. Xie, Q., Yang, Y., Huang, J., Ninkovic, J., Walcher, T., Wolf, L., Vitenzon, A., Zheng, D., Götz, M., Beebe, D.C., Zavadil, J., Cvekl, A., 2013. Pax6 interactions with chromatin and identification of its novel direct target genes in lens and forebrain. PLoS One 8, e54507. Yamanaka, S., 2012. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell 10, 678–684. Zecchini, V., Mills, I.G., 2009. Putting chromatin immunoprecipitation into context. J. Cell Biochem. 107, 19–29. Zhao, L., Zevallos, S.E., Rizzoti, K., Jeong, Y., Lovell-Badge, R., Epstein, D.J.., 2012. Disruption of SoxB1-dependent Sonic hedgehog expression in the hypothalamus causes septo-optic dysplasia. Dev. Cell. 22, 585–596. Zhu, C.C., Dyer, M.A., Uchikawa, M., Kondoh, H., Lagutin, O.V., Oliver, G., 2002. Six3mediated auto repression and eye development requires its interaction with members of the Groucho-related family of co-repressors. Development 129, 2835–2849.